ID: 956590383

View in Genome Browser
Species Human (GRCh38)
Location 3:70908333-70908355
Sequence CAGTTGACCTGGATGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956590377_956590383 9 Left 956590377 3:70908301-70908323 CCATGCCTGGCCAGAGCATTGCT No data
Right 956590383 3:70908333-70908355 CAGTTGACCTGGATGGAAGTGGG No data
956590378_956590383 4 Left 956590378 3:70908306-70908328 CCTGGCCAGAGCATTGCTTTGAT No data
Right 956590383 3:70908333-70908355 CAGTTGACCTGGATGGAAGTGGG No data
956590379_956590383 -1 Left 956590379 3:70908311-70908333 CCAGAGCATTGCTTTGATGAAAC No data
Right 956590383 3:70908333-70908355 CAGTTGACCTGGATGGAAGTGGG No data
956590376_956590383 12 Left 956590376 3:70908298-70908320 CCACCATGCCTGGCCAGAGCATT No data
Right 956590383 3:70908333-70908355 CAGTTGACCTGGATGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956590383 Original CRISPR CAGTTGACCTGGATGGAAGT GGG Intergenic
No off target data available for this crispr