ID: 956595752

View in Genome Browser
Species Human (GRCh38)
Location 3:70965282-70965304
Sequence CTGCCCATGCTGAATGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 162}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956595752 Original CRISPR CTGCCCATGCTGAATGTGAA TGG (reversed) Intronic
900638114 1:3675603-3675625 CTGCCCAGGCTGAGTGCGGACGG + Intronic
901726399 1:11246114-11246136 GTGCCCAGGCTGAATGTCACTGG + Intronic
902515703 1:16988349-16988371 CTGGCCATGCTCGAGGTGAAGGG + Exonic
905006358 1:34713239-34713261 CTGCCCATTCTGAAAGGAAAGGG - Intronic
905223887 1:36467007-36467029 CTGACCATGCTGAGTCTGAACGG - Intronic
906543100 1:46603293-46603315 CTGACCCTGCAGAATGGGAAGGG - Intronic
913503306 1:119491805-119491827 GTGCCCATGCTGAAAGTTTAGGG + Intergenic
915442919 1:155957481-155957503 CAGCTCATGCTGAATTTGAAAGG + Intronic
916211735 1:162365257-162365279 ATGCCCATGCTGCCCGTGAAGGG + Intronic
917069043 1:171128721-171128743 CTGCCCAGTCTGACTGTAAAGGG + Intergenic
917742451 1:177974194-177974216 TTGCACATGCTGAATGTGAGGGG + Intronic
918132380 1:181641104-181641126 CTGCACAAGATGAATGAGAAAGG - Intronic
920683966 1:208095119-208095141 CTCCCCTTGCTGAATGTCTAGGG + Intronic
922571230 1:226635726-226635748 CTGCCCACGCTGAATCTGCAGGG - Intronic
1063425492 10:5947096-5947118 CTCCCCATGCAGAATGGGACAGG + Intronic
1063730953 10:8696657-8696679 CTGCTCATGCTCAAAGTGAAGGG - Intergenic
1066680860 10:37936147-37936169 CTGCCCATGATGACTGGGCAAGG + Intergenic
1067181421 10:43988939-43988961 CCTCCCATCCTTAATGTGAAGGG + Intergenic
1068744526 10:60515323-60515345 CAGACCCTGCTGAATGTGCAGGG - Intronic
1071707808 10:88018594-88018616 CAGACCATGTTGAATGTGTATGG + Intergenic
1072234064 10:93438229-93438251 TTGCCCATGCTGTATCTGAGTGG + Intronic
1073909794 10:108328574-108328596 CTACCCATGCTGACAGTGATTGG - Intergenic
1077352956 11:2101218-2101240 TTGGCCATGCTGGATGGGAAGGG - Intergenic
1081771608 11:45653563-45653585 TGCCCCATGGTGAATGTGAATGG + Intronic
1083961372 11:66016657-66016679 GTGCCCGTGTTGCATGTGAAAGG - Intergenic
1085156736 11:74302478-74302500 GTGTACATGCTCAATGTGAAAGG - Exonic
1085471099 11:76758651-76758673 CTGCACAGGCTGAGTGTGAAGGG + Intergenic
1086851146 11:91810743-91810765 CTGCCCATCCTAAATGGGAGAGG + Intergenic
1089060951 11:115625748-115625770 CTGCCCAGGCTTAATGGGGAGGG + Intergenic
1091865975 12:3837226-3837248 CTGCCCATGCTGAGTGGGAGAGG - Intronic
1092127740 12:6086716-6086738 CTGCTCATGGTGACTCTGAAAGG - Intronic
1097492160 12:60283438-60283460 CTGCCAAAGCTGAATGAGCAAGG - Intergenic
1099825539 12:87772587-87772609 CTGCCCCTGTTGAATGAGCAGGG + Intergenic
1103494624 12:121352126-121352148 CTGCCCCTGCTGCAGGTGAGAGG - Exonic
1103903580 12:124315878-124315900 TTGCCCCTCCTGGATGTGAACGG - Exonic
1104205560 12:126635131-126635153 CTGTCTGTGCTGAAAGTGAAAGG - Intergenic
1104968525 12:132520725-132520747 CTGCTCTTGCTGAATGTGAGGGG + Intronic
1106433354 13:29703286-29703308 CTGCCCAGGGTGGATGGGAACGG - Intergenic
1107260119 13:38480713-38480735 CTACCCATGCTGAAGGAGAGGGG - Intergenic
1108024620 13:46164708-46164730 CTGCTCATGCTGATGGTAAAAGG - Intronic
1108157670 13:47603196-47603218 TGGCCCATGCTGAATAAGAAAGG - Intergenic
1110019799 13:70456134-70456156 CAGCCCATGCTCAAAGTAAAGGG + Intergenic
1112450226 13:99501384-99501406 CTGCACATGCTCAGTGAGAACGG - Intergenic
1114164702 14:20209020-20209042 CTGCCCATGCTGGAGGGCAATGG - Intergenic
1114719089 14:24861150-24861172 CTGCACATGATGAAAGTGTAAGG - Intronic
1118528604 14:66675181-66675203 TTGCCCATGCTGAAGTCGAATGG + Intronic
1121034112 14:90685017-90685039 CTGCCCATCTTGAATTTGAAAGG - Intronic
1121227800 14:92334226-92334248 CTGCCCCTGCTGTCTGGGAAAGG - Intronic
1126396510 15:48224038-48224060 CTGGCCATGCTCAAGGAGAAGGG - Intronic
1126815879 15:52452659-52452681 CTGCCCATCCTGAATGAGGATGG - Intronic
1128548504 15:68583153-68583175 TGGCTCCTGCTGAATGTGAAAGG + Intronic
1128818628 15:70632083-70632105 CTGCCCATACCTAATGTGCAAGG - Intergenic
1132204256 15:99975738-99975760 CTGTGCATGAGGAATGTGAAGGG - Intronic
1134538744 16:15047441-15047463 CTGACCACGCTCAATGTGGAAGG - Exonic
1134843031 16:17416538-17416560 CTGCACAGGCTGATTGTGATAGG - Intronic
1135983730 16:27168501-27168523 CGGCCCATGCTGAATGAGGATGG + Intergenic
1140534955 16:75701405-75701427 CTGCCCAAGATGAATTTGGAGGG - Intronic
1141784163 16:86187462-86187484 CTGCCAATGCTGAAGGTCCATGG + Intergenic
1144017538 17:11210134-11210156 CTGCCCAGGCTGAATTTACAGGG + Intergenic
1149881906 17:60300406-60300428 TTTCCCCTGCTAAATGTGAAAGG - Intronic
1152155512 17:78630085-78630107 CTGCACACGCTGAATGTCACTGG - Intergenic
1152479327 17:80539530-80539552 CAGCCCATTCTGCCTGTGAATGG + Intergenic
1154163000 18:11993853-11993875 CTGCCCTGGCTGGGTGTGAAGGG + Intronic
1155732233 18:29175053-29175075 CAGCCCCTGCTCAATGTGATTGG - Intergenic
1156141337 18:34115308-34115330 CTGGCCATGGTGGATGTGACTGG - Intronic
1156474686 18:37398066-37398088 GAGCCCATCCGGAATGTGAAGGG + Intronic
1157196901 18:45626830-45626852 CTGGCCTGGCTGAATGGGAAGGG + Intronic
1157213060 18:45760245-45760267 CTGTCCATGAGGAATGTGTAGGG - Intergenic
1160398843 18:78593862-78593884 GTGCCCATGATGAATATAAATGG + Intergenic
1161055156 19:2187251-2187273 CTGCCCCAGGTTAATGTGAAAGG - Intronic
1162367353 19:10257511-10257533 CTGCCCTGCCGGAATGTGAATGG + Intronic
1164991962 19:32691362-32691384 CTGCACACCTTGAATGTGAAAGG - Intergenic
1168596093 19:57678702-57678724 TTACACATGCTGCATGTGAAAGG - Exonic
926513908 2:13817070-13817092 CTGCCCTTGAAGAATATGAAGGG + Intergenic
930628723 2:53728209-53728231 CTGGCAATGCTGAATGTGGAAGG + Intronic
934014442 2:87864187-87864209 ATGCCCCTGCTCAATGTAAATGG + Intergenic
936979407 2:118250381-118250403 CTGCCCAGGATGGATTTGAAGGG + Intergenic
937350328 2:121156407-121156429 CAGCCCCAGCTGAATGGGAAAGG + Intergenic
940260795 2:151777506-151777528 GTGCCCATGATGAATGAGTAAGG - Intergenic
940345455 2:152623733-152623755 CTGACGAAGCTGAATGTGTATGG + Intronic
943900090 2:193422734-193422756 CTTCCCATGTTAAATATGAATGG + Intergenic
946332090 2:219016028-219016050 GTGCAAATGCTGAGTGTGAAAGG + Intronic
947588573 2:231371605-231371627 CTGCCGGTGATGGATGTGAAGGG + Intronic
948610773 2:239165277-239165299 CTGCCCCTGCTGCAGGTGGATGG - Intronic
1169798430 20:9491075-9491097 CTGCCCATGCTTCATGGGAAGGG + Intergenic
1169914536 20:10672948-10672970 CTGTCCATGCAGAACGTGAACGG - Exonic
1171287746 20:23955901-23955923 CTGTCCATCCTGCAGGTGAAAGG - Intergenic
1171332124 20:24349569-24349591 CTGGCCATGCTTACTCTGAAGGG - Intergenic
1171336220 20:24388192-24388214 CAGTCCCTCCTGAATGTGAATGG - Intergenic
1172025009 20:31942645-31942667 CTCCAGATGCTGAATGTGGATGG - Intronic
1174271980 20:49376294-49376316 CTGCCCCTGCTAAGTGGGAAGGG + Intronic
1177622791 21:23618509-23618531 CTGACCAGCCTGACTGTGAAAGG - Intergenic
1177624122 21:23636793-23636815 CTTCCCTTGCTGGATGCGAATGG + Intergenic
1181819434 22:25463938-25463960 ATGCCCATGTTGAATATGTAAGG - Intergenic
951351381 3:21611184-21611206 CTGCCCATGTTGAACAAGAAAGG + Intronic
955566917 3:60257396-60257418 TTGTCCATGCAGGATGTGAATGG - Intronic
956286384 3:67614622-67614644 CTTCACAGGCTGAAGGTGAAGGG + Intronic
956595752 3:70965282-70965304 CTGCCCATGCTGAATGTGAATGG - Intronic
958823118 3:98999043-98999065 TTACCCATGCTCTATGTGAATGG - Intergenic
960822375 3:121748901-121748923 CTGCACAACCGGAATGTGAAAGG - Intronic
961404958 3:126672321-126672343 ATTCCCAGGGTGAATGTGAATGG + Intergenic
961640895 3:128364290-128364312 CTTGCCATGCTGACTGTGAATGG - Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
964406494 3:156353880-156353902 CAGCCCATGCTCAAAGGGAAGGG + Intronic
965768058 3:172152553-172152575 CTTCCCATGGAGAATGTGAGTGG - Intronic
966296310 3:178427652-178427674 CTGCCCATGCATACTGTGCAGGG - Intronic
966322172 3:178713256-178713278 TTGCCCATACCCAATGTGAAAGG - Intronic
969165470 4:5306628-5306650 ATGCTAATGTTGAATGTGAATGG - Intronic
969394547 4:6911523-6911545 AAGCCCAAGCTGAATGTGAGAGG - Intronic
970686175 4:18570190-18570212 CAGCCCATGCTCAAGGGGAAGGG - Intergenic
970859393 4:20684257-20684279 CTGCTCCTGCAGAAGGTGAAGGG + Intergenic
972785244 4:42320506-42320528 TTGCCCTTGCTGTATCTGAAAGG + Intergenic
972980686 4:44696987-44697009 CTGCCTCTACTGAATGTGGATGG - Intronic
975225190 4:71863634-71863656 ATGCCCATGCTGAAGGTTATGGG + Intergenic
976512731 4:85930049-85930071 CTGCACCTGCTGAATGTGACCGG + Intronic
977620091 4:99126194-99126216 CACCCCATTCTGATTGTGAAGGG + Intronic
977809205 4:101339444-101339466 TTGTCCCTGCTGAATGTAAAAGG - Intronic
979527766 4:121735547-121735569 TTGCTGATGCAGAATGTGAAAGG - Intergenic
979875890 4:125890629-125890651 CTGCCTCTGCTGTATGTGTAAGG + Intergenic
980330938 4:131410337-131410359 TTGCCCATTCTGGATGTAAATGG + Intergenic
981178814 4:141714974-141714996 CTGGACATGCTGAGTTTGAAAGG - Intronic
983938161 4:173517326-173517348 CTGCCCATGCTGGATGAAAGTGG - Intergenic
985502073 5:254570-254592 CTGGCCTTGCTGATGGTGAACGG + Intronic
985685929 5:1281456-1281478 CCGCCCAGGCTGACTGTGGAGGG - Intronic
986041307 5:3996657-3996679 CTGCCAATGCTGAGAATGAATGG - Intergenic
989411152 5:41121472-41121494 CTGCCAATGCTGAAGGTACATGG - Intergenic
991269854 5:64767247-64767269 CTGCCCATCCTGTATGTGTTTGG + Intronic
991462185 5:66870764-66870786 CTGCCCTTCCTGACAGTGAATGG - Intronic
993500671 5:88662550-88662572 GTGTCCTTGCTGAATGTGAATGG - Intergenic
994751121 5:103738143-103738165 CTTCTCATGCAGAATGTGATTGG + Intergenic
994822898 5:104676747-104676769 CTGCCTATGCTGAATTTTACAGG - Intergenic
998865190 5:146492052-146492074 CTGCCACTTCTGAATGTAAAAGG - Intronic
999240011 5:150121948-150121970 GTGCCCATGCTGGACATGAAAGG - Exonic
1000121398 5:158201366-158201388 CTGCCCATACTGAAAATGAAAGG + Intergenic
1001220110 5:169893249-169893271 CTGCTGCTGCTGAATCTGAAAGG + Intronic
1003421455 6:5961876-5961898 CTGCCCAAGTTGAATGTCAATGG - Intergenic
1003463545 6:6354448-6354470 CTTGCAAAGCTGAATGTGAATGG - Intergenic
1004319884 6:14624090-14624112 CTGCCCTTCCAGAATGGGAAGGG - Intergenic
1006430341 6:33991930-33991952 GTGCACATGCTGAATGTTTAGGG + Intergenic
1009654284 6:66520175-66520197 CAGCTCATGATGAGTGTGAATGG + Intergenic
1009950778 6:70393347-70393369 TTGACAATGCTGAATATGAAAGG - Intergenic
1010768324 6:79801222-79801244 GTGCTCATGCTCAATGTGCAAGG - Intergenic
1012887381 6:104860904-104860926 CTGCCCATTCAGGATATGAAGGG + Intergenic
1013351969 6:109313987-109314009 TTGCACAGGCTGCATGTGAAAGG + Intergenic
1013506743 6:110807845-110807867 CTGCCCATGCTGAAGTGCAATGG + Intronic
1013738727 6:113258851-113258873 GTGCCCATGCTCAATGTGTGGGG + Intergenic
1013742147 6:113299830-113299852 TGGCCTATGCTGAAAGTGAAAGG - Intergenic
1016100756 6:140097286-140097308 CCGCCCATATTGAATATGAATGG + Intergenic
1017934110 6:158989440-158989462 CTGCCCATCCTGAATGGGGGAGG + Intronic
1018445309 6:163852909-163852931 CAGGCCATGCTGAGTGTGATAGG + Intergenic
1023625075 7:42107530-42107552 CTGCCCTTGCTGACTGAGAATGG + Intronic
1024753690 7:52502543-52502565 CTGCACTTGCTTCATGTGAACGG + Intergenic
1026132758 7:67634047-67634069 CTGCCCATTCTGAAAGGGTATGG + Intergenic
1029048559 7:97658743-97658765 GTGCCCATGCTAAGTGGGAATGG - Intergenic
1029409249 7:100398294-100398316 GTTCCCCTGCTGAATGTGCAGGG + Intronic
1032107033 7:129041005-129041027 TTGCCCATACTAAATGTTAAGGG + Intronic
1032943557 7:136823791-136823813 CCACCCATGCAGAATTTGAAAGG - Intergenic
1033421544 7:141208685-141208707 TTGCTCTTGCTGAATGTCAAGGG + Intronic
1040735102 8:50496335-50496357 CTGCCCTTGCTGTCTGTGAAGGG + Intronic
1041784922 8:61621087-61621109 CTTCCCATGCTGTATCTAAAAGG + Intronic
1043547789 8:81334805-81334827 TTGCTCATGCAGAATGTGAGAGG - Intergenic
1043964763 8:86461533-86461555 CTCCCTATGGTGACTGTGAAGGG + Intronic
1046066669 8:109205450-109205472 CTGCCTATGGTGAAAGTGGAGGG - Intergenic
1047198419 8:122742760-122742782 GTGCCGATGCAGAAAGTGAAGGG - Intergenic
1048575138 8:135684202-135684224 CCGCGCATGCATAATGTGAATGG + Intergenic
1050520929 9:6498867-6498889 CTGCCCACACTGCATGTGTAGGG + Intronic
1051210024 9:14731526-14731548 CTTTCAATGCTGAATGTAAAAGG + Intergenic
1051520379 9:17980880-17980902 CTGCCCATGCAGAAGGTGAAGGG + Intergenic
1051602989 9:18892696-18892718 CTGGCCAATCAGAATGTGAAAGG - Intronic
1052542764 9:29831761-29831783 CTACCCCTGCTGAATATGATTGG + Intergenic
1054809203 9:69421526-69421548 CTGCACATGCTAAATGTTCAAGG + Intergenic
1054905331 9:70409536-70409558 CTGCCCATACTCTATGTGAAAGG + Intronic
1056355493 9:85797606-85797628 CTGCCCTAGGTGAAGGTGAAGGG - Intergenic
1056589555 9:87955003-87955025 CTGCTCATGATGAATTTTAAAGG + Intergenic
1058459637 9:105170982-105171004 CTGGACATGCTCAGTGTGAAGGG + Intergenic
1060266319 9:122113514-122113536 CTGTCCATGCTGAAGGAGTAGGG + Intergenic
1060796930 9:126518642-126518664 CTGCCCACGCTGAATTTATAGGG - Intergenic
1188024834 X:25197348-25197370 CTGCCTATGCTGAGGGAGAAGGG + Intergenic
1188308272 X:28585906-28585928 CTGCCGGTGTTGAATGGGAAAGG + Intergenic
1188572303 X:31602675-31602697 CTTCACATGCTGAATCTGGAAGG + Intronic
1193951527 X:87806601-87806623 GTGCCCAGGCTGACTTTGAAGGG - Intergenic
1194870671 X:99127433-99127455 CTGGTCATGCTGTATGTCAACGG - Intergenic
1195942599 X:110178252-110178274 CAGCCCATGATGACTGTGATTGG + Intronic
1197239992 X:124113894-124113916 CTGGACAGGCTGAATGTGGAAGG - Intronic
1198504047 X:137283255-137283277 ATGCCCTTCCTGAATGTCAAGGG + Intergenic
1198977019 X:142347568-142347590 TGGCAAATGCTGAATGTGAAAGG - Intergenic