ID: 956604074

View in Genome Browser
Species Human (GRCh38)
Location 3:71053882-71053904
Sequence CTGGATAAATACATGTTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 242}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956604074_956604079 15 Left 956604074 3:71053882-71053904 CCATGCAACATGTATTTATCCAG 0: 1
1: 0
2: 4
3: 29
4: 242
Right 956604079 3:71053920-71053942 AGATCCTATTTAATCTATCATGG 0: 1
1: 0
2: 0
3: 11
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956604074 Original CRISPR CTGGATAAATACATGTTGCA TGG (reversed) Intronic
901178159 1:7319963-7319985 CTGGGTAAATAAATTTAGCAAGG - Intronic
901445823 1:9307516-9307538 CTGGCTAATTAAATTTTGCATGG + Intronic
901617101 1:10549967-10549989 CTCAATAAATACTTGTTGGATGG - Intronic
902436564 1:16401769-16401791 TTGGGTAACTACAGGTTGCAGGG - Intronic
902773630 1:18660615-18660637 CGTGGTAAATACAGGTTGCAGGG - Intronic
903390876 1:22962984-22963006 CTCAAGAAATACATGTTGGACGG + Intronic
905671951 1:39797247-39797269 ATGGATAAATACATATTGTATGG + Intergenic
907984799 1:59520060-59520082 CTGGATAATTCTTTGTTGCAGGG - Intronic
910781604 1:90942391-90942413 CAGGAAAAAAACAGGTTGCAAGG - Intronic
911095533 1:94051864-94051886 GTGGATAAAAATATGTTGGAAGG - Intronic
914768503 1:150661441-150661463 CTGGATAAACAAATGTGGTATGG + Intronic
917589790 1:176464360-176464382 CTCAATAAATACTTGTTGAAAGG - Intronic
918235308 1:182574569-182574591 CTGGATAATTCTTTGTTGCAGGG + Exonic
918305739 1:183244424-183244446 CTCAATAAATATATGTTGGAAGG - Exonic
918485026 1:185019671-185019693 TTGGATGAATAAATGTAGCAGGG + Intergenic
918610412 1:186483969-186483991 CTGGAAAAAAACATGTTTGAAGG + Intergenic
919844103 1:201630098-201630120 CTGAATAAATGAATGATGCATGG + Intronic
922650893 1:227337381-227337403 CTGAATAAAGACATGCAGCAAGG + Intergenic
923730881 1:236548425-236548447 CTCCATAAATACTTGTTGAATGG - Exonic
1063507170 10:6610367-6610389 CTGAATAAATATATGTTGAATGG - Intergenic
1063892543 10:10645206-10645228 CTTGTTGAATACATGTTTCAGGG + Intergenic
1065291523 10:24235000-24235022 CTAGACAGATACATGTTGGAGGG + Intronic
1067973629 10:50998801-50998823 CTGGATATATCCATTTTGCAGGG - Intronic
1070792312 10:79196739-79196761 CTTGATAAATGCTTGTTGCCTGG - Intronic
1072976246 10:100061445-100061467 CTGGCTAAATACAGCTTGCTGGG + Intronic
1073583755 10:104689691-104689713 CTGGATGATAACATCTTGCAGGG + Intronic
1075234541 10:120714854-120714876 CTGGATAACTCCATGTTGTGGGG - Intergenic
1075475970 10:122734253-122734275 CTCAATAAATGCTTGTTGCAAGG + Intergenic
1078235333 11:9479395-9479417 CTGGTTAAGTACATGGTTCAGGG - Intronic
1078978997 11:16510366-16510388 CTGAATTAATACAAGTTGAAGGG - Intronic
1079011307 11:16830684-16830706 CTTGGTAAATACATGGTGAATGG - Intronic
1080168684 11:29272158-29272180 CTGGATAATTATTTGTTGTAAGG + Intergenic
1084097319 11:66920280-66920302 CTGGGTAAATACCAGTTACAGGG - Intronic
1086419598 11:86625591-86625613 CTGGATAAATATTTATTGCATGG - Intronic
1087231378 11:95669629-95669651 ATGGATAAATACATATTGTGGGG - Intergenic
1088136640 11:106563341-106563363 CTGGATAATTCTTTGTTGCAGGG - Intergenic
1089189303 11:116642639-116642661 CTCCATAAATGCATGTTGAATGG + Intergenic
1089844228 11:121445914-121445936 ATGCATAAAAATATGTTGCAGGG + Intergenic
1090383153 11:126340785-126340807 CCTGATAAATACATGTTGAATGG - Intronic
1090384380 11:126348082-126348104 CCGGATAAATAAATGTTTGAGGG + Intergenic
1090407250 11:126484115-126484137 CTTAATAAATACTTGTTGCCTGG + Intronic
1091353773 11:134919376-134919398 CTGGATAAATAGATGCTGGCAGG - Intergenic
1091813271 12:3417388-3417410 TTGAATTAATTCATGTTGCATGG - Intronic
1093092609 12:14938274-14938296 CTGGATAAGTGCATTTTGCCTGG - Intronic
1093688980 12:22088103-22088125 TTCAATAAATACGTGTTGCATGG - Intronic
1093729108 12:22547701-22547723 ATGGATAAATAATTATTGCATGG - Intergenic
1098540507 12:71651072-71651094 CTGGTTAAATACAGATTGCTAGG + Intronic
1098928577 12:76382416-76382438 CTGGATAATTATTTGTTGTAAGG + Intronic
1099413516 12:82360091-82360113 CTGGATGAATATTTGTTGAATGG + Intronic
1100731530 12:97476083-97476105 CTGGATAAATGTCTGTTGCATGG + Intergenic
1101209775 12:102524241-102524263 CTGGATAAATACCTGTTGTGGGG + Intergenic
1101748421 12:107562138-107562160 CTCTATAAATATATGTTGAATGG - Intronic
1102686381 12:114728080-114728102 CTTGATCATTACATGTTGTATGG - Intergenic
1104097882 12:125575921-125575943 CTGGATAAATAACAGTTGGAAGG - Intronic
1105646295 13:22321567-22321589 CTAGAAAAAGACATGTTGGAAGG - Intergenic
1106374007 13:29166170-29166192 CTAGAGAAATAGATATTGCAAGG - Intronic
1106442905 13:29794761-29794783 CCTGATAAATACATTTTGCATGG - Intronic
1107240499 13:38228517-38228539 CTAGATAATCACAGGTTGCAGGG + Intergenic
1107648863 13:42524227-42524249 ATGGATTAATATATGTTTCAAGG - Intergenic
1107744216 13:43487995-43488017 CTGGATACATTCATTTTGCAAGG + Intronic
1108827054 13:54425017-54425039 GTGGATAAAAGCATGTTTCATGG - Intergenic
1110886977 13:80651990-80652012 CTGGAAAAAGAGATTTTGCAGGG + Intergenic
1112950487 13:104989829-104989851 CTGTTTAGATACATATTGCAAGG + Intergenic
1114538511 14:23437980-23438002 CTCAATAAATACTTGTTGAATGG - Intergenic
1115232191 14:31172960-31172982 CTGAATAAATGCTTGTTGAATGG - Intronic
1115557449 14:34554652-34554674 CTGGGTAAATACAAGGGGCAGGG + Intergenic
1116404972 14:44556427-44556449 ATGGATAACTACATGATGAATGG - Intergenic
1117610833 14:57481484-57481506 CTTGATATATTCATGTGGCAGGG + Intronic
1118767724 14:68921368-68921390 CTCGATAAATAAATGTTGAGTGG - Intronic
1119081531 14:71699054-71699076 CTGGATGAAGACAAGTTGCTAGG - Exonic
1119094683 14:71818191-71818213 CTGAAAAAATATATGTAGCAAGG - Intergenic
1119510918 14:75210548-75210570 CTCAATAAATATTTGTTGCATGG + Intergenic
1120649188 14:87110853-87110875 GTTAATAAATACATGTTGCATGG + Intergenic
1120678078 14:87445645-87445667 CTCAATAAATATATGTTGCATGG + Intergenic
1120765011 14:88320973-88320995 AGGGATAAATACATTTTTCAGGG + Intronic
1120969539 14:90195991-90196013 CTTGATAAACACATGTAGGATGG + Intergenic
1122035186 14:98943881-98943903 CAGGATAGAGACATGTTTCAGGG - Intergenic
1125280729 15:38040059-38040081 CTGGAGAAATCCATGTGGCAAGG - Intergenic
1126324257 15:47459196-47459218 TTGGAGAAATCCATGTGGCAAGG + Intronic
1126798022 15:52276139-52276161 CTCAATAAATACATGTTGACAGG - Intronic
1127004583 15:54552157-54552179 TTGAATAAATACATGTTTAATGG - Intronic
1127253402 15:57266410-57266432 ATGGATAAATGAATGTGGCATGG - Intronic
1127296402 15:57612497-57612519 CTCCATAAATACATTTTGAAGGG - Intronic
1127623115 15:60753346-60753368 TTCGATAAATACTTGTTGAATGG - Intronic
1128890601 15:71328483-71328505 CTTGATAAATATATATTGAATGG - Intronic
1134891311 16:17843977-17843999 CTGGATAATTACCTGTTGCAGGG + Intergenic
1135392738 16:22107349-22107371 CTGGATAATTATCTGTTGTAGGG - Intronic
1137533209 16:49297026-49297048 CTGGCACAATACATGTTGCATGG - Intergenic
1138971247 16:62146194-62146216 GTGGATAAATATATTATGCACGG + Intergenic
1143002413 17:3802951-3802973 TTGGATAAATACATACTGGATGG - Intergenic
1147783076 17:42957799-42957821 CTCAATAAATACTTGTTGAATGG - Intronic
1148116364 17:45177684-45177706 ATGGATAAATACAGTTTGAAGGG - Intergenic
1149022663 17:51987592-51987614 CTGAATAAATATTTGTTGAATGG - Intronic
1150202494 17:63371883-63371905 CTGGATAACTACGGGTTACAAGG - Intronic
1150867263 17:68865805-68865827 CTTGATAAATACAGATTGCTGGG + Intergenic
1153613851 18:6915950-6915972 CTGGATAATTCTATGTTGCAGGG - Intergenic
1153808343 18:8730343-8730365 CTGGATAAATATTTGTTCCATGG + Intronic
1156668910 18:39443687-39443709 CTATAAAAATAGATGTTGCAGGG + Intergenic
1156723991 18:40105431-40105453 CTGGACAAATAAATGATGGAGGG + Intergenic
1157855629 18:51102509-51102531 CTGGATAAAGACCTGTATCAAGG + Intergenic
1157993196 18:52522147-52522169 ATGGATAATTACATGGTCCAGGG + Intronic
1158280376 18:55818962-55818984 TTGGATAAATACATCTGGTATGG + Intergenic
1159384504 18:67706350-67706372 CTGGATTAATACATCCTGTAAGG + Intergenic
1159856879 18:73599282-73599304 CTGCATAAATACCTGTTTCCTGG + Intergenic
1162841733 19:13361765-13361787 TTTGATAAATACAGGTTGGAAGG + Intronic
1165599412 19:37040727-37040749 CTGGACAAATTAAAGTTGCAGGG + Intronic
926706226 2:15839667-15839689 CAGGATAAACAAATGGTGCATGG + Intergenic
927184043 2:20469375-20469397 CTCGATAAATATATGTGGAATGG + Intergenic
929810143 2:45182836-45182858 CTGCACAAATTCATGTTTCAGGG - Intergenic
929893562 2:45938561-45938583 CTGAATAAATAGCTGCTGCAAGG - Intronic
930569460 2:53066553-53066575 CTGGATGAATAGATGATGGATGG + Intergenic
932333377 2:70913838-70913860 CTTATTAAATACATGTTGAATGG + Intronic
932610851 2:73198786-73198808 CTGGATAGTAACATGTTGCAGGG + Intergenic
934607038 2:95703684-95703706 ATGGTTAAATAGTTGTTGCAGGG + Intergenic
935903174 2:107814467-107814489 CTGGATAAAACCATGTAGGATGG - Intergenic
936713404 2:115159882-115159904 CAGGATAAGTACATGCTGGAGGG - Intronic
936970229 2:118169816-118169838 CTGATTAATTACTTGTTGCAGGG - Intergenic
937085084 2:119166284-119166306 CTGGATAAATAGTTCCTGCATGG - Intergenic
939261225 2:139812322-139812344 CTGGATAAATGAATATTGAATGG + Intergenic
941286163 2:163615259-163615281 CTGGATAAATTCTCGTTTCAGGG - Intronic
944437151 2:199702590-199702612 CTTGATAAATATTTGTTGAATGG - Intergenic
944697379 2:202214539-202214561 GTGGAAAAATACAGGTTACAAGG - Intronic
945058303 2:205887102-205887124 GTGCATAAATACATTTTGGAAGG - Intergenic
945773121 2:214070142-214070164 CTTGAAAAATACTTGTTGCAAGG - Intronic
947289846 2:228560808-228560830 TTGGATAAATACATCATTCAAGG - Intergenic
948818697 2:240527354-240527376 TTGGATGAATGGATGTTGCATGG + Intronic
948818715 2:240527453-240527475 CTGGATGAATGGATGTTCCATGG + Intronic
1171066566 20:22022217-22022239 CTTCATAAATACTTGTTGAATGG + Intergenic
1174656259 20:52174980-52175002 TTGGAAAAATAAATGTTGAAAGG - Intronic
1177121651 21:17144331-17144353 CTGGATAATTATTTGTTGTAGGG - Intergenic
1178093986 21:29194370-29194392 GGTGATAAATAGATGTTGCAAGG + Intronic
1179425998 21:41279214-41279236 CTGGAAAAATACATTTTGAGAGG + Intronic
1181690481 22:24556125-24556147 CTGGAGAAAGACTTGCTGCATGG + Intronic
1182726648 22:32452246-32452268 CTCAATAAATACTTGTTGAATGG + Intronic
1182942987 22:34296082-34296104 CTGGAGAAATACATTTTGATAGG + Intergenic
1183560280 22:38567485-38567507 CTGGATAATTCTTTGTTGCAAGG - Intronic
1183908358 22:41060064-41060086 CTGGATAAAAAGATTCTGCAGGG - Intergenic
949492926 3:4606591-4606613 ATGGTAAAACACATGTTGCAAGG + Intronic
953720631 3:45351795-45351817 CTCAATAAATACTTGTTGAATGG - Intergenic
954954661 3:54508517-54508539 CTCAATAAATACTTATTGCAAGG + Intronic
954998550 3:54904713-54904735 CTGGATAAATACATGATTCAAGG + Intronic
955100301 3:55842581-55842603 CTGGTTAAATATAGGTTGCTAGG + Intronic
955154452 3:56402897-56402919 CTGGATAATTCTTTGTTGCAAGG + Intronic
955800090 3:62677577-62677599 CTGGATAATTCCTTGTTGCAGGG - Intronic
956604074 3:71053882-71053904 CTGGATAAATACATGTTGCATGG - Intronic
956761974 3:72451677-72451699 CTGGATAGATCCATATGGCAGGG + Intergenic
956846079 3:73184026-73184048 CAGGTAAACTACATGTTGCATGG + Intergenic
959947315 3:112139205-112139227 CTGGTTATATACATCATGCATGG + Intergenic
960165525 3:114397021-114397043 CTGGACAAATACATCTGGTAAGG - Intronic
960195929 3:114768037-114768059 ATGGATAATTAGATGGTGCAGGG - Intronic
960363514 3:116743206-116743228 TTGGTTAAATACATGTGGCAAGG - Intronic
960811139 3:121628466-121628488 CTGGATAATTCTTTGTTGCAAGG + Exonic
962340721 3:134580821-134580843 CAAGATAATTACAGGTTGCAGGG - Intergenic
962903977 3:139785345-139785367 ATTCATAAATACTTGTTGCATGG - Intergenic
963380093 3:144518418-144518440 CTGGAGAAAAAGATATTGCAAGG + Intergenic
967093961 3:186161602-186161624 CTGGATGCAGCCATGTTGCACGG - Exonic
967811435 3:193764457-193764479 CTCAATAAATATTTGTTGCATGG + Intergenic
969345139 4:6565135-6565157 CCTGATAAATACATGTCCCACGG + Intergenic
970325639 4:14920580-14920602 CTGGATAAATCTATGTTGGATGG + Intergenic
970845479 4:20532858-20532880 CTTAATAAATATTTGTTGCATGG - Intronic
971481642 4:27120055-27120077 CTTGTTAAATGCATGTTTCATGG - Intergenic
971759740 4:30750082-30750104 CAGAATAAGTATATGTTGCAAGG - Intronic
972201135 4:36715979-36716001 ATGGCTAAAGACATGTGGCAGGG - Intergenic
972419983 4:38877986-38878008 CTGGATAAATAAATCTGGTAGGG - Intronic
973206744 4:47569514-47569536 CTTGATAAATACTTGTGGAATGG - Intronic
974284918 4:59852184-59852206 GTGGAAAAATACAAGTTACATGG + Intergenic
975155996 4:71073753-71073775 CTGTATAAATACTTGATGGATGG + Intergenic
976905094 4:90227532-90227554 ATAGCTGAATACATGTTGCAAGG - Intronic
977408698 4:96633656-96633678 CTCTATAAATAATTGTTGCAAGG - Intergenic
977800720 4:101227617-101227639 ACAGATAAATTCATGTTGCAGGG + Intronic
977852882 4:101851394-101851416 CTTAATAAATACTTGTTGCCTGG - Intronic
979051535 4:115940435-115940457 CTGGAAAAAAACATGTTGTGAGG + Intergenic
981997896 4:150994426-150994448 CTTAATAAATACATGTTGGATGG - Intronic
982366509 4:154585284-154585306 CTCAATAAATACATGTTAAATGG - Intronic
982681776 4:158439897-158439919 CTAAAGAAATACATGTTGTAAGG + Intronic
984064129 4:175027181-175027203 TTGGATAAATACATCTGGTATGG - Intergenic
984417745 4:179482763-179482785 CTGAATAAATACATGTGGTTTGG + Intergenic
984781144 4:183526924-183526946 CTTAATAAATACATTTTGAATGG + Intergenic
985329893 4:188820254-188820276 ATGGATAGGTACATGTTGCTGGG + Intergenic
986114560 5:4759452-4759474 CTGGATAAATACATCTGGTATGG - Intergenic
987723823 5:21671613-21671635 CTGCATAAATACTTGTGGCTTGG - Intergenic
987979070 5:25056317-25056339 TTGAATAAATACATCTTGTAAGG + Intergenic
988263639 5:28924163-28924185 CTGGATAATTATTTGTTACATGG - Intergenic
988418136 5:30971895-30971917 CTAGCTAAATAAATTTTGCATGG + Intergenic
990164544 5:52979828-52979850 CTCAATAAATACATGCTGAATGG + Intergenic
990591809 5:57273281-57273303 CTAAATAAATGTATGTTGCATGG + Intergenic
993182282 5:84569849-84569871 CTGGATAAACAAATGTGGCATGG - Intergenic
994521242 5:100839213-100839235 CTGGGTAAATACATATTGCAAGG + Intronic
994818916 5:104623109-104623131 AAAGATAAATACATGTTCCACGG + Intergenic
995482037 5:112603103-112603125 CTGGATAAATAAATATGGAAAGG - Intergenic
996148272 5:120002081-120002103 CTGGATAAATACATTTTTATGGG - Intergenic
996750711 5:126885894-126885916 ATGGAAAAATAGATGTTCCATGG - Intronic
997185703 5:131879842-131879864 CTCAATAAATACTTGTTGCTTGG - Intronic
997831138 5:137151093-137151115 CTGGTAAAATAGATGCTGCAGGG - Intronic
997979053 5:138457856-138457878 TTTGATAAATACTTGTTGAATGG + Intergenic
1000282420 5:159793667-159793689 TTGGCTAAACACATGTTGAATGG - Intergenic
1000384962 5:160666589-160666611 CAAGAAAAATAAATGTTGCAAGG - Intronic
1000663689 5:163968169-163968191 ATGGTTAAATAAATATTGCATGG + Intergenic
1000761874 5:165236097-165236119 CTGGATAAATCTTTGTTGTAGGG + Intergenic
1001006463 5:168055273-168055295 CTTGATAAATATTTATTGCATGG + Intronic
1001044970 5:168364627-168364649 CTTGATAAATGCTTGTTGCTTGG + Intronic
1003556132 6:7141628-7141650 CAGAATAAAAACATGTAGCAGGG + Intronic
1003889430 6:10550836-10550858 CTGTAGAAATACAGGTTACAGGG - Intronic
1006876227 6:37299504-37299526 CTTAATAAATACTTGTTGAATGG - Intronic
1006886081 6:37383379-37383401 CTGGTTTAATCCCTGTTGCATGG + Intronic
1007662569 6:43495774-43495796 GGGGATAAATACATGCTGTAGGG + Intronic
1008489695 6:52073412-52073434 CTAGTTACATACATGCTGCATGG - Intronic
1008724781 6:54404174-54404196 CAGGCTTTATACATGTTGCAGGG + Intergenic
1008867998 6:56238304-56238326 CTGAATAAATATTTGTTGAATGG + Intronic
1008966579 6:57318697-57318719 CTCAATAAATACTTGTTGAATGG - Intronic
1010051649 6:71511499-71511521 GTGGAGAAATCCATGTGGCAAGG + Intergenic
1010477338 6:76304248-76304270 GTAGATAAAAACATGTTTCATGG - Intergenic
1010618114 6:78039622-78039644 CTGGATACATAATTGTTGAATGG - Intergenic
1011058055 6:83228345-83228367 CTGGATAATTCCTTGTCGCAGGG + Intronic
1011878559 6:91993310-91993332 CAGGATAAATGCATGTGGGATGG + Intergenic
1012745488 6:103081830-103081852 TTGGATAAATACATCTGGTATGG + Intergenic
1014651546 6:124045319-124045341 CTGAATAAATACTGGTTGAATGG + Intronic
1016224984 6:141723883-141723905 CTCTATAAATCCATGTTGCTGGG + Intergenic
1016786442 6:148015743-148015765 CTGAATCAATACCTGTGGCAAGG - Intergenic
1017290236 6:152727308-152727330 CTGGACAAATATTTTTTGCAGGG - Intergenic
1018342505 6:162866989-162867011 ATGGAGAAATATTTGTTGCATGG + Intronic
1020556400 7:9675374-9675396 CTGGAAAAATATTTCTTGCAGGG - Intergenic
1021292225 7:18860433-18860455 TTGGAAAGATACATGTTGCAGGG + Intronic
1027499100 7:78925721-78925743 TTTGAAAAATACATTTTGCAAGG - Intronic
1027684716 7:81266411-81266433 CAGGATACATAAATGTTGCAGGG + Intergenic
1027833892 7:83216916-83216938 TGAGATAAATAGATGTTGCAAGG + Intergenic
1031255446 7:119441665-119441687 ATGGATAAATATATGTAGGAAGG - Intergenic
1032366580 7:131305787-131305809 TTCCATAAATATATGTTGCAAGG + Intronic
1032645530 7:133819486-133819508 CTGGATGAATGCATGTTGCATGG + Intronic
1032866094 7:135925708-135925730 CTGGTTAAATACATTTTAAAGGG - Intergenic
1035439846 7:158887825-158887847 GTGCATAAATACATGTCACAAGG - Intronic
1040719558 8:50301791-50301813 TTCAATAAATACATGTTTCAGGG - Intronic
1042345804 8:67726532-67726554 TTGGAAAAATACATGTTATAGGG + Intronic
1043264081 8:78240515-78240537 CTGGATAACTACTTGTTAAAGGG + Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043390283 8:79785136-79785158 CTTGCTAAATGCATGTTGAATGG - Intergenic
1044182555 8:89213844-89213866 CAGGAAAAATACATGATTCATGG - Intergenic
1045170161 8:99656915-99656937 CCAGAAAAATACAGGTTGCATGG - Intronic
1046687691 8:117245387-117245409 CTGGATAAATAATTGTTGCCAGG + Intergenic
1046839149 8:118838212-118838234 CTGGATAACTTCATGATGGAAGG - Intergenic
1047353177 8:124095256-124095278 CTGGATAATTCCCTGTTGGAGGG - Intronic
1047555549 8:125925267-125925289 CTCAATAAATATATGTTGAATGG - Intergenic
1047919447 8:129618825-129618847 GAGGATAAACACCTGTTGCATGG - Intergenic
1048024115 8:130568702-130568724 CTGGATAAATGGATGTTAGATGG + Intergenic
1051816570 9:21114251-21114273 CTGTATCAATACAGGCTGCAAGG + Intergenic
1053355130 9:37438910-37438932 GTGGATAATTTCATGTTCCAGGG - Exonic
1054778718 9:69146827-69146849 CTGGATAATTCGTTGTTGCAGGG - Intronic
1055387752 9:75781514-75781536 ATCAATAAATACATTTTGCATGG + Intergenic
1057617984 9:96609515-96609537 CTCAATAAATACTTGTTGAATGG + Intronic
1059409082 9:114120795-114120817 CTGGATAGATAGATGATGGATGG + Intergenic
1059525066 9:114983868-114983890 CTGGATAATTCTATGTTGCAGGG + Intergenic
1060156622 9:121324793-121324815 CTAAATAAATACCTGTTCCATGG - Intronic
1060301977 9:122379390-122379412 TTGGATAATTACAGGTGGCATGG - Intronic
1060439290 9:123623872-123623894 CTGGACAAAGACATGTTAAATGG - Intronic
1185625072 X:1475307-1475329 ATGGATGAATAGATGATGCATGG + Intronic
1185883877 X:3764555-3764577 ATGGATGAATACATATTGAATGG - Intergenic
1186955865 X:14681423-14681445 GTGGATAAATACATGGTGGATGG - Intronic
1188186675 X:27124981-27125003 CTGGATAATTATCTGTTGTAGGG + Intergenic
1188456067 X:30367535-30367557 TTGGAGAAATACATTTTGTAAGG - Intergenic
1189961064 X:46325295-46325317 GTGGATAAATACGTGTTGAGTGG + Intergenic
1191710144 X:64140875-64140897 CTTAATAAATACTTGTTGAATGG + Intergenic
1193009290 X:76657906-76657928 ACGGATAAATACTTGTTACAGGG + Intergenic
1194080008 X:89450053-89450075 CTGGATAAATACTTATCTCAGGG + Intergenic
1194497104 X:94630256-94630278 CTGGATAACCATATTTTGCAGGG - Intergenic
1195732181 X:107979037-107979059 CTGGATAATTCTTTGTTGCAGGG - Intergenic
1196291094 X:113942408-113942430 TTGGATAAATACTTATTGCTTGG + Intergenic
1197287252 X:124610300-124610322 CTGTATAAATACGTATTGCATGG - Intronic
1198200698 X:134415736-134415758 ATGGATAGATACATGTTACTAGG - Intronic
1198228126 X:134665414-134665436 ATGGATAAATACATTGTGCTGGG - Intronic
1198724515 X:139663492-139663514 ATAGATAAACACGTGTTGCAGGG + Intronic
1199103038 X:143828174-143828196 TTGGCTAATAACATGTTGCAAGG - Intergenic
1200351965 X:155506570-155506592 CTGGATACATAAATGTTGTTGGG + Intronic
1200416266 Y:2914543-2914565 CTGGATACGTACAAGTTCCAAGG + Intronic
1202248353 Y:22842703-22842725 ATGGATAATGACATATTGCAAGG + Intergenic
1202401341 Y:24476451-24476473 ATGGATAATGACATATTGCAAGG + Intergenic
1202469439 Y:25193635-25193657 ATGGATAATGACATATTGCAAGG - Intergenic