ID: 956582180

View in Genome Browser
Species Human (GRCh38)
Location 3:70826267-70826289
Sequence CTGGATGATACCCTTTATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956582180_956582186 30 Left 956582180 3:70826267-70826289 CCTACATAAAGGGTATCATCCAG No data
Right 956582186 3:70826320-70826342 AATTAATATGACCAAATGGGTGG No data
956582180_956582185 27 Left 956582180 3:70826267-70826289 CCTACATAAAGGGTATCATCCAG No data
Right 956582185 3:70826317-70826339 TGCAATTAATATGACCAAATGGG No data
956582180_956582184 26 Left 956582180 3:70826267-70826289 CCTACATAAAGGGTATCATCCAG No data
Right 956582184 3:70826316-70826338 GTGCAATTAATATGACCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956582180 Original CRISPR CTGGATGATACCCTTTATGT AGG (reversed) Intergenic
No off target data available for this crispr