ID: 956593851

View in Genome Browser
Species Human (GRCh38)
Location 3:70945450-70945472
Sequence GTGCAATGCATGATCCAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956593845_956593851 16 Left 956593845 3:70945411-70945433 CCCTTCCCCACTGTTGTTGGTCA No data
Right 956593851 3:70945450-70945472 GTGCAATGCATGATCCAGGTTGG No data
956593849_956593851 9 Left 956593849 3:70945418-70945440 CCACTGTTGTTGGTCATTGTGAT No data
Right 956593851 3:70945450-70945472 GTGCAATGCATGATCCAGGTTGG No data
956593848_956593851 10 Left 956593848 3:70945417-70945439 CCCACTGTTGTTGGTCATTGTGA No data
Right 956593851 3:70945450-70945472 GTGCAATGCATGATCCAGGTTGG No data
956593846_956593851 15 Left 956593846 3:70945412-70945434 CCTTCCCCACTGTTGTTGGTCAT No data
Right 956593851 3:70945450-70945472 GTGCAATGCATGATCCAGGTTGG No data
956593847_956593851 11 Left 956593847 3:70945416-70945438 CCCCACTGTTGTTGGTCATTGTG No data
Right 956593851 3:70945450-70945472 GTGCAATGCATGATCCAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956593851 Original CRISPR GTGCAATGCATGATCCAGGT TGG Intergenic
No off target data available for this crispr