ID: 956585984

View in Genome Browser
Species Human (GRCh38)
Location 3:70865517-70865539
Sequence GGTAATGTATTCACAGGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956585979_956585984 27 Left 956585979 3:70865467-70865489 CCCATCTCAAGATTCTTAACTTC 0: 3
1: 27
2: 127
3: 444
4: 1120
Right 956585984 3:70865517-70865539 GGTAATGTATTCACAGGCATTGG No data
956585978_956585984 28 Left 956585978 3:70865466-70865488 CCCCATCTCAAGATTCTTAACTT 0: 11
1: 87
2: 288
3: 692
4: 1256
Right 956585984 3:70865517-70865539 GGTAATGTATTCACAGGCATTGG No data
956585977_956585984 29 Left 956585977 3:70865465-70865487 CCCCCATCTCAAGATTCTTAACT No data
Right 956585984 3:70865517-70865539 GGTAATGTATTCACAGGCATTGG No data
956585980_956585984 26 Left 956585980 3:70865468-70865490 CCATCTCAAGATTCTTAACTTCA 0: 3
1: 25
2: 151
3: 460
4: 1098
Right 956585984 3:70865517-70865539 GGTAATGTATTCACAGGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956585984 Original CRISPR GGTAATGTATTCACAGGCAT TGG Intergenic
No off target data available for this crispr