ID: 956601976

View in Genome Browser
Species Human (GRCh38)
Location 3:71032278-71032300
Sequence CTGTCTGTGCAGTGGCACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 281}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956601966_956601976 28 Left 956601966 3:71032227-71032249 CCCGGGGGGATTGTCCCATATTA 0: 1
1: 0
2: 1
3: 11
4: 86
Right 956601976 3:71032278-71032300 CTGTCTGTGCAGTGGCACTGAGG 0: 1
1: 0
2: 4
3: 37
4: 281
956601970_956601976 14 Left 956601970 3:71032241-71032263 CCCATATTAACACCACCTGGGCT 0: 1
1: 0
2: 2
3: 11
4: 87
Right 956601976 3:71032278-71032300 CTGTCTGTGCAGTGGCACTGAGG 0: 1
1: 0
2: 4
3: 37
4: 281
956601967_956601976 27 Left 956601967 3:71032228-71032250 CCGGGGGGATTGTCCCATATTAA 0: 1
1: 0
2: 3
3: 33
4: 161
Right 956601976 3:71032278-71032300 CTGTCTGTGCAGTGGCACTGAGG 0: 1
1: 0
2: 4
3: 37
4: 281
956601971_956601976 13 Left 956601971 3:71032242-71032264 CCATATTAACACCACCTGGGCTG 0: 1
1: 0
2: 0
3: 12
4: 144
Right 956601976 3:71032278-71032300 CTGTCTGTGCAGTGGCACTGAGG 0: 1
1: 0
2: 4
3: 37
4: 281
956601973_956601976 2 Left 956601973 3:71032253-71032275 CCACCTGGGCTGTGGCAATTGTG 0: 1
1: 1
2: 3
3: 31
4: 395
Right 956601976 3:71032278-71032300 CTGTCTGTGCAGTGGCACTGAGG 0: 1
1: 0
2: 4
3: 37
4: 281
956601974_956601976 -1 Left 956601974 3:71032256-71032278 CCTGGGCTGTGGCAATTGTGCTC 0: 1
1: 0
2: 0
3: 11
4: 145
Right 956601976 3:71032278-71032300 CTGTCTGTGCAGTGGCACTGAGG 0: 1
1: 0
2: 4
3: 37
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956601976 Original CRISPR CTGTCTGTGCAGTGGCACTG AGG Intronic
901234138 1:7658510-7658532 CTGCCTGTGCAGCGGTACAGAGG + Intronic
901622122 1:10597065-10597087 CAGACTGTGCTGTGGCCCTGAGG - Intronic
901690725 1:10971477-10971499 CAGTATGTGCAGAGGCCCTGAGG - Intronic
902244727 1:15113075-15113097 CTGTCTGTGCATTTCCATTGAGG - Intronic
902642135 1:17773896-17773918 CTGTCTGTGCAGGGCCACAGAGG + Intronic
903674656 1:25056215-25056237 CTTGCTGTGCAGTGGGACTATGG + Intergenic
903743388 1:25571360-25571382 CAGGCTGAGCAGTGCCACTGGGG - Intergenic
904354721 1:29931494-29931516 CTCTCTGTGCAGAGACACTTCGG - Intergenic
905009814 1:34739636-34739658 CTTTCTGTCCAGTGGCTTTGGGG - Intronic
905503971 1:38461973-38461995 CTGTCAATGCTGTTGCACTGGGG - Intergenic
905849653 1:41264151-41264173 CTGACTTTCCACTGGCACTGTGG + Intergenic
907332921 1:53683065-53683087 TGGTCTGTGCAAAGGCACTGAGG + Intronic
908331723 1:63077365-63077387 CTCTCTGTGCACAGGCACTGAGG + Intergenic
909446302 1:75752431-75752453 CAGTTTGTGAATTGGCACTGTGG + Intronic
910835903 1:91509851-91509873 CAGTCTGGGCAGTGGCCCTGAGG - Intronic
913338569 1:117733696-117733718 CTCTCTGTACAGTGGAACTATGG - Intergenic
915109520 1:153554191-153554213 ATCTCTGTGCAGAGGCACAGAGG - Intergenic
916427329 1:164693204-164693226 CTGTCTCTGAACTGGCCCTGTGG + Intronic
916714665 1:167438966-167438988 CTCCCTGTGCAATGGGACTGTGG - Intronic
920744527 1:208614009-208614031 CTGCCTGTGCACTGACTCTGAGG + Intergenic
921262284 1:213394928-213394950 CCATCAGTGCAGTGGCACTGTGG + Intergenic
921309455 1:213828292-213828314 CTGGGTGTGATGTGGCACTGTGG - Intergenic
922092618 1:222411182-222411204 CCCTCTGGGCAGAGGCACTGAGG + Intergenic
922413640 1:225399468-225399490 CTGACTGTGCAATGTCCCTGTGG + Intergenic
923013262 1:230105677-230105699 CTGTCGGTGCTGTCTCACTGTGG + Intronic
923538081 1:234868488-234868510 CCATCTGTGAAGGGGCACTGAGG - Intergenic
924421368 1:243913209-243913231 CTGTCTGTGCAGTGGCTCACTGG - Intergenic
924798479 1:247309945-247309967 CTGGCAGTGCAGGGGCAGTGGGG + Intronic
1063102366 10:2961939-2961961 CTGTCTGTGCCAAGACACTGAGG - Intergenic
1064167551 10:13000141-13000163 CAGTCTGGGAAGTAGCACTGAGG - Intronic
1067256504 10:44647543-44647565 CTGGGTGTGGAGGGGCACTGGGG - Intergenic
1067730912 10:48810920-48810942 GTGTCTGTGCAGTGAGGCTGCGG - Intronic
1067881614 10:50050810-50050832 GGGTGTGTGCAGTGGCACTAAGG + Intergenic
1067887598 10:50103843-50103865 GGGTGTGTGCAGTGGCACTAAGG - Intronic
1069044238 10:63724933-63724955 CTCTCAGTGCATTGTCACTGAGG + Intergenic
1069194238 10:65528513-65528535 CTGTCTGAGCAGTGGTCCTCTGG + Intergenic
1069568892 10:69482303-69482325 CTGCCTGTGCAAAGGCCCTGGGG + Intronic
1070507305 10:77125419-77125441 CTGCATGTGCAGAGGCCCTGGGG - Intronic
1071450855 10:85790523-85790545 CTGTCTGGGCAGAGGGAGTGGGG + Intronic
1072438893 10:95436911-95436933 CTATCTGTGCAGCCACACTGAGG + Intronic
1072892428 10:99335867-99335889 CTGTCTGTGGACAGGCACTGAGG - Intronic
1074696132 10:116051550-116051572 CTGTCTGACCAGTGGCAGAGGGG - Intergenic
1075369964 10:121927724-121927746 CCGTCTCGGCCGTGGCACTGGGG + Intronic
1075595905 10:123728956-123728978 CAGTCTGTGCAGTGGCTCTGAGG - Intronic
1076573118 10:131445451-131445473 CTGTCTGTGCAGTGGTCCTGTGG - Intergenic
1077159811 11:1107575-1107597 CAGCCTGTGCAGTGGCCCCGGGG + Intergenic
1078391766 11:10940947-10940969 CTATCTGTGCATTGGCACAGTGG - Intergenic
1081437165 11:43040079-43040101 CTGTCTTTGCCATGGTACTGTGG - Intergenic
1083270730 11:61571201-61571223 GTGTCTGTGCAGAGGCACATGGG - Intronic
1083430775 11:62612726-62612748 CTGTTTGTGCTGCGGCGCTGTGG - Exonic
1084062879 11:66687367-66687389 CTATCTGGGCAGAGGCTCTGGGG + Intronic
1084409447 11:68997867-68997889 CTGACTCTGCAGTGACAGTGAGG + Intergenic
1084477603 11:69397855-69397877 CTGCCTGTGCAAAGGCCCTGTGG + Intergenic
1084608420 11:70185860-70185882 CTGTCAGTGCAGGGGGCCTGGGG - Intronic
1085509717 11:77082145-77082167 CAGTGTGTGCAGAGGCCCTGAGG + Intronic
1085556467 11:77427185-77427207 CTGTCTCTGCAGAGACACTTAGG - Intronic
1085793022 11:79512436-79512458 CTGGGTGTGCCATGGCACTGAGG - Intergenic
1085892864 11:80601838-80601860 CTGTCTGTGCAGAAGTACTGTGG - Intergenic
1088184356 11:107148737-107148759 CTCACTCTGCAGTGGGACTGAGG - Intergenic
1089529466 11:119116912-119116934 CTCTGTGAGCAGTGGCTCTGTGG + Exonic
1091334073 11:134753618-134753640 CTGTCAGTTCAGTGGCCCTGAGG + Intergenic
1091767343 12:3130197-3130219 CTGCCAGTGCGCTGGCACTGAGG - Intronic
1092997485 12:13963731-13963753 CTCTCTGGGGAGTGGCACTAGGG + Intronic
1093013123 12:14129328-14129350 CAGTCTGTGAAGTTGCTCTGAGG - Intergenic
1095929377 12:47610359-47610381 CAGTGTGTGCATAGGCACTGAGG - Intergenic
1096608469 12:52784889-52784911 CTTTCTCTGCAGTGGCACTGTGG + Intergenic
1099469022 12:83023593-83023615 ATGGCTCTGCAGTGGCACTGAGG + Intronic
1100813227 12:98360950-98360972 CTCTCTCTGCAGAGGCCCTGGGG + Intergenic
1101997466 12:109535292-109535314 CTGTCTGGGAAGAGGCGCTGTGG - Exonic
1102554968 12:113720813-113720835 GTGTCTGTGCAGTCCCACGGGGG - Intergenic
1102955205 12:117054483-117054505 CTGTGTGTGCAAAGGCCCTGTGG - Intronic
1102985306 12:117272897-117272919 CTGCCTGTGCAAAGGCCCTGAGG - Intronic
1103041455 12:117698879-117698901 CTGTATGTGCAAAGGCCCTGGGG - Intronic
1104013863 12:124949816-124949838 CGGTCTGTGCAGCGGCTCTCGGG - Intronic
1104074471 12:125377123-125377145 CTGTCTGTGCACTGCCTCTGAGG + Intronic
1104355055 12:128077957-128077979 CTGTCCTTGCAGTGGTTCTGAGG + Intergenic
1104443798 12:128817511-128817533 AGGTGTGTGCAGTGTCACTGTGG - Intronic
1104658247 12:130590356-130590378 CTCTTTGTGCTGTGGCCCTGGGG - Intronic
1104877962 12:132049679-132049701 CTGTCTGTGCAAGGTCACAGAGG - Intronic
1106132460 13:26951642-26951664 CTGTGTGTGCCGTGGTGCTGCGG - Intergenic
1107636742 13:42399761-42399783 CTGTTTGTGATGTGGCCCTGTGG + Intergenic
1109221949 13:59648736-59648758 CTGTCTGCTCAGTGCCACAGCGG - Intergenic
1113384200 13:109833272-109833294 CTGGCTTTGCAGTGGCCCTAGGG - Intergenic
1113404075 13:110021933-110021955 CTGTCTGGGCACTGGAAATGTGG - Intergenic
1113860826 13:113485435-113485457 TTTTCTTTGCTGTGGCACTGGGG - Intronic
1113919341 13:113898221-113898243 CTGTCTGTCCAGTGAAGCTGAGG + Intergenic
1121001833 14:90456652-90456674 CTGTCTGTGCAGTGGGGAGGTGG - Intergenic
1121589257 14:95088764-95088786 CTGTCGGTGCACTCGCACAGAGG + Exonic
1121780469 14:96618855-96618877 CTGTCTATATGGTGGCACTGGGG + Intergenic
1124062068 15:26302917-26302939 TGGCCTATGCAGTGGCACTGTGG + Intergenic
1125034258 15:35105989-35106011 CTTTGTGTGCATTGGCACTGTGG + Intergenic
1125729198 15:41883274-41883296 CCCTCTGAGCACTGGCACTGGGG + Intronic
1126213873 15:46132159-46132181 CAGTCTGTGCAGTGGTAGAGCGG + Intergenic
1126704121 15:51391837-51391859 CTGCCCGTCCAGTGGAACTGGGG - Intronic
1127051580 15:55089485-55089507 CTTTCAGTGCAGTGGTCCTGAGG + Intergenic
1127381024 15:58430601-58430623 CAGTCTGTGCAAAGGCCCTGAGG - Intronic
1127599366 15:60519954-60519976 TTCTTTGAGCAGTGGCACTGTGG + Intronic
1128930699 15:71702687-71702709 CTGTCTGTGCAAAGGCCCCGTGG - Intronic
1129751795 15:78070504-78070526 CTGTGTGTGCTTAGGCACTGGGG - Intronic
1130256864 15:82329871-82329893 CTGCCTGTGCACTGGCCCTGCGG + Intergenic
1130598084 15:85260117-85260139 CTGCCTGTGCACTGGCCCTGCGG - Intergenic
1132043429 15:98545086-98545108 CTGTGTGTGCAAAGGCCCTGAGG - Intergenic
1132233310 15:100200645-100200667 CTGGCTGTGCAGTCACATTGGGG + Intronic
1133152552 16:3847151-3847173 ATCTCTGTGCAGTGTCACAGAGG + Intronic
1134451860 16:14368614-14368636 CTGGCTGTGCAAAGGCCCTGGGG - Intergenic
1134843857 16:17423501-17423523 GGGACTGTGCAGTGGCTCTGTGG + Intronic
1135161672 16:20102059-20102081 CTGGGTGTGCAGAGGCACTTAGG + Intergenic
1135497874 16:22968415-22968437 CTGTCTCTGCTGGGGCACTGGGG + Intergenic
1137301905 16:47157392-47157414 CTGTATCTCCTGTGGCACTGTGG - Intronic
1139935629 16:70568927-70568949 CTGTCTAGGCAGTGCCCCTGTGG + Intronic
1140028203 16:71311320-71311342 GTGTGTGTGCAGTGCCCCTGGGG + Intergenic
1140712547 16:77691804-77691826 CTGTGTCTGCAGTAGCACGGGGG - Intergenic
1140819698 16:78651608-78651630 CTGTGTGAGCAATAGCACTGAGG - Intronic
1141639202 16:85331853-85331875 CTGTCTTTGCAGTGCTCCTGAGG + Intergenic
1141677777 16:85526557-85526579 CTGTCTGTGCTGTGTCCCTTTGG - Intergenic
1142692026 17:1612400-1612422 CTGTCTGTGCCCGGGCACGGAGG + Intronic
1147508680 17:41046837-41046859 GTGTCTGTGCAGTCCCCCTGCGG - Exonic
1147509426 17:41054796-41054818 GTGTCTGTGCAGTCCCCCTGCGG - Exonic
1147509447 17:41054886-41054908 GTGTCTGTGCAGTCCCCCTGCGG - Exonic
1147947559 17:44088582-44088604 CTGCCCGTGGAGTGGCACTACGG + Exonic
1148872537 17:50667315-50667337 AGGCCGGTGCAGTGGCACTGAGG + Intronic
1149803484 17:59592472-59592494 CTGACTAAGAAGTGGCACTGAGG - Intronic
1149843007 17:59983014-59983036 CTGACTAAGAAGTGGCACTGAGG + Intergenic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1151551286 17:74823898-74823920 TTGTCTGTGCGGTGGCAGCGAGG + Intronic
1152199203 17:78935325-78935347 CTGCCTGTCCTGTGGGACTGTGG + Intergenic
1152316485 17:79583626-79583648 CTGCCTGTGCAAAGGCCCTGAGG + Intergenic
1152596261 17:81239177-81239199 CTGTCTGTGCTCTGGGACTTCGG - Intergenic
1152606332 17:81292816-81292838 CTGTCGGTGAAGTGCCACCGTGG - Intronic
1152757275 17:82092288-82092310 AGGTCTGAGCAGAGGCACTGAGG - Intronic
1155087873 18:22475218-22475240 CTCTCTGTGCTGTGGCCCTGAGG + Intergenic
1156339161 18:36195885-36195907 CTGTATCTGCAGTGACAGTGGGG + Intronic
1156502876 18:37570741-37570763 TTGTGTGGGCAGTGGCACTCAGG + Intergenic
1156777148 18:40805441-40805463 CTGTCCCTGCTGTGGGACTGAGG + Intergenic
1157253505 18:46116985-46117007 GTGACTGTGAAGTGGCACTGTGG - Intronic
1157874492 18:51259878-51259900 AGGTCTGTGCAAAGGCACTGTGG - Intergenic
1159894315 18:73982193-73982215 CTGGCTGTGCAATGGCAGTGGGG - Intergenic
1159939711 18:74397578-74397600 CTGTCTGAGCTGAGACACTGAGG - Intergenic
1160509383 18:79444698-79444720 CTGTGTGTGCAGTGCCGGTGTGG - Intronic
1160739541 19:679690-679712 CTGTCTGAGCAGCGGGGCTGCGG + Intronic
1161248422 19:3267795-3267817 CTCTCTGTGCAGGGTCACAGAGG + Intronic
1161556650 19:4946415-4946437 CTGTCTGTCCGTGGGCACTGGGG + Intronic
1161584238 19:5096512-5096534 GGGTCTGGGCAGGGGCACTGAGG - Intronic
1161634202 19:5377102-5377124 CAGTCTGTGCAAAGGCCCTGAGG + Intergenic
1161658292 19:5529631-5529653 GTGTTTGAGCAGTGGCTCTGTGG + Intergenic
1162309792 19:9899407-9899429 CTGCATGTGCAGAGGCCCTGAGG - Intronic
1164051187 19:21586730-21586752 CTGGCTGGGCAGCGGCGCTGGGG + Intergenic
1164574680 19:29398829-29398851 CTGTCTGGGCAGTGGGATTGGGG - Intergenic
1165120439 19:33555390-33555412 CTGTCTGTGTGGTGGCCCTATGG - Intergenic
1167487889 19:49773832-49773854 CTGCCTGTGCAAAGGCCCTGAGG + Intronic
925226736 2:2189991-2190013 CCAGCTGTGCAGTGGCCCTGAGG - Intronic
925337241 2:3107438-3107460 CTTTATTAGCAGTGGCACTGAGG + Intergenic
929790057 2:45015536-45015558 GTGTCTTTCCAGTAGCACTGTGG + Intergenic
930572580 2:53106053-53106075 CTACCTGTGCAGTGGAAATGAGG - Intergenic
931792692 2:65679029-65679051 GGGTCTGTGCAGTGGAACTAAGG - Intergenic
934178657 2:89600048-89600070 CTGTCCTTGCTGTGGCACTGTGG - Intergenic
934857169 2:97736729-97736751 CCGCCTGTGCAGAGGCCCTGAGG + Intronic
935570624 2:104656995-104657017 TTGTCTGTGCGCAGGCACTGCGG - Intergenic
938138799 2:128780326-128780348 GTCCCTGTGTAGTGGCACTGAGG - Intergenic
938288204 2:130135994-130136016 CTGTTTGGTCAGTGGCACCGGGG - Intergenic
938838272 2:135130963-135130985 CTGTCTGGGCAGTGGGAATCAGG + Intronic
938900898 2:135797766-135797788 TTGTCTGTGGAGTGGCATAGTGG + Intronic
938917785 2:135960750-135960772 TTGTGTGTGCAGTGGCTCTAAGG - Intronic
939567000 2:143797014-143797036 TTGTCTGTGAAGTGGAACTTGGG - Intergenic
940396568 2:153197520-153197542 ATGTTTGTGCACTGGGACTGGGG + Intergenic
942813442 2:180023555-180023577 CTGTTGGTGGAATGGCACTGGGG + Intergenic
943459054 2:188146964-188146986 CTGTGTGTGCACCTGCACTGAGG - Intergenic
944839085 2:203608210-203608232 TTGTCTGAGCAGTGGTACAGTGG - Intergenic
947267824 2:228302248-228302270 CTCTCAGTTCAGTGGCACTGAGG - Intergenic
948672598 2:239578094-239578116 CTGGCTGGGCGGTGGCACAGGGG - Intergenic
948900329 2:240953519-240953541 CCGTCTGTGCTGTGCCCCTGGGG - Intronic
1169212568 20:3775610-3775632 CTGCCTTAGCAGTAGCACTGTGG + Intergenic
1169415428 20:5412082-5412104 CTGTCTGGGAAGTGGGAGTGGGG - Intergenic
1170143561 20:13148821-13148843 ATGACTGTGAGGTGGCACTGAGG + Intronic
1170183224 20:13556694-13556716 CTGCATGTGCAGAGGCCCTGTGG - Intronic
1170781658 20:19430991-19431013 CTGTCTGTGCTGGGGTCCTGAGG - Intronic
1171013224 20:21519802-21519824 CTGTCTGTGGGGTGGCAGAGTGG + Intergenic
1171268939 20:23798549-23798571 GTGTCTGTGCAGTGGCTGGGAGG + Intergenic
1171395413 20:24829784-24829806 CTGTCTTTGCTGCGGCAGTGTGG - Intergenic
1172447777 20:35002108-35002130 CTCTCTGTGCAGGGGGACTGTGG + Intronic
1172997178 20:39079587-39079609 CTGTTTGTTCAGTGGGACAGAGG - Intergenic
1173127693 20:40355056-40355078 CTGTTTGTACAGTGACAGTGTGG + Intergenic
1173726378 20:45301137-45301159 CCCTCTCTGCAGTGGCACCGTGG + Exonic
1173869261 20:46331426-46331448 CTGTCTGGGCAGGGGGTCTGTGG + Intergenic
1174172577 20:48626665-48626687 CTGTGCGTGCTGTGGCGCTGGGG - Intronic
1174926075 20:54761449-54761471 GTGGCTATGCAGGGGCACTGAGG + Intergenic
1175387900 20:58608886-58608908 GTGTCTGTGCAGTGCCAGTCGGG + Intergenic
1176068425 20:63212913-63212935 CTTTCTCTGCCTTGGCACTGTGG - Intronic
1178644142 21:34371146-34371168 GTGTCTGGGCAGTGGCTGTGGGG + Exonic
1179035384 21:37754906-37754928 CTTTCTGTCCAGCTGCACTGCGG - Intronic
1179107039 21:38410550-38410572 CTGTATGTGGAGTGGGAGTGGGG + Intronic
1180801130 22:18632442-18632464 CTGCTTATGCAGAGGCACTGGGG + Intergenic
1180852360 22:19028001-19028023 CTGCTTATGCAGAGGCACTGGGG + Intergenic
1181220590 22:21362819-21362841 CTGCTTATGCAGAGGCACTGGGG - Intergenic
1181281519 22:21724109-21724131 CTGTCCCTGGAGTGGGACTGGGG - Intronic
1181393780 22:22603659-22603681 ATGTGTCTGCAGTGACACTGGGG - Intergenic
1182102438 22:27667589-27667611 CAGTCTCTGCAGAGGGACTGTGG + Intergenic
1182275979 22:29188942-29188964 CTGTCTGAGCAGAGGCCCTGAGG + Intergenic
1183861977 22:40676964-40676986 TTGTCAGTGCAGAGGCCCTGTGG - Intergenic
1184840737 22:47051024-47051046 CTGTCTGGGCGGCGGCTCTGGGG + Intronic
1185052874 22:48562927-48562949 CCGTCTGTGCGGAGGCCCTGGGG + Intronic
1185362053 22:50414295-50414317 CTGTCGGTGCAGAGCCACAGGGG + Intronic
950129695 3:10533734-10533756 CTGTCCCAGCACTGGCACTGGGG - Intronic
950578789 3:13849828-13849850 CGGCCTGTGCAATGGCCCTGAGG + Intronic
950820481 3:15753070-15753092 CTCTGTGGGCAGTGGCAGTGAGG + Intronic
950941016 3:16891544-16891566 ATGTGTGTGCAGTTGTACTGAGG - Intronic
951707564 3:25558660-25558682 CTGTCAGAGCAATGGCATTGTGG - Intronic
956518527 3:70078410-70078432 CTGGGTGTGGAGTGGCAATGTGG + Intergenic
956601976 3:71032278-71032300 CTGTCTGTGCAGTGGCACTGAGG + Intronic
956663166 3:71618970-71618992 CTTTCTGTAAAGTGGCAATGCGG - Intergenic
958064686 3:88528486-88528508 TTGTCAGGGCAGTGGCAGTGTGG + Intergenic
959184183 3:103023587-103023609 CTGTCCATGCAGAGGCTCTGAGG - Intergenic
960280147 3:115772219-115772241 CTGGCTGTGCACTGGGTCTGAGG - Intergenic
960562163 3:119096660-119096682 CTTTATGTCCAGTGGCACAGTGG + Intronic
960632440 3:119745894-119745916 CTGTTTGTGGATTGGCACTTTGG - Intronic
961189746 3:124948764-124948786 CTTTCTTTGCACTTGCACTGGGG + Intronic
962457071 3:135574388-135574410 CTGTCTGCCCTGTGGGACTGTGG - Intergenic
962877798 3:139549239-139549261 CTATCTCTCCAGAGGCACTGGGG - Intergenic
967440549 3:189502855-189502877 ATCTCTGTGTTGTGGCACTGTGG + Intergenic
968902839 4:3439363-3439385 CTGTCTGTGCAGGGGCCTTCGGG + Intronic
968946788 4:3669113-3669135 CCGTCTGTGCACTGGCCCTGCGG + Intergenic
969198680 4:5584503-5584525 CTGTCTGTGCTGTGGGGTTGTGG - Intronic
969310015 4:6347633-6347655 CTGGCTGTGCAGGGACTCTGGGG + Intronic
971225942 4:24751695-24751717 CTGTCTGTGCAAAGGCCCTGAGG - Intergenic
974474382 4:62361197-62361219 CTGGCTCTGAAGTGGTACTGGGG + Intergenic
974650825 4:64751725-64751747 TTATCTGTGCAGTGTCAGTGAGG + Intergenic
975313493 4:72928020-72928042 CTGGCTGTACAGTGGCATGGAGG + Intergenic
975594435 4:76035295-76035317 CTGTCTTTGCATAGGCCCTGGGG - Exonic
975619002 4:76276760-76276782 CAGTGTGTGTAGAGGCACTGAGG + Intronic
976557853 4:86469385-86469407 ATGTCTGGGCACTGGTACTGGGG - Intronic
978981795 4:114956248-114956270 ATCTCTGAGCAGTGGCACAGAGG + Intronic
981416805 4:144503362-144503384 CTGTCTCTGCCCTGACACTGTGG - Intergenic
984823288 4:183903320-183903342 CAGTCTGTGCAAAGGCCCTGGGG - Intronic
985141475 4:186844413-186844435 TTTTCTGTGCTGTGCCACTGTGG + Intergenic
986224654 5:5801498-5801520 TTGTCTGTGCAGTGGGATGGAGG + Intergenic
986965348 5:13263737-13263759 CTGACTCTGCAGTGGCACCTTGG - Intergenic
989160309 5:38384645-38384667 CAGTCTGTGCAGTGACAGAGTGG + Intronic
989177481 5:38542734-38542756 CTGTCTGTGCGGGAACACTGAGG - Intronic
989698398 5:44232055-44232077 CTCACTGGGCAGTGGCAGTGGGG + Intergenic
991093941 5:62719734-62719756 CTGTCTGTGCAGCAGCAGAGGGG + Intergenic
991154440 5:63414987-63415009 CTGTCTGTGCAGTGCCAGCAGGG + Intergenic
991499406 5:67261864-67261886 CTGTCTCTGGAGTGGCAGAGGGG + Intergenic
992340118 5:75814703-75814725 CTGTTGGTGCAGGGGCACAGTGG - Intergenic
996329090 5:122310832-122310854 CTATCTGAGTAGTGGCAATGGGG - Intergenic
997200982 5:132010119-132010141 CTGGCTGTGCAGGGGCACTCTGG - Intronic
997341642 5:133149803-133149825 CTGTCTGGGCAGCAGCCCTGCGG + Intergenic
998941612 5:147289096-147289118 CTGTATGTGCAGTGTCAAGGGGG + Intronic
999971132 5:156864526-156864548 CTGTATGTGCAAAGGCCCTGAGG + Intergenic
1000502282 5:162067042-162067064 GTGTCTGTGCATTTTCACTGGGG + Intergenic
1001586642 5:172837252-172837274 CTGTCTGTGAAATGGGAATGAGG + Intronic
1001698833 5:173692062-173692084 CTGCCTGTGCAAAGGCCCTGAGG + Intergenic
1001813244 5:174646631-174646653 CTGTCTGGGTTGAGGCACTGGGG + Intergenic
1002341161 5:178517371-178517393 CTGTCTATACACGGGCACTGTGG + Intronic
1002643753 5:180642966-180642988 CTATCTGTACAGTGGCAATACGG - Intronic
1003444441 6:6171844-6171866 CTGTATGTGCAAAGGCCCTGGGG - Intronic
1003841961 6:10129828-10129850 CTGTCAGTGCAGGGTAACTGTGG + Intronic
1005922843 6:30416695-30416717 CTGTCTGTGCAGGAGCTATGAGG - Intergenic
1006516575 6:34548939-34548961 CTGGCTGTGCTGTGTGACTGTGG - Intronic
1007589182 6:43011302-43011324 CTGTGTGGGCTGTGGCCCTGTGG - Exonic
1007953971 6:45899664-45899686 CTGTCTGTGGAGTGGCCATGGGG + Exonic
1008294143 6:49756256-49756278 CTCTCTCTGCAGTGGCAGAGAGG + Intergenic
1012134846 6:95543047-95543069 CTGCCTCTACAGTGGCACTCTGG - Intergenic
1012405061 6:98886683-98886705 CCTGCTCTGCAGTGGCACTGCGG + Intronic
1013611428 6:111799698-111799720 CTGCCTGTCCAGAGCCACTGAGG + Intronic
1014237314 6:118972825-118972847 CTGTCTGAGGAGTACCACTGAGG + Intronic
1015589265 6:134806887-134806909 ATGTCTGTGAAATTGCACTGTGG - Intergenic
1016189025 6:141237148-141237170 TTGGCTGGGCAGTGGCAGTGGGG - Intergenic
1017870142 6:158480027-158480049 CTGTCTCTGCCCTGGCTCTGTGG - Intronic
1017984162 6:159427968-159427990 CTGTCTGGCCTGTGGCACTTTGG - Intergenic
1018055428 6:160048147-160048169 CTGTCAGTGCAGAGGCACGGGGG + Intronic
1018984256 6:168623880-168623902 CTGTCGGTGCAGTGGCTGTGGGG + Intronic
1019100447 6:169625483-169625505 CTGTCTGTGCTCTTGCTCTGTGG - Intronic
1020747645 7:12097995-12098017 CTCTCTCTGCAGTGGCACAGTGG - Intergenic
1021203663 7:17753735-17753757 CTTTCTGTCCACTGGCTCTGGGG + Intergenic
1021316412 7:19153364-19153386 CTGTCTTTGAAGTTACACTGAGG + Intergenic
1021980458 7:26049250-26049272 CTGTCCCTGCAGTGACTCTGAGG - Intergenic
1022652143 7:32287331-32287353 CAGCCTGTGCAGAGGCCCTGTGG - Intronic
1023585317 7:41724072-41724094 CTCTCTGTGCAGTGAAAGTGGGG + Intergenic
1024511613 7:50208553-50208575 CTGTCCTTTCCGTGGCACTGGGG + Intergenic
1024644572 7:51360495-51360517 CTGTCTGTGCTTTTGCAGTGAGG + Intergenic
1024895759 7:54259661-54259683 CTCTGCGTGCAGTGCCACTGTGG - Intergenic
1026664892 7:72333799-72333821 GTGTCTGTGCAGTTGGTCTGGGG - Intronic
1026848972 7:73713059-73713081 CTGTCTGTGGAGTGGATTTGGGG + Intronic
1027520782 7:79204052-79204074 CTCTCTGTGCTGTGGCACCTTGG - Intronic
1028087219 7:86651134-86651156 CTGTCTGTGGGAAGGCACTGAGG - Intronic
1028129438 7:87152663-87152685 CTGTCGGCGCCGGGGCACTGCGG + Exonic
1029363931 7:100105508-100105530 CCCTCTGTGCAGTGGGACCGAGG + Exonic
1032923918 7:136580255-136580277 CTGTCTGTTGAGTGGCACCCAGG + Intergenic
1033593219 7:142832386-142832408 CTGCCTGTGCAGTGTGACTCTGG - Intergenic
1034785387 7:153921581-153921603 CCCTCTTTACAGTGGCACTGTGG - Intronic
1035057965 7:156049568-156049590 CTGTCAGTGCACTGGCTCAGGGG + Intergenic
1036076950 8:5512751-5512773 CTGTGTGTGCTGTGGCAATGTGG + Intergenic
1036180425 8:6579873-6579895 CTGTGTGGGCAGTGTGACTGTGG - Intronic
1038436824 8:27542091-27542113 CTACCTGTGCAGTCACACTGGGG - Intronic
1039968360 8:42299922-42299944 CTGTCTGTGCCTTGGCAGTGAGG + Intronic
1043566109 8:81549904-81549926 CTATCTGTCTAGTGGCACTGGGG - Intergenic
1043860957 8:85316657-85316679 CTGACTGTGCAAAGGCACTGAGG + Intergenic
1043867707 8:85394850-85394872 CTCTCTGCTTAGTGGCACTGGGG + Intronic
1043916704 8:85930705-85930727 ATAGCTGTGCAGTGGCATTGGGG - Intergenic
1045550911 8:103171594-103171616 CTGTTTTTGCAGTTGCCCTGGGG + Intronic
1049018604 8:139939025-139939047 CTGTCTGTCAAGTGGCAGGGAGG - Intronic
1049758597 8:144321743-144321765 CTGGCTGTGGACTAGCACTGGGG + Intronic
1051333755 9:16048053-16048075 CTGCCTGTGCATTTCCACTGAGG - Intronic
1052836731 9:33255552-33255574 GTTGCTGTGCAGTGGCCCTGAGG - Intronic
1055131392 9:72778994-72779016 TTGTCGGGGCAGTGGCAGTGGGG - Intronic
1056101682 9:83305806-83305828 CAGTCTTTGCATTGGCACTTTGG - Intronic
1057843145 9:98502334-98502356 CTTGCAGTGGAGTGGCACTGTGG - Intronic
1058621555 9:106888621-106888643 CCGTATATGCAGTGCCACTGTGG + Intronic
1060207717 9:121692321-121692343 CTGTATGTGTGGTGGCACTGGGG + Intronic
1062303745 9:135890236-135890258 TTGTGTGTGCAGAGGCTCTGTGG - Intronic
1062502095 9:136856026-136856048 CTGTCTCTGCAGCGGGCCTGGGG + Exonic
1186237708 X:7531494-7531516 CTGTCTGTGCAAAGGCCCTGGGG + Intergenic
1189995846 X:46636683-46636705 CTGTCTGTGCTGTGGCACTTTGG - Intronic
1190320958 X:49178953-49178975 CCGTCTGTGCAGTGGACATGGGG - Intronic
1192152099 X:68718808-68718830 CTGCCTGTGCTGTGGCCTTGAGG + Intronic
1193352211 X:80476756-80476778 CTGTATCTGCAGTAGCAGTGAGG + Intergenic
1194998894 X:100622773-100622795 CTCTCTGGGCAGTGGGAGTGAGG + Intergenic
1195914462 X:109922431-109922453 CTGTCTAAGCAGTAGCACTGGGG - Intergenic
1196641579 X:118068705-118068727 CTCTCAGTGCAGTAGCCCTGTGG - Intronic
1197482140 X:127000399-127000421 CTTTCAGTGCTGTTGCACTGGGG + Intergenic
1198480801 X:137038154-137038176 CTTTCTGTGCAGTGCCCCTCTGG - Intergenic
1198979328 X:142377136-142377158 CAGTATGTGCAGAGGCTCTGGGG + Intergenic
1199306364 X:146271204-146271226 CTGTTTGTGCAGTGGAAGTATGG - Intergenic