ID: 956606965

View in Genome Browser
Species Human (GRCh38)
Location 3:71082945-71082967
Sequence AGGTTCCTTTTAGAAGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 194}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956606965_956606971 20 Left 956606965 3:71082945-71082967 CCTCCATCTTCTAAAAGGAACCT 0: 1
1: 0
2: 0
3: 17
4: 194
Right 956606971 3:71082988-71083010 TTATCTATTCTGGATCTACGTGG 0: 1
1: 0
2: 0
3: 6
4: 76
956606965_956606973 29 Left 956606965 3:71082945-71082967 CCTCCATCTTCTAAAAGGAACCT 0: 1
1: 0
2: 0
3: 17
4: 194
Right 956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG 0: 1
1: 0
2: 0
3: 6
4: 89
956606965_956606969 10 Left 956606965 3:71082945-71082967 CCTCCATCTTCTAAAAGGAACCT 0: 1
1: 0
2: 0
3: 17
4: 194
Right 956606969 3:71082978-71083000 AAGTTACTCCTTATCTATTCTGG 0: 1
1: 0
2: 2
3: 12
4: 159
956606965_956606972 28 Left 956606965 3:71082945-71082967 CCTCCATCTTCTAAAAGGAACCT 0: 1
1: 0
2: 0
3: 17
4: 194
Right 956606972 3:71082996-71083018 TCTGGATCTACGTGGTTTTAAGG 0: 1
1: 0
2: 0
3: 4
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956606965 Original CRISPR AGGTTCCTTTTAGAAGATGG AGG (reversed) Intronic
901360943 1:8699892-8699914 AGTTTGCTGATAGAAGATGGGGG - Intronic
902143538 1:14377315-14377337 AGGTGCCTTGTAGAAATTGGAGG + Intergenic
902738476 1:18417295-18417317 AGGGTCCCTTTAGATGATTGGGG + Intergenic
904571076 1:31465654-31465676 AAGTTGCTCTTGGAAGATGGAGG - Intergenic
906010433 1:42519323-42519345 ATGTTCCTTTAAGAAAATGAAGG - Intronic
907824868 1:58005889-58005911 AGTTTCCTTTTGGAAAAAGGAGG - Intronic
909352862 1:74674248-74674270 AGCTGGCTTTCAGAAGATGGGGG + Intergenic
911713510 1:101102383-101102405 AAATTCAGTTTAGAAGATGGAGG - Intergenic
913230843 1:116739839-116739861 AAGTTCCTGTTTGAAGAGGGAGG + Intergenic
913295334 1:117313802-117313824 AGGTTCCTTTCTGAACATTGTGG + Intergenic
915408393 1:155680490-155680512 AGATTCATTTTACAATATGGAGG + Intronic
917411004 1:174760043-174760065 AGGTAGGTTTGAGAAGATGGTGG + Intronic
921018917 1:211218392-211218414 ATGTTGTTTTTAGAAGAAGGAGG - Intergenic
923465362 1:234243571-234243593 AGAATCCTTTTAGAGGATGTAGG + Intronic
923797279 1:237170041-237170063 AAGTTTATTTTGGAAGATGGAGG + Intronic
1065669118 10:28094556-28094578 AGGTTCTTTTAAGTAGTTGGAGG - Intronic
1067967270 10:50926736-50926758 AGCTGCCTTTTAGAAGATGTAGG - Intergenic
1069362087 10:67654158-67654180 GGGTTCCTTTTAGAAGGAGGTGG - Intronic
1070176786 10:73977504-73977526 TGGTTCCTTTTAGCAGATAATGG + Intergenic
1070694993 10:78556106-78556128 ATGTTCCTATTAAAAGATAGAGG - Intergenic
1071752281 10:88493782-88493804 TGTTTCCTTTTATATGATGGGGG + Intronic
1072793277 10:98334934-98334956 TGGTTCCTTTTAGTGGAGGGTGG + Intergenic
1074034122 10:109720585-109720607 AGATTCCTTCTAAAAGATTGGGG - Intergenic
1074133220 10:110602756-110602778 AAGTTACTTTTGAAAGATGGTGG + Intronic
1074201547 10:111240639-111240661 AGGTTAACTTTAGAGGATGGTGG + Intergenic
1075931694 10:126302265-126302287 ACTATCCTTTTACAAGATGGGGG + Intronic
1076201483 10:128562294-128562316 AGGTTCCTTTTAGCAGAGGATGG + Intergenic
1076308315 10:129481201-129481223 AGGTGCCCTTTAGCAGATGGGGG + Intronic
1084862224 11:72026849-72026871 AGCTTCCTTTTGGGAAATGGAGG - Intronic
1085326684 11:75611740-75611762 AGTTGCCTTTTATAAGCTGGAGG + Intronic
1085423338 11:76381903-76381925 AAGCTTCTTTTAAAAGATGGTGG - Exonic
1085556454 11:77427073-77427095 AGGTTCCTTGTAGCATGTGGGGG - Intronic
1086169992 11:83825580-83825602 TGGTCCCTTTTAGATAATGGAGG + Intronic
1087141737 11:94770641-94770663 AGGTTCTTTGCAGATGATGGAGG + Intronic
1090760124 11:129829246-129829268 AGTTTCCTTTAGGAAGATGTAGG + Intronic
1091715700 12:2774769-2774791 AGGTTCCTATGGGAAGGTGGGGG - Intergenic
1094496990 12:30994804-30994826 AATTTCCTTTTATAAAATGGGGG - Exonic
1094765595 12:33590684-33590706 AGGTTCCTCTTAGAAAAAAGTGG - Intergenic
1096204752 12:49711773-49711795 ATGTTCCTTATAGAGGATTGAGG - Intronic
1097390101 12:59000403-59000425 AGATGACTTTTAGAAGATTGAGG - Intergenic
1100761797 12:97815598-97815620 ATGGTCCTTTTAGAATCTGGTGG - Intergenic
1101901967 12:108797646-108797668 AGCTTGACTTTAGAAGATGGAGG + Intronic
1103242883 12:119429614-119429636 GGGTGGCTTTCAGAAGATGGAGG - Intronic
1106401526 13:29435905-29435927 AGCATCCTTCTAGAAGCTGGTGG + Intronic
1106682529 13:32022786-32022808 TTCTGCCTTTTAGAAGATGGTGG - Intergenic
1107447067 13:40479270-40479292 AAGTTTCTTTTAGAAGTGGGAGG - Intergenic
1110708538 13:78624354-78624376 ATGGTACTTTTAGAAGATGGAGG - Intronic
1111960773 13:94807686-94807708 ATGTTGCTGTTTGAAGATGGAGG - Intergenic
1113677958 13:112221450-112221472 ATGCTCATTTTAGAAGATGGAGG - Intergenic
1115146674 14:30234648-30234670 GAGTTCCTATTAGAAAATGGAGG - Intergenic
1116359160 14:43971283-43971305 AGATTCTTGCTAGAAGATGGTGG + Intergenic
1118157123 14:63253218-63253240 AGTGTACTTTTAGCAGATGGAGG - Intronic
1118610575 14:67536381-67536403 AGAGCACTTTTAGAAGATGGTGG + Intronic
1119697662 14:76726513-76726535 AAGTACCTCTTAGCAGATGGGGG + Intergenic
1126447444 15:48764494-48764516 AGGTGCATTTTAGAAGTTAGAGG - Intronic
1126730040 15:51673298-51673320 AGGTTCTTTTCAGCAGCTGGAGG - Intergenic
1128364138 15:66985173-66985195 AGGTTGCTTTCAGCAGAAGGAGG + Intergenic
1131998880 15:98160255-98160277 AGTTTCCTTTTGGAAGAGGATGG - Intergenic
1132400246 15:101500771-101500793 AGATTACTTTTACAGGATGGAGG - Intronic
1133086204 16:3365632-3365654 AGGATGCTTCAAGAAGATGGGGG + Intronic
1133180524 16:4050827-4050849 TGGTTCCTTTTAGTAGAAAGTGG - Intronic
1134003319 16:10799712-10799734 AGGTTCCTCTTAGAAGCAGATGG + Intronic
1136027261 16:27476731-27476753 AAGTTTCTTTTAGTAGATAGGGG + Intronic
1137391394 16:48084262-48084284 AAGTTCCTTTGGAAAGATGGAGG - Intronic
1139466673 16:67157756-67157778 AGGTTTTTGTCAGAAGATGGAGG - Intronic
1140200747 16:72892859-72892881 AGGTTCCTTTCAGAGGATGTTGG + Intronic
1140258532 16:73357611-73357633 AGGCTCCTTTTAGAACCTGGAGG - Intergenic
1143001338 17:3797000-3797022 AGGCTCCGTGTAGAAGATCGAGG - Intronic
1143373840 17:6455876-6455898 GGGTTCCTTGGAGAAGCTGGAGG - Intronic
1144002339 17:11067010-11067032 AGGTTGCTTGTAGGAGATGAGGG + Intergenic
1145889935 17:28407250-28407272 AGTTCCCTTAGAGAAGATGGGGG + Intergenic
1146393248 17:32442300-32442322 AGGTTCCTTTAAGAAGGTCCCGG + Intergenic
1146394208 17:32450030-32450052 AGATTCCTTTTAGAAGTTTTAGG - Intronic
1148696866 17:49565868-49565890 AGCAGCCTTTAAGAAGATGGTGG - Intergenic
1148722079 17:49761249-49761271 AAGTTCATTTTAAAAGATGAGGG + Intronic
1152195867 17:78918000-78918022 AGGCACCTTTGAGAAGTTGGCGG + Intronic
1152532377 17:80926351-80926373 AGGTTCATGTGAGAAGAGGGAGG - Intronic
1153313923 18:3703574-3703596 TGTTTCTTTTTAGAAGACGGAGG + Intronic
1162396758 19:10421540-10421562 AGGGTCCTTCTAGGGGATGGAGG + Intronic
1162895168 19:13761072-13761094 AGGTTCCATTTAAAATGTGGTGG - Intronic
1163209213 19:15828455-15828477 GGTTTCCTTTTAGATGACGGAGG + Intergenic
1168634157 19:57982331-57982353 AGGGTCCTTTTATAAGATTGTGG - Intronic
925895597 2:8469643-8469665 AAGTTCCTATTTGAAGTTGGTGG - Intergenic
926189014 2:10713393-10713415 TGGTTCCTTTTAGTGGATGGTGG + Intergenic
926279230 2:11431449-11431471 AGGGTCTTTTTACATGATGGAGG - Intergenic
926434904 2:12827810-12827832 AGGTAGCTCTTAGCAGATGGGGG + Intergenic
927086351 2:19677185-19677207 AGGTTTTATTTAGAAGATTGGGG - Intergenic
928719592 2:34103888-34103910 AGTTTCTTTTTAGGAGCTGGAGG - Intergenic
931569977 2:63658006-63658028 AGTTTCCTTCTAGAAGATAAAGG + Intronic
933939903 2:87236412-87236434 CTGTTCCTTCTAGAAGAGGGTGG - Intergenic
935663994 2:105494489-105494511 AGGTACCTCTCAGCAGATGGGGG + Intergenic
935839327 2:107092027-107092049 AGGGTGCTTTGAGAAGTTGGAGG - Intergenic
936353234 2:111729361-111729383 CTGTTCCTTCTAGAAGAGGGTGG + Intergenic
936593811 2:113828815-113828837 AGGATCCTTTTAGTAGAAGAGGG - Intergenic
937049948 2:118880385-118880407 ATGGTGCTTTTAGAAGATGCTGG + Intergenic
938644282 2:133315280-133315302 AGGATCTGTTTCGAAGATGGAGG + Intronic
939690439 2:145253861-145253883 AGCTTTCTTTTAGAATGTGGTGG + Intergenic
940344799 2:152618139-152618161 TGGTTCCTTTTATAAGGGGGGGG - Intronic
940438513 2:153684807-153684829 TGGGGCCTTTTGGAAGATGGAGG - Intergenic
941492496 2:166159675-166159697 TGCTTACTTCTAGAAGATGGGGG - Intergenic
941764309 2:169279957-169279979 CAGTTCCATTTAGAAGATGCAGG + Intronic
942655704 2:178211983-178212005 AGGTTCCATTGGGAAGTTGGGGG + Intronic
943363883 2:186951005-186951027 AGGTTTCTTTTTAGAGATGGGGG + Intergenic
945007470 2:205423918-205423940 TGGGGCCTTTTGGAAGATGGAGG + Intronic
945202930 2:207302223-207302245 AGGTTCCTTTTATCAGGTGGAGG - Intergenic
945622672 2:212160619-212160641 ATGTTCCTCTTAGAAGAAGAGGG + Intronic
946741348 2:222805482-222805504 TGGTTCCTTTCAGGAGATGTAGG - Intergenic
948056245 2:235011029-235011051 AGGTTTCTCCTAGAAGAGGGAGG - Intronic
1169915998 20:10684493-10684515 ACCTTACTTGTAGAAGATGGAGG + Intergenic
1170270321 20:14520243-14520265 AGGCTTCTTTTAAAAGATGGTGG + Intronic
1170787620 20:19481373-19481395 AATTTCCTTTTCTAAGATGGTGG - Intronic
1175146633 20:56901450-56901472 AGGATCCTTTTAAAAGAAAGAGG + Intergenic
1177256863 21:18675085-18675107 AGGTTACTATTAGAATATGAAGG - Intergenic
1179970261 21:44832910-44832932 TGGTTCCTCTTTGAAGATAGCGG + Intergenic
1182664460 22:31946953-31946975 ATATTCCATTTAGATGATGGGGG - Intronic
949811114 3:8007306-8007328 AGGTTCCTTGTATTATATGGTGG - Intergenic
950991338 3:17441387-17441409 AGGTTGCTCTTTGAAGATGAAGG + Intronic
951172656 3:19560019-19560041 AGGTTCCTTTGAGAAGAGAAAGG - Intergenic
953131586 3:40144461-40144483 ATGTCCCTTTTAGAAGAATGAGG + Intronic
953319986 3:41962777-41962799 ACCTTCCTTTTTGGAGATGGAGG + Intergenic
954620387 3:51992136-51992158 AGGTTCCATGTACAAGCTGGAGG + Intergenic
954921849 3:54198207-54198229 AGGAGCCTATTAGAGGATGGGGG - Intronic
955774560 3:62419402-62419424 AAGTTCCTTTGAGAGGATGGAGG - Intronic
956606965 3:71082945-71082967 AGGTTCCTTTTAGAAGATGGAGG - Intronic
956773579 3:72547246-72547268 AGCTTCCTTTTAGAAGTACGTGG - Intergenic
958573577 3:95917966-95917988 AGGTTTATTTTAGAATATGAGGG + Intergenic
960589800 3:119354289-119354311 AGTTTCATTTAGGAAGATGGAGG - Intronic
961577155 3:127846930-127846952 AGGTTATTTTCAGAAGATAGTGG - Intergenic
964200847 3:154117480-154117502 AGTTTGCTTTTAGAAGTTGTGGG - Intergenic
965275979 3:166683389-166683411 TGGAACCTTTAAGAAGATGGAGG - Intergenic
965813871 3:172617265-172617287 AGTTTCTGTTTAGAACATGGAGG + Intergenic
966765815 3:183461057-183461079 AGGTATCTATAAGAAGATGGAGG + Intergenic
968149108 3:196323079-196323101 AAGTTGAATTTAGAAGATGGGGG + Intronic
969321555 4:6416114-6416136 AGGTTGTTTTTGGAAAATGGTGG - Intronic
971904518 4:32709810-32709832 AGGTTCCTTTATGATGATGATGG + Intergenic
973080572 4:45987147-45987169 TGGTGCCTTTCAGAGGATGGAGG + Intergenic
973267968 4:48230296-48230318 AGGAACCTTATAGAAAATGGAGG - Intronic
974159480 4:58119338-58119360 AGGGTCCTATGAGAACATGGAGG - Intergenic
974207590 4:58726313-58726335 ATGTTCCTTTTAGAATAGTGTGG + Intergenic
975057512 4:69952970-69952992 ATGTTCTTTTTAGAAAATGTAGG - Intergenic
976674626 4:87690843-87690865 AGGTTCCTTTCACAAGATGTAGG - Intergenic
977657309 4:99536781-99536803 ATGTTCCTACTAGAAGATGTTGG + Intronic
978369063 4:108012236-108012258 AGGTGGCCTTTAGATGATGGTGG + Intronic
978674982 4:111302199-111302221 AGGTGACTACTAGAAGATGGAGG + Intergenic
979198296 4:117945931-117945953 AAGTTCCTTTTAAAAGATTTTGG - Intergenic
979800516 4:124903037-124903059 AAGTTTGTTTTAGAAGACGGAGG + Intergenic
979952854 4:126916271-126916293 AGGTGCCTTTAAGAAAAAGGAGG - Intergenic
980182868 4:129423367-129423389 AGGTTCCTCTAAGGAGTTGGGGG + Intergenic
981062295 4:140437678-140437700 AGGTTTCTGTTACAAAATGGGGG + Intergenic
981779694 4:148413256-148413278 AGGATTATTTTAGAGGATGGTGG + Intronic
985942901 5:3152588-3152610 AAGTTCCTTTTAAAACATCGTGG + Intergenic
986032762 5:3909323-3909345 AGGTCCCTTTTAATTGATGGTGG - Intergenic
987814555 5:22883555-22883577 ATGTTTGTTTAAGAAGATGGAGG - Intergenic
988980176 5:36560559-36560581 AAGTTTCTTTAAGAAAATGGAGG + Intergenic
989251922 5:39327105-39327127 AGAAGCATTTTAGAAGATGGAGG + Intronic
989782964 5:45291626-45291648 AGGATCCCTTGAGGAGATGGAGG - Intronic
990082888 5:51938719-51938741 TGGGGCCTTTTAGAGGATGGAGG - Intergenic
995320485 5:110828040-110828062 AGGTTTCGTTTAAAAAATGGGGG + Intergenic
997167553 5:131676977-131676999 CTGTTGCTTTTAGATGATGGGGG - Intronic
1000458965 5:161488245-161488267 AAGTTCCTTTTAGAAGGAAGTGG - Intronic
1000520577 5:162289865-162289887 AAGTTCCTTATAAAAGGTGGTGG + Intergenic
1000822130 5:165997756-165997778 ATGATCATTTTAGAAGCTGGCGG - Intergenic
1000897538 5:166873843-166873865 TGGTGCCATTTATAAGATGGAGG - Intergenic
1001467456 5:171980955-171980977 AGGTGACTCTTGGAAGATGGGGG + Intronic
1002837212 6:875019-875041 CTGTTATTTTTAGAAGATGGAGG + Intergenic
1005751518 6:28887111-28887133 AGTTTCCTTTTAAAAGAAGCAGG + Intergenic
1007603294 6:43097211-43097233 AGCTTCCCTTTAAAAGATGCAGG - Intronic
1010668996 6:78664124-78664146 AGGTTTGTTTTAGAGTATGGAGG - Intergenic
1010889021 6:81282943-81282965 TGGTTCCTTTTGGAGGATGAAGG + Intergenic
1013946471 6:115728465-115728487 AGGTAGCTCTTAGCAGATGGGGG - Intergenic
1015239931 6:131010898-131010920 ACGTTCCTTTTTGATGCTGGAGG - Intronic
1015827531 6:137330359-137330381 ATTTTCCTTTTTGAAGATTGAGG + Intergenic
1017959115 6:159206598-159206620 AGGTGCCTGTGAGAAGATTGGGG + Intronic
1022302033 7:29110822-29110844 AGAGTCCTTTTAGAAGACAGAGG + Intronic
1022478361 7:30726702-30726724 AGGGTCCTGTTTGAAGGTGGGGG + Intronic
1022674799 7:32489227-32489249 AGTATCCTTTTAAAAGGTGGTGG - Exonic
1024952850 7:54882783-54882805 AGGTCCCTTATAAAAGATGGGGG - Intergenic
1026245359 7:68614929-68614951 AGGTCCCTTTTAAAAGAACGTGG - Intergenic
1031622617 7:123953249-123953271 AATTTCATTTTAGAAGATGGAGG - Intronic
1032610710 7:133409399-133409421 TGATTGCTTTGAGAAGATGGAGG - Intronic
1035131093 7:156654365-156654387 AAGTCCCTGATAGAAGATGGTGG - Intronic
1035750388 8:1992053-1992075 AGGGACCTTTCAGAAGAGGGAGG - Intronic
1037160185 8:15760187-15760209 ATGTTCCTTCTAGAAGATACAGG + Intronic
1040011075 8:42661623-42661645 AGATGCCCTTCAGAAGATGGGGG - Intergenic
1045069837 8:98491080-98491102 TGGCTACTTTTAGAAGATAGAGG - Intronic
1048490093 8:134884379-134884401 TGGCTCCTTTTAGAAAATGAGGG + Intergenic
1049379280 8:142303959-142303981 AGGTGCCCTTTAGACGAGGGTGG - Intronic
1050428245 9:5534637-5534659 AGGTGCCTTTTGGAAAATGGGGG + Intronic
1052330218 9:27260059-27260081 AGCTTATTTTTTGAAGATGGTGG + Intergenic
1053386656 9:37696538-37696560 AAATTCCTTTTGGAAGAAGGAGG - Intronic
1056389855 9:86131084-86131106 AGGTGCCCTCTAGAAGCTGGAGG - Intergenic
1056558621 9:87710414-87710436 TGATTCCTTTTAGAAGGTGTAGG - Intergenic
1057436093 9:95041966-95041988 AGTTTCCTTTTAAAAGAGGAAGG - Intronic
1057767817 9:97938483-97938505 ATGTTCCTTTTTACAGATGGAGG + Intronic
1061535585 9:131247332-131247354 AGATGCCTTTTATAAGGTGGAGG - Intergenic
1061751492 9:132780626-132780648 AGGTTCCTTTGAGGATGTGGTGG - Intronic
1185517374 X:710271-710293 TGGTTCCTTTTAGAAGCTCTAGG + Intergenic
1185586688 X:1246398-1246420 TGGTTCCTTTTAGAAGCTCTAGG - Intergenic
1187555402 X:20346179-20346201 TGGTTCCTTATAGAAGATCACGG + Intergenic
1188104814 X:26137229-26137251 TGGGGCCTTTTAGAAGGTGGAGG + Intergenic
1188147471 X:26630933-26630955 AAGTTCCTTATATAAAATGGTGG - Intergenic
1188489808 X:30725391-30725413 AGCTTCATTTTCCAAGATGGTGG + Intronic
1188806927 X:34601995-34602017 AGGTTCTCTTTCCAAGATGGTGG - Intergenic
1190277901 X:48911093-48911115 AGGGTCCATTTTGAGGATGGGGG - Intronic
1190579440 X:51876726-51876748 ATGTTCTTTTTAGAATGTGGAGG + Intronic
1195415965 X:104619650-104619672 AGTTTCATTTTCCAAGATGGTGG - Intronic
1195701314 X:107707800-107707822 AGTTTAATTTTATAAGATGGTGG + Intergenic
1199052066 X:143247581-143247603 AGCATCCTTTTATAAGATGAAGG - Intergenic
1199318739 X:146412955-146412977 AGGTTCCTTTCAGAACTTGCAGG + Intergenic
1200297209 X:154932525-154932547 AGCTTCCCTTGAGAAGAAGGTGG - Intronic
1200494702 Y:3866804-3866826 AGGTCATTTTTAGAAGATTGTGG - Intergenic
1201412372 Y:13713182-13713204 AGGTACCTCTCAGCAGATGGGGG + Intergenic