ID: 956593516

View in Genome Browser
Species Human (GRCh38)
Location 3:70942298-70942320
Sequence TGCACCCAGACCCTCGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956593510_956593516 26 Left 956593510 3:70942249-70942271 CCTGTGGTATTAGCTTATCTGGG No data
Right 956593516 3:70942298-70942320 TGCACCCAGACCCTCGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956593516 Original CRISPR TGCACCCAGACCCTCGGAGA AGG Intergenic
No off target data available for this crispr