ID: 956594975

View in Genome Browser
Species Human (GRCh38)
Location 3:70957676-70957698
Sequence CATGGTATGCAGAAATGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956594975_956594979 1 Left 956594975 3:70957676-70957698 CCATCACATTTCTGCATACCATG 0: 1
1: 0
2: 1
3: 16
4: 196
Right 956594979 3:70957700-70957722 TTGGGACCCCCCCAAAGCCCAGG 0: 1
1: 0
2: 1
3: 12
4: 166
956594975_956594980 2 Left 956594975 3:70957676-70957698 CCATCACATTTCTGCATACCATG 0: 1
1: 0
2: 1
3: 16
4: 196
Right 956594980 3:70957701-70957723 TGGGACCCCCCCAAAGCCCAGGG 0: 1
1: 0
2: 4
3: 32
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956594975 Original CRISPR CATGGTATGCAGAAATGTGA TGG (reversed) Intronic
903311831 1:22465030-22465052 CCAGGTATGCAGACAAGTGAAGG + Intronic
905104420 1:35555743-35555765 TGTGGTAGGCAGAAATGTGTTGG - Intronic
905978257 1:42197154-42197176 CATTGTATGCAGAGTTTTGAGGG - Intronic
906143398 1:43546491-43546513 CATGGTTGGCAGGAAGGTGAAGG + Intronic
906700655 1:47855660-47855682 CTTCCTATGCTGAAATGTGATGG + Intronic
907733005 1:57086098-57086120 CAGGGGATGCAGAATTTTGAAGG + Intronic
908271511 1:62427164-62427186 CATGTTATTTAGACATGTGAAGG - Intergenic
908993798 1:70127658-70127680 TAAGGCATGCAGAAATGAGAAGG + Intronic
909398970 1:75204589-75204611 CTTGGGAGGCTGAAATGTGAGGG - Exonic
911256733 1:95641711-95641733 CATGGTATGAAGCAATGTCCTGG + Intergenic
914063987 1:144230390-144230412 CATGGTATGCCTGAATTTGAAGG + Intergenic
914115163 1:144735964-144735986 CATGGTATGCCTGAATTTGAAGG - Intergenic
915335410 1:155138095-155138117 CATGGTAAGCACAACTGGGATGG + Exonic
917708292 1:177657268-177657290 CCTGCTTTGCAGAAATGTGTTGG - Intergenic
920814155 1:209315263-209315285 AATGGTTTGCAAAAATGTGTTGG - Intergenic
920920481 1:210293653-210293675 CATGGTCTGCAGAAACCTGAAGG - Intergenic
921885594 1:220302085-220302107 CACAGTATGCAGAAATGGGAAGG - Intergenic
1069119905 10:64556726-64556748 CATAGCATTCAGAATTGTGATGG + Intergenic
1069200148 10:65604122-65604144 CATGGAATGGAGAAATATGCAGG + Intergenic
1071056812 10:81520765-81520787 AATGGGATGCTGAAGTGTGAGGG + Intergenic
1071082148 10:81825195-81825217 TATGATATGCAGAAATGTTGGGG - Intergenic
1071141914 10:82519485-82519507 CATGGTTTAAATAAATGTGATGG - Intronic
1071938113 10:90553089-90553111 TATGGTATACAAAAATTTGAAGG - Intergenic
1072752814 10:97995523-97995545 AATGGTATGCAGACCTCTGAAGG + Intronic
1078619709 11:12895814-12895836 CATGTTATTTAGAAATGTGGAGG - Intronic
1078912515 11:15746260-15746282 CCTGGGATGCAGAAATCTGAAGG - Intergenic
1079517306 11:21284416-21284438 GATGGGATGCAAAAAAGTGATGG + Intronic
1082755369 11:57070121-57070143 CAAGATGTGCAGAAATATGAGGG - Intergenic
1084165085 11:67371855-67371877 GGTGGTGTGCAGAAGTGTGACGG + Intronic
1087679282 11:101201122-101201144 CATGGTATGAAGAAAGGAGCTGG + Intergenic
1088087197 11:105995717-105995739 CTTGGTATGAAAAAATTTGATGG - Intronic
1088577346 11:111284743-111284765 CATGCTAGGCAGTAATGAGATGG + Intronic
1089790628 11:120940935-120940957 CATGGAATGCAGAAAAGGGCAGG - Intronic
1092167606 12:6352597-6352619 CAGGGTATACAGAACTGGGATGG - Intronic
1093149014 12:15600105-15600127 TATGGTAAGCACAAATATGAAGG + Intergenic
1096000068 12:48122059-48122081 CATAGCATGTAGTAATGTGAGGG + Intronic
1099562779 12:84198734-84198756 GATTGTTGGCAGAAATGTGAGGG - Intergenic
1099755574 12:86843959-86843981 CATGCTATGAAAAAATGTTATGG + Intergenic
1099867041 12:88295943-88295965 CATTGTATGAACAAATGTAATGG + Intergenic
1100200763 12:92295700-92295722 CATGGCATGAAGAGATGGGATGG + Intergenic
1101203638 12:102463218-102463240 CACGGAATGAAGAAATTTGAAGG - Intronic
1101780984 12:107835349-107835371 TCTGAAATGCAGAAATGTGAAGG - Intergenic
1108263093 13:48678022-48678044 CTTGGTATGGAGAAATGTGGTGG - Intronic
1109081953 13:57914847-57914869 CATGATAAGTAGAAATTTGAGGG + Intergenic
1109856835 13:68141333-68141355 CATTATATGCAGAAATGACATGG + Intergenic
1110006211 13:70273897-70273919 CATGGTATTCAGAGATGGAAAGG - Intergenic
1110737270 13:78951626-78951648 CATGTTATGTAGAAATATTAGGG - Intergenic
1111418708 13:87981182-87981204 TCTGGTATTCAGAAATATGAAGG - Intergenic
1112661492 13:101514179-101514201 CATTGTATGAAGAAGTGTGTTGG + Intronic
1113215778 13:108039413-108039435 CCTGGTAGGCAGAAATGCAAAGG - Intergenic
1113649701 13:112026944-112026966 CATGGTTTGCAGAAAGGAAACGG + Intergenic
1114268375 14:21086663-21086685 AAAGGTATGTAAAAATGTGAGGG + Intronic
1114418578 14:22560444-22560466 CATGGTAAGCAAAAATTTAAAGG + Intergenic
1114729687 14:24978744-24978766 AATGGTATGTATAGATGTGATGG - Intronic
1115497109 14:34016604-34016626 CATGGAATGAAGAAATGGAATGG + Intronic
1117228234 14:53686325-53686347 CATGGTTGGCAGAGATGTAAAGG - Intergenic
1121964728 14:98293633-98293655 CATGGTGTGCAGGAAGGTGGGGG - Intergenic
1122945516 14:105006861-105006883 GATGGTGTGCAGGAATGTGGGGG + Intronic
1125285432 15:38087822-38087844 CATGGTAGGCAGTCATGGGAGGG - Intergenic
1125618375 15:41036593-41036615 CATGGTATGTATTAATCTGAGGG - Intronic
1126750739 15:51874561-51874583 CATGCTATGTAAAAATATGATGG - Intronic
1127338676 15:58017496-58017518 AATGCTATGGAGAAATTTGAGGG - Intronic
1128980937 15:72184943-72184965 CAAAGTAGGCAGAACTGTGATGG + Intronic
1131653486 15:94428636-94428658 CATGGAAGGTAGAAATGAGAAGG - Intronic
1132946143 16:2532350-2532372 CGGGGTCTGCAGGAATGTGAGGG - Intergenic
1134435743 16:14254762-14254784 CATGTTATGGATAAATGTTATGG - Intronic
1137526171 16:49238255-49238277 CTGGGTATGCAGAAATATTATGG + Intergenic
1137670667 16:50276370-50276392 CATGGGGTGCAGAAGTGAGAGGG - Intronic
1138174183 16:54881671-54881693 CATAGTATTTAGAAATGTGAAGG + Intergenic
1145778654 17:27546958-27546980 CATGGGGTGCAGGAATGTCAGGG + Intronic
1146535104 17:33643098-33643120 CATCGTATGCATAAATGCGCTGG - Intronic
1149555509 17:57570801-57570823 CATGGTATGCAGAAGGCTGCTGG + Intronic
1150529523 17:65962415-65962437 TAAGGTATGAAGAAATGAGATGG - Intronic
1150901751 17:69286269-69286291 CAAGGAATGCTGAAATGTGTTGG - Exonic
1153845907 18:9049710-9049732 CAAGACATTCAGAAATGTGAGGG + Intergenic
1158187209 18:54784262-54784284 AATGGAATGCAAAAAGGTGAAGG - Intronic
1158231872 18:55265571-55265593 AATTGTATCCAGCAATGTGAAGG - Intronic
1161229158 19:3163887-3163909 CATGGTACCCAGAACTGTGGAGG + Intergenic
1166443349 19:42835803-42835825 CTTGGTATGTAAAAATGTGTGGG + Intronic
1166463039 19:43006457-43006479 CTTGGTATGTAAAAATGTGTGGG + Intronic
1166480323 19:43166544-43166566 CTTGGTATGTAAAAATGTGTGGG + Exonic
1166670474 19:44706771-44706793 CAAGGTATGCAGGTATGTGCAGG + Intronic
926570084 2:14520081-14520103 TAAAGTAGGCAGAAATGTGATGG + Intergenic
927519200 2:23689025-23689047 CATGGCCTGCAGAGCTGTGAGGG - Intronic
927681373 2:25141602-25141624 CATGGACTGCAGTAATGTGATGG - Intronic
928361360 2:30664665-30664687 CATGGTATTCACTAATGTGAGGG + Intergenic
929050557 2:37833078-37833100 TATGGTATACAGAAAAATGAAGG - Intergenic
931056760 2:58481305-58481327 TATGGTTTAAAGAAATGTGATGG + Intergenic
931117534 2:59180807-59180829 CATTGTATGCAAAACAGTGAAGG - Intergenic
931940438 2:67246092-67246114 TCTGGGATGCAGAACTGTGAGGG + Intergenic
932629840 2:73330825-73330847 CAAGGTATTAGGAAATGTGAGGG + Intergenic
932866219 2:75345826-75345848 CTTGGGCTGCAGAAATGTTAGGG + Intergenic
933425164 2:82101533-82101555 AATGGTAGGCAGAAAAGTGTAGG - Intergenic
933486309 2:82928718-82928740 CATGTTGTACTGAAATGTGAGGG + Intergenic
935447193 2:103169053-103169075 CATGGAATGCAGAAAGTTAAAGG + Intergenic
935869494 2:107429943-107429965 CATGTCATTTAGAAATGTGAAGG + Intergenic
939095892 2:137832612-137832634 CATGGCATGCAGACAGGTTAGGG + Intergenic
943535381 2:189142667-189142689 CATAGTATAAAGAAATCTGAAGG - Intronic
944487374 2:200221112-200221134 CATGGTATTTAGAGATGTGTGGG - Intergenic
945910650 2:215645050-215645072 CATGATATCCAGAAATGTGTAGG - Intergenic
946789314 2:223284704-223284726 CGAGGTATGCAGACAAGTGAAGG + Intergenic
1170251794 20:14291675-14291697 CAGGGTGTGGACAAATGTGAAGG - Intronic
1170425952 20:16235814-16235836 TAATGTATACAGAAATGTGAAGG - Intergenic
1170631255 20:18067868-18067890 CATGGTAAGGAGAAATGAAAAGG - Intergenic
1170755672 20:19204403-19204425 CATGGTATGAGGCAATGAGAAGG + Intergenic
1175671352 20:60905469-60905491 GATAGTATGCAGAAATGTTTTGG - Intergenic
1178041548 21:28645525-28645547 GATGGTATGCAGAAATTTAGGGG - Intergenic
1178067340 21:28919564-28919586 CATGTTATGCAGGCATGAGAGGG + Intergenic
1179332849 21:40422166-40422188 CCTGGAATGCAGAACTGAGAAGG - Intronic
1181575079 22:23788743-23788765 CATGCTATGCTCAATTGTGAAGG - Intronic
1184108417 22:42381782-42381804 CAAGGTAAGCAGAGAGGTGAGGG - Exonic
1184363524 22:44033421-44033443 CCTTGTACCCAGAAATGTGAGGG + Intronic
949795811 3:7849533-7849555 AACAGTATGGAGAAATGTGATGG + Intergenic
954775792 3:53017231-53017253 TATGGTGTGCAGAAATATTATGG - Intronic
956197589 3:66668782-66668804 CAGGTTATGCAGAAATTTCATGG - Intergenic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956594975 3:70957676-70957698 CATGGTATGCAGAAATGTGATGG - Intronic
957024935 3:75170490-75170512 CACTGTAAGCAGAAATGTAATGG - Intergenic
957508064 3:81151463-81151485 CATGGGATGCAGAAATAGGATGG + Intergenic
957994441 3:87671453-87671475 CATGGTCTAAAGAAATGAGAAGG - Intergenic
958194999 3:90232862-90232884 GATGGTATCCAGCATTGTGATGG + Intergenic
958418355 3:93903762-93903784 TATGGTATCCAGCATTGTGATGG + Intronic
960938268 3:122916630-122916652 CGTGGGAAGCAGAAGTGTGAGGG - Intronic
963979988 3:151526918-151526940 CTTGGTATGTACATATGTGAAGG + Intergenic
965542163 3:169881092-169881114 CAAGGCTTGCACAAATGTGAAGG + Intergenic
965666561 3:171100191-171100213 CATGTTTTGCAGAAATGTTCTGG + Intronic
966759783 3:183407705-183407727 CATATTCTGCAGAAATGAGAAGG - Intronic
967343761 3:188429891-188429913 CATGGTGTAGAAAAATGTGAAGG - Intronic
968464533 4:743949-743971 AATGGTATGTTGAAATCTGAGGG + Intronic
971714034 4:30152992-30153014 CGAGGTATGCAGACAAGTGAAGG + Intergenic
971938739 4:33188245-33188267 TAAGGTATGCAGACAAGTGAGGG + Intergenic
973603689 4:52566021-52566043 CTTGGTATGTAGAAAAGAGAGGG - Intergenic
975910433 4:79259864-79259886 CCTGAAATGAAGAAATGTGAAGG - Intronic
976420130 4:84832764-84832786 CACGGTATGCAAAAATATTAGGG - Intronic
979885037 4:126016559-126016581 CAAGATATGCAGAAATGACAGGG - Intergenic
980468907 4:133224363-133224385 CGAGGTATGCAAAAAAGTGAAGG - Intergenic
980741834 4:136960603-136960625 CATGGTAAACAGAACGGTGAGGG - Intergenic
981841202 4:149114601-149114623 CATGTTATTCAGAAATATGAAGG + Intergenic
983033283 4:162830261-162830283 CATGTTATGGAGAATTTTGAAGG - Intergenic
984187580 4:176564880-176564902 CATGGTTCGGAGCAATGTGATGG - Intergenic
984331051 4:178319350-178319372 CATGTTGTGCAGAAATGGGTGGG - Intergenic
986664454 5:10088401-10088423 CATAGTATTCAGAAATATGGAGG + Intergenic
987002448 5:13673641-13673663 CTAGGTATGCAAAAATGCGATGG - Intergenic
987522800 5:19008757-19008779 AATGGTATGTAGACACGTGAGGG + Intergenic
990329177 5:54708469-54708491 CATGTTACTCAGAAATATGAAGG - Intergenic
991585643 5:68199016-68199038 CATGTTAAGAAGAAAAGTGATGG - Intergenic
992285480 5:75230983-75231005 TCTGGTATAGAGAAATGTGAAGG - Intronic
992534616 5:77686453-77686475 CATGATATGTAGAACTGTTATGG - Intergenic
994246307 5:97481781-97481803 CATGCTACGCAGAAGTGTGGAGG + Intergenic
995909345 5:117167148-117167170 CAAGGTATGGAGAAAAGTGAGGG - Intergenic
997242400 5:132317199-132317221 CATGGTATGCAAATCTGTCATGG - Intronic
999610632 5:153365370-153365392 CTGGGTATACAGAAATGTCAGGG + Intergenic
999913825 5:156235970-156235992 CATGGGATGGAAAAATGTGGTGG + Intronic
1000092723 5:157944130-157944152 AATGCTATGCAGAAATGAGAGGG + Intergenic
1001609164 5:172986160-172986182 CATGGTATACAGCAATGTCCTGG - Intronic
1003355708 6:5368047-5368069 GATGGTCGGCAGAAATGTGAAGG + Intronic
1004598123 6:17120902-17120924 GATGGTGTGCAGAGATGTGGGGG - Intronic
1005153718 6:22780226-22780248 CATGTTGTGCAGGAATGTGGTGG + Intergenic
1007369953 6:41420255-41420277 CATGGAATCCTGAAATGTCAGGG - Intergenic
1008335659 6:50301773-50301795 CATAGTAAACAGAAATGGGATGG - Intergenic
1009668841 6:66719011-66719033 CATATTAGGCAGAAATATGAAGG + Intergenic
1009934771 6:70220887-70220909 CATGGTTTTCTGAAATGTCAAGG + Intronic
1012087141 6:94842538-94842560 CATTGTTTGGAGAAAGGTGAAGG + Intergenic
1012172500 6:96036413-96036435 CATGGTTTGCATAATCGTGATGG + Intronic
1012179628 6:96136303-96136325 CATGATATGTTGATATGTGATGG + Intronic
1012269071 6:97185031-97185053 CATGCTTTGCAGAAGTCTGAAGG - Intronic
1013168447 6:107615202-107615224 CATGGTCTTCAGACATTTGAAGG + Intronic
1020569122 7:9836207-9836229 CATGGTCTACACAAATGTGTTGG - Intergenic
1023867607 7:44245672-44245694 CTTGGGATGCAGAGATGAGAGGG + Intronic
1024090129 7:45931003-45931025 TCTGGTATACAGAAATATGATGG + Intergenic
1028490469 7:91405831-91405853 GATGGTATAGATAAATGTGAAGG - Intergenic
1030654387 7:112150278-112150300 CATGGTTGGCAGAAATATCAAGG + Intronic
1031330639 7:120459326-120459348 CATGCTATGCAGATAATTGAGGG - Intronic
1032131517 7:129232749-129232771 CTTAGTATCCAGAACTGTGATGG + Intronic
1032135239 7:129270783-129270805 CATGGCATAGAGAAATGTCAAGG + Intronic
1032894004 7:136230906-136230928 AAAGGTATGCAGAATTGGGAAGG - Intergenic
1038473242 8:27843282-27843304 CCTGGAAGGCAGAAATGAGATGG + Intergenic
1038779039 8:30555611-30555633 CATGGCATGAAGAAATGTGAGGG + Intronic
1039458737 8:37726065-37726087 CACGGAATGCAGAAATGTTTGGG + Intergenic
1046277149 8:111977960-111977982 AAAGGTATGCAGATATGGGAGGG - Intergenic
1046419408 8:113960133-113960155 CAAAGTATCTAGAAATGTGAGGG + Intergenic
1048054745 8:130852743-130852765 CATGGGGTGCAGAAGGGTGAGGG - Intronic
1048655660 8:136533061-136533083 CATTGTATTTAGAAAGGTGAAGG - Intergenic
1049508770 8:143017705-143017727 GAGGGTGTGCGGAAATGTGAGGG - Intergenic
1051195268 9:14557241-14557263 CATGTTATTTAGAAATATGAAGG + Intergenic
1052472869 9:28922099-28922121 GAGGATATGCAGAAATGTGGAGG - Intergenic
1053542425 9:38987934-38987956 TAAAGTGTGCAGAAATGTGAGGG + Intergenic
1053806877 9:41811452-41811474 TAAAGTGTGCAGAAATGTGAGGG + Intergenic
1054623715 9:67375975-67375997 TAAAGTGTGCAGAAATGTGAGGG - Intergenic
1054853008 9:69868020-69868042 CATGGTATTAAGAGATATGAAGG - Intronic
1054927331 9:70601847-70601869 CATGATAAGCAGAAAAGGGAAGG - Intronic
1056461337 9:86812415-86812437 GATAGAATGCAGAAAAGTGATGG - Intergenic
1057190896 9:93087099-93087121 CAAGGTGTCTAGAAATGTGAAGG - Intergenic
1057529969 9:95836232-95836254 CATGAGATGAATAAATGTGAAGG - Intergenic
1058812426 9:108653824-108653846 CATGTTATGCAGAAAAGAGAAGG + Intergenic
1059901357 9:118929931-118929953 CATGGTCTGGATAAATGTGCAGG + Intergenic
1060165887 9:121414886-121414908 CATGGCAGTCAGAAAGGTGATGG - Intergenic
1060876159 9:127085046-127085068 CATTGTTTTCAGTAATGTGAAGG + Intronic
1186132786 X:6486851-6486873 GATGCCATGCACAAATGTGATGG - Intergenic
1187948872 X:24452678-24452700 CAGGGTATGCAGAAATCACATGG + Intergenic
1187978425 X:24728905-24728927 TATAGTATGCGGAAATATGAAGG - Intronic
1189944548 X:46164715-46164737 CAAGGCAATCAGAAATGTGATGG - Intergenic
1191714578 X:64185530-64185552 CATGGTATGTATATGTGTGAGGG - Exonic
1192262939 X:69518829-69518851 CATGGCATTTAGAAATGTGGAGG - Intronic
1193196014 X:78632166-78632188 CATGGTGTTTTGAAATGTGAAGG + Intergenic
1195347648 X:103966511-103966533 CATGGTGAGCATAAATGTTATGG + Intronic
1195359794 X:104072330-104072352 CATGGTGAGCATAAATGTTATGG - Intergenic
1196505887 X:116441308-116441330 CATGGGCTGCAGAAATGGGAAGG + Intronic
1197596874 X:128474839-128474861 CATGGTATGAATAAATATTAAGG + Intergenic
1198549999 X:137735360-137735382 CATGGTATGCAGCTATGTCATGG - Intergenic
1198822260 X:140660960-140660982 CATAGTATGCAAAAATGACAGGG - Intergenic
1201451182 Y:14116406-14116428 CATTACATGCAGCAATGTGAAGG - Intergenic
1201861865 Y:18607005-18607027 CCTGCTTTGCAGAATTGTGAAGG + Intergenic
1201871458 Y:18713375-18713397 CCTGCTTTGCAGAATTGTGAAGG - Intergenic