ID: 956594333

View in Genome Browser
Species Human (GRCh38)
Location 3:70949500-70949522
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956594328_956594333 -10 Left 956594328 3:70949487-70949509 CCGGGGGATGGGGCATGGAGTGG No data
Right 956594333 3:70949500-70949522 CATGGAGTGGGGAGTAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr