ID: 956606966

View in Genome Browser
Species Human (GRCh38)
Location 3:71082948-71082970
Sequence CTCAGGTTCCTTTTAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 367}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956606966_956606971 17 Left 956606966 3:71082948-71082970 CCATCTTCTAAAAGGAACCTGAG 0: 1
1: 0
2: 0
3: 31
4: 367
Right 956606971 3:71082988-71083010 TTATCTATTCTGGATCTACGTGG 0: 1
1: 0
2: 0
3: 6
4: 76
956606966_956606973 26 Left 956606966 3:71082948-71082970 CCATCTTCTAAAAGGAACCTGAG 0: 1
1: 0
2: 0
3: 31
4: 367
Right 956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG 0: 1
1: 0
2: 0
3: 6
4: 89
956606966_956606969 7 Left 956606966 3:71082948-71082970 CCATCTTCTAAAAGGAACCTGAG 0: 1
1: 0
2: 0
3: 31
4: 367
Right 956606969 3:71082978-71083000 AAGTTACTCCTTATCTATTCTGG 0: 1
1: 0
2: 2
3: 12
4: 159
956606966_956606972 25 Left 956606966 3:71082948-71082970 CCATCTTCTAAAAGGAACCTGAG 0: 1
1: 0
2: 0
3: 31
4: 367
Right 956606972 3:71082996-71083018 TCTGGATCTACGTGGTTTTAAGG 0: 1
1: 0
2: 0
3: 4
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956606966 Original CRISPR CTCAGGTTCCTTTTAGAAGA TGG (reversed) Intronic
904198687 1:28805012-28805034 CTCAGGGTCCATTCAAAAGAGGG + Intergenic
904483503 1:30808547-30808569 CTCAGTTTCCTGATAGAACAGGG - Intergenic
906338913 1:44960769-44960791 CTCATGTTGCTTTTATAAAATGG - Intronic
906379185 1:45321054-45321076 CTGGGGTTCCTTTAAGAAAACGG - Intergenic
906987824 1:50705375-50705397 CTCAAATTCCTTTTAGAAACAGG + Intronic
907824869 1:58005892-58005914 CTTAGTTTCCTTTTGGAAAAAGG - Intronic
907825345 1:58011437-58011459 CTCAGCTTCCTCTTAAAATAAGG - Intronic
907921778 1:58920745-58920767 CACAGCTTCCTATTAGATGAGGG - Intergenic
908996623 1:70163393-70163415 ATCAGATTCTTTTTAGAAAAAGG - Intronic
909650912 1:77974942-77974964 CTCAAGTTCCTTATATAAAATGG + Intronic
912338127 1:108882332-108882354 CTCAAGTTCCTTATATAACATGG + Intronic
912459383 1:109820900-109820922 CTCAGGTTCCTGATATAAAATGG - Intergenic
912621888 1:111168943-111168965 CTCAGGTTCCTGATATAAGGTGG + Intronic
913281863 1:117193139-117193161 CTCAAGTTCCTTATATAAAATGG - Intronic
913460028 1:119075360-119075382 CTCAAGTTCCTTATATAAAATGG - Intronic
913994958 1:143644083-143644105 CTTAGTTTTCTTATAGAAGATGG - Intergenic
914237810 1:145827989-145828011 CTCATGTTTCTTTGAGAAGGTGG + Intronic
914435634 1:147656995-147657017 CTCAAGTCCCTTTTATAAAATGG - Intronic
916853310 1:168725829-168725851 TTCAGGTTTATTTTAAAAGAGGG - Intronic
916919343 1:169446767-169446789 TTCAAGTTCCTTTTATAAAATGG - Intronic
917048812 1:170894243-170894265 ATCTGGTTCCTTTGAGGAGATGG - Intergenic
917087845 1:171321396-171321418 CTCAAGTTCCTAATAGAAAATGG + Intronic
918246087 1:182660735-182660757 CTCATGTGCCTTTGAGAACAGGG + Intronic
919107805 1:193175741-193175763 CTCAAGTCCCTTTTATAAAATGG - Intronic
920116747 1:203626991-203627013 CTCAGGTTCCTGAAAGAAAAAGG - Exonic
920930360 1:210382314-210382336 CTAAGATTCCTTTCAGAAAATGG - Intronic
921586505 1:216952633-216952655 CTCAGGATCCTCTCAGAAGGTGG - Intronic
922075233 1:222237066-222237088 CTCAGTTTCCTTCTTGAACATGG - Intergenic
922374668 1:224950302-224950324 TTCATGTGCCTTTTATAAGAAGG + Intronic
922860263 1:228810443-228810465 GTCAGGTGCCTTTGGGAAGAAGG + Intergenic
923173366 1:231438390-231438412 CTCAAGTTCCTTATATAAAATGG - Intergenic
923515359 1:234693382-234693404 ACCTGGTTCCTTTTAGCAGAAGG + Intergenic
923882187 1:238115752-238115774 CTCATGTTGTTTTAAGAAGAAGG + Intergenic
924257664 1:242198251-242198273 ATCAGGATCATTTTATAAGAAGG + Intronic
924303711 1:242665682-242665704 CCCAGCATCCTTTTAGTAGAAGG - Intergenic
1062918869 10:1265064-1265086 TCCAGGTTCCTTTTGGAAGCAGG - Intronic
1064148018 10:12840747-12840769 CACAGGTGCATTCTAGAAGATGG + Intergenic
1064412626 10:15120523-15120545 CTCAAGTCCCTTATATAAGATGG - Intronic
1066070105 10:31799626-31799648 TTCAGTTTCCTTGGAGAAGATGG - Intergenic
1068216912 10:53992822-53992844 CTCAGCTTCAATTTAGTAGAGGG + Intronic
1068784652 10:60958341-60958363 GTCAAGTTCCTTTTGCAAGACGG - Intronic
1068865858 10:61895286-61895308 CTCAAGTCCCTTATATAAGATGG - Intergenic
1069362088 10:67654161-67654183 CTTGGGTTCCTTTTAGAAGGAGG - Intronic
1069621299 10:69838856-69838878 CTCAGGCTCATTTTACAAAATGG - Intronic
1069702776 10:70438792-70438814 CTCTGGTTCATCTTAGAATAAGG + Intronic
1070518398 10:77229091-77229113 CTCAAGTTCCTTCAAGAACATGG - Intronic
1071107439 10:82114970-82114992 CTCAGTTTTCTTTTGGAAAAAGG + Intronic
1071583868 10:86800347-86800369 CTCATGTTCCTATCAAAAGAGGG + Intronic
1072496588 10:95967221-95967243 CTCAGGCCCTTTTTGGAAGAAGG - Intronic
1072666492 10:97396706-97396728 CTCAGGTCCCTTATAAAAAATGG + Intronic
1072793276 10:98334931-98334953 CTCTGGTTCCTTTTAGTGGAGGG + Intergenic
1072973811 10:100040347-100040369 CTCCAGTTCCTTTTATAAAATGG - Intergenic
1073393765 10:103201105-103201127 CTCAGGTTCCTTCTATGAGAGGG - Intergenic
1073568820 10:104558599-104558621 CTCAGTTTCCTTTCAGCTGATGG - Intergenic
1073792342 10:106953264-106953286 CTCAAATTCCTGATAGAAGATGG + Intronic
1074464576 10:113669873-113669895 CTCAAGTTCCTTATATAAAATGG + Intergenic
1074706687 10:116139159-116139181 CTCAGGTTACTTCTATAGGATGG + Intronic
1074891110 10:117737337-117737359 CTCAGTTTCCTCCTATAAGAAGG - Intergenic
1075713671 10:124543858-124543880 CTGTGGTTCCTTTTGGAAGGTGG - Intronic
1076632738 10:131861202-131861224 CTGAGGTGCCTTGGAGAAGAGGG + Intergenic
1076935032 10:133562493-133562515 CTGAGGTTCCTTAAAGAAAATGG + Intronic
1077991562 11:7416702-7416724 CTCAGGTCCCTTATATAAAATGG - Intronic
1078182834 11:9027090-9027112 CTCTGGGTCCTTGTGGAAGAGGG + Intronic
1078306590 11:10194395-10194417 CTCAAGTTCCTTATATAAAATGG - Intronic
1079176798 11:18149665-18149687 TTCAGTTTCCTTATAGAAAATGG - Intronic
1080340817 11:31261645-31261667 CTCAGGTCCCTTATATAAAATGG - Intronic
1080448036 11:32355022-32355044 GTCAGGATGATTTTAGAAGAAGG - Intergenic
1080459910 11:32445358-32445380 CCCAGGGTACTGTTAGAAGAAGG + Intergenic
1080758364 11:35224007-35224029 CTCAAGATTCTTTTAGAAAAGGG - Intronic
1080863087 11:36167462-36167484 CTCATGTCCCTGTAAGAAGAAGG + Intronic
1081360956 11:42177463-42177485 CTCAAGTTCCTTTTATGAAATGG - Intergenic
1081426025 11:42927269-42927291 TCCAGGTCCCTTTTAGAAGGGGG + Intergenic
1082091231 11:48091238-48091260 CTCAGCTCCATTTTACAAGAGGG - Intronic
1082912939 11:58397180-58397202 TTCAAGTTCCTTATAGAAGCGGG - Intergenic
1086169991 11:83825577-83825599 CTCTGGTCCCTTTTAGATAATGG + Intronic
1090298867 11:125616217-125616239 CTCAGGTCCCTTATATAAAATGG + Intronic
1091686793 12:2568064-2568086 CTGAGGTGCCTTCAAGAAGAGGG + Intronic
1091716112 12:2777313-2777335 CTCAGGGCCCTTTGAGAAGCTGG - Intergenic
1091872200 12:3903165-3903187 CTCAAGTTCCTTATATAAAATGG + Intergenic
1093540055 12:20271661-20271683 CTAAGGTTTCATTTTGAAGATGG + Intergenic
1093897294 12:24588599-24588621 CTCAAGTTCCTTATATAAAATGG + Intergenic
1094618591 12:32058768-32058790 CTCAAGTTCCTTATATAAAATGG - Intergenic
1095191009 12:39257968-39257990 CTCAAGTACCTTTTACAAAAAGG - Intergenic
1095312636 12:40718489-40718511 CTCGGGTTCCTTATCGGAGAAGG - Intronic
1095342015 12:41101281-41101303 CTCAAGTTCCTTATATAAAATGG - Intergenic
1098199421 12:68039035-68039057 CTCTGGTTCCTCCTGGAAGAGGG + Intergenic
1102609701 12:114100747-114100769 CTCAGGCTGGTTTCAGAAGAGGG - Intergenic
1103054869 12:117810811-117810833 TTTTGGTTCCTTTTAGAAAAGGG + Intronic
1103824506 12:123726324-123726346 CTCATCTGCCTTTTACAAGAAGG - Intronic
1103826299 12:123741848-123741870 CTCAAGGAACTTTTAGAAGATGG + Intronic
1105519086 13:21115507-21115529 CACAGCTTCCATTTACAAGATGG + Intergenic
1106293100 13:28383922-28383944 CTCAAGTTCCTTATATAAAATGG - Intronic
1106847252 13:33749405-33749427 CTCAAGTTCCTTATATAAAATGG - Intergenic
1109302008 13:60599378-60599400 TTCAGGTTCCTTATAGATGCTGG - Intergenic
1109641222 13:65194182-65194204 CTCAAGTCCCTTATAGAAAATGG + Intergenic
1109685604 13:65815537-65815559 CTCAGTTTCCTTGGAGAAGGTGG - Intergenic
1110114277 13:71792662-71792684 CTCAGTTTCCATTTAATAGAGGG - Intronic
1111537225 13:89618051-89618073 CTTAAGTTCCTTGTAGAAGCTGG + Intergenic
1112264655 13:97912408-97912430 CTCAGGTTTCTTTTAAGAGAAGG + Intergenic
1113677960 13:112221453-112221475 CCCATGCTCATTTTAGAAGATGG - Intergenic
1113727224 13:112614096-112614118 CTCAAGTTCCTTTTAGCATCTGG + Intergenic
1115534983 14:34364380-34364402 CTCAGGTCCCTTGAAGAGGAAGG - Intronic
1115729760 14:36255957-36255979 ATCAGATTCCTTTATGAAGAAGG + Intergenic
1117858801 14:60066662-60066684 CTCAGTTGCCTTTTAGAACTAGG + Intergenic
1118816389 14:69317268-69317290 CACAGTTCCCCTTTAGAAGAGGG + Intronic
1119176333 14:72570282-72570304 CTCAAGTCCCTTTTATAAAATGG - Intergenic
1120189407 14:81426727-81426749 CTCATGTTCATTTTACAAAAAGG + Intronic
1120679400 14:87462155-87462177 CTCAGTTTCCTTTCCCAAGAAGG - Intergenic
1122669097 14:103356176-103356198 TTCAGGGTTCTTTTAGAGGAGGG + Intergenic
1125381888 15:39094793-39094815 TTTATGTTCCTTTTAGAATAAGG - Intergenic
1125628152 15:41125989-41126011 TTCAGGCTCCTTTAAGGAGATGG + Intergenic
1126753374 15:51899913-51899935 CTCAAGTGCCTTATAGAAAATGG - Intronic
1127354596 15:58186212-58186234 CACATGTTCCCTTTAGAAGTAGG - Intronic
1127495478 15:59507354-59507376 TTCAGGTAGCTTTTAGAAGCGGG + Intronic
1127745608 15:61968433-61968455 CTCAAGTTCCTTATATAAAATGG - Intronic
1129015823 15:72467957-72467979 CTCAAGTTCCTTATATAAAATGG - Intergenic
1129117323 15:73371819-73371841 CTCTGGTTCCTTTGATAACATGG + Intergenic
1130543428 15:84838475-84838497 CTCAGCTTATTTTTAGAAGCTGG - Intronic
1131006697 15:88984198-88984220 CTCAGTTTCCCTATAGGAGAGGG - Intergenic
1131811161 15:96174602-96174624 CTCAAGTGCCTTATATAAGATGG + Intergenic
1132076464 15:98825314-98825336 CTCAAGTCCCTTTTATAAAATGG + Intronic
1132105660 15:99060701-99060723 CTCAAGTTCCTTATATAAAATGG - Intergenic
1135046726 16:19162052-19162074 GCCTGGTTCCTTTTAGAAGCTGG + Intronic
1136137602 16:28266631-28266653 TGCAGGTACCTTTTGGAAGATGG - Intergenic
1138332310 16:56224893-56224915 TTCAGGTGCCCTTTAGAGGATGG + Intronic
1138475047 16:57265678-57265700 CTGAGATTCCCTTTGGAAGATGG - Intronic
1139104729 16:63814784-63814806 GTAATGTTCCTTTTAGAATATGG - Intergenic
1141781816 16:86167591-86167613 CTCATGTACCTTTTAGGGGAGGG + Intergenic
1141999257 16:87654839-87654861 CGCTGGTTCCTGTGAGAAGAGGG - Intronic
1142630717 17:1224381-1224403 CTCCATTTCCTTTTAGATGAGGG - Intronic
1142785573 17:2219484-2219506 CCTAGGTTACTTTTTGAAGAAGG - Intronic
1142976513 17:3647907-3647929 CTGAGGTTGCTTTCAGAAGCAGG + Intronic
1143700814 17:8658774-8658796 CTGAGGTGCCTTTGAGAAGCAGG + Intergenic
1144149188 17:12427225-12427247 CTCAGGTCCCTTATATAAAATGG - Intergenic
1144265496 17:13564449-13564471 CTCAAGTTCCTTATATAAAATGG + Intronic
1146143669 17:30390719-30390741 CTCAGGATCCATTTAGGAAATGG + Intronic
1146966087 17:37031352-37031374 CTCAAGTTCCTTATATAAAATGG - Intronic
1147017941 17:37507402-37507424 CCCAGGTTCCCTGTAGAAGCCGG - Intronic
1147328032 17:39679313-39679335 CTCAGCTTCCTTCTTGGAGAGGG - Intronic
1147426034 17:40346344-40346366 GTCTGGTTCATTTTAGAAGTGGG + Intronic
1147678768 17:42225588-42225610 CTCAAGTTCCTTATATAAAATGG + Intronic
1148919829 17:51020785-51020807 CTCAGGTCCCTTATATAAAATGG + Intronic
1149899499 17:60461070-60461092 CTAAGGTTCACTTTTGAAGAAGG - Intronic
1150534897 17:66026672-66026694 CTCAAGTCCCTTTTATAAAATGG + Intronic
1150662710 17:67098310-67098332 CTCGGTTTCCTTTTAAAAGGGGG + Intronic
1150915736 17:69435108-69435130 TTCAGGTTACTATTAGAATATGG - Intronic
1151559660 17:74863448-74863470 CTCAGTTTCCCTGTAGATGAGGG + Intronic
1152532379 17:80926354-80926376 CCCAGGTTCATGTGAGAAGAGGG - Intronic
1152913804 17:83022026-83022048 TTCAGGTTCATTTTTGAAGATGG - Intronic
1155440030 18:25852337-25852359 CTCAGCTTCATTTCAGAAGTGGG + Intergenic
1156659629 18:39331495-39331517 CTCACGTTCCTTATATAAAATGG + Intergenic
1157407014 18:47430242-47430264 CTCAGTTTCCTCATGGAAGAAGG + Intergenic
1158232752 18:55277140-55277162 ATCAGCTTCCTTTCAGTAGAGGG - Intronic
1158781757 18:60661057-60661079 CTCAGGTTCCTTATATAAAGTGG + Intergenic
1160095825 18:75871952-75871974 CTTAGATTCCTTTTGGAAGAAGG - Intergenic
1162396757 19:10421537-10421559 CTCAGGGTCCTTCTAGGGGATGG + Intronic
1162864636 19:13535536-13535558 CTCAAGTCCCTGATAGAAGATGG + Intronic
1168438837 19:56346006-56346028 CTGAGGTTCCTTAAAGAAAATGG - Intronic
925485372 2:4322952-4322974 CTCACGTTCCTTTCTGAAAAAGG + Intergenic
926127395 2:10279927-10279949 CTCAGTTTCCCTCTATAAGATGG + Intergenic
926189012 2:10713390-10713412 CCCTGGTTCCTTTTAGTGGATGG + Intergenic
926512753 2:13802946-13802968 CTCAAGTTCCTTATATAAAACGG + Intergenic
926666260 2:15527077-15527099 CTCTTGTCCCTTTTAAAAGAAGG - Intronic
928845479 2:35666690-35666712 CTCAAGTCCCTTTTAGAAAATGG - Intergenic
930174159 2:48284578-48284600 CTCATGTTCATTTTATAAGCAGG + Intergenic
930251525 2:49040196-49040218 ATCAGGTTTATTTTAGAAAAAGG + Intronic
930463758 2:51717952-51717974 CTCAGGTGCCTTGTATAAAATGG - Intergenic
930705904 2:54504651-54504673 CTCAGGTCCCTTATATAAAATGG - Intronic
930749555 2:54920136-54920158 CTAAGCTTCCTGTTAGCAGAAGG + Intronic
931002404 2:57801976-57801998 TTCTTGTTGCTTTTAGAAGAAGG - Intergenic
931180241 2:59892249-59892271 CACTGGTTACTTTTTGAAGATGG - Intergenic
931632427 2:64312936-64312958 CACAGCCTCCTTTTAGATGAGGG - Intergenic
931833535 2:66076078-66076100 CTGAGATTCCTTTTCTAAGATGG + Intergenic
931884281 2:66599063-66599085 CTCAGGTTCCCTTCTTAAGAAGG - Intergenic
933353055 2:81179820-81179842 CTCAAGTCCCTTATAGAAAATGG + Intergenic
933493212 2:83015286-83015308 CTCAGGTTCTTTTTACATAAAGG + Intergenic
937368709 2:121283545-121283567 CTCAGGTACCTTTTAGGATTTGG - Intronic
937967914 2:127527963-127527985 CTCACCTTCTCTTTAGAAGAGGG - Intergenic
938107864 2:128545470-128545492 CTCAGGTTGTTGTGAGAAGAGGG - Intergenic
938677497 2:133653481-133653503 CTCTGGTTTCTTTTATAAAAGGG - Intergenic
938834208 2:135082905-135082927 CTCAAGTCCCTTTTATAAAATGG + Intronic
939195965 2:138972554-138972576 CTCAGTTTCCCTTCAAAAGATGG - Intergenic
939419071 2:141942576-141942598 TTCAGGTTCCTTTCACAAGGTGG - Intronic
940111430 2:150159191-150159213 CTCAGGGACCTTTTGCAAGAAGG + Intergenic
940358545 2:152771649-152771671 CTCAAGTTCCTCTTATAAAATGG + Intergenic
940739949 2:157495979-157496001 CTCAAGTCCCTTTTATAAAATGG - Intergenic
940922903 2:159329355-159329377 CTCAGGTTCCTTATATAAAATGG - Intronic
942255052 2:174088707-174088729 CTTAGCTCTCTTTTAGAAGAGGG - Intronic
942381633 2:175397839-175397861 CTCATGTTTCATTTAGAAAATGG - Intergenic
942728163 2:179033382-179033404 CTCAAGTCCCTTTTATAAAATGG - Intronic
942894831 2:181039817-181039839 CTCAAGTTCCTTATATAAAATGG + Intronic
943165730 2:184322933-184322955 CTGAAGTTCCTTGAAGAAGAAGG + Intergenic
943262072 2:185678769-185678791 CTGAGGTTCCTTAAAGAAAATGG - Intergenic
943661128 2:190560550-190560572 CTCAGTTTGTTTTTAAAAGAAGG - Intergenic
943785709 2:191876232-191876254 CTCAGATTCCTTTTGAAAGTAGG + Intergenic
945211296 2:207385793-207385815 CTCAGGTCCCTTATATAAGATGG - Intergenic
945829564 2:214766642-214766664 CTCAAGTTTCTTATAAAAGATGG + Intronic
946171229 2:217897154-217897176 CTCAGGTCCATTTTAGAGGGAGG - Intronic
947119930 2:226802736-226802758 CTAAGGTTCATTTTAAAAGAGGG + Intergenic
947677799 2:232000056-232000078 CTCAGGTCCCTTATATAAAATGG + Intronic
947929772 2:233954316-233954338 CTCAGATTCCTTTGAGAATATGG + Intronic
948927069 2:241105955-241105977 CTGGGGTTCCTTTTACAAGCAGG - Intergenic
1168983925 20:2031414-2031436 TTCAGGTTCCCTTTTGCAGATGG + Intergenic
1169095214 20:2891779-2891801 CTCAGGTGCCTTATATAAAATGG + Intronic
1169600878 20:7259342-7259364 CTCAAGTCCCTTTTATAAAACGG + Intergenic
1170344635 20:15370731-15370753 TTCAGATTCCTTTTAGAAAGGGG - Intronic
1170787621 20:19481376-19481398 CTCAATTTCCTTTTCTAAGATGG - Intronic
1172004987 20:31812950-31812972 CTCAGTTTCCTTTTGGAAATGGG + Intergenic
1172529158 20:35618436-35618458 CTTAGGTTCCTGTTGGATGAAGG - Exonic
1174412913 20:50347497-50347519 CTCAAGCTCCTTTTGGAATAAGG + Intergenic
1174809015 20:53630167-53630189 CTCAAGTTCCTTGTATAAAATGG + Intergenic
1175742090 20:61426684-61426706 CTCAGGTCACTTTGATAAGAAGG - Intronic
1176997435 21:15572163-15572185 CTCAAGTTCCTTATATAAAATGG + Intergenic
1178021331 21:28411892-28411914 CTCAGGTTCCACTTCGCAGATGG + Intergenic
1178068901 21:28939248-28939270 CTCAAGTTCCTTATATAAAATGG - Intronic
1178389816 21:32189078-32189100 CTCAGCTTCCTCATGGAAGAGGG + Intergenic
1178729540 21:35087214-35087236 CTCAGGTCCCTTTTGTAAAATGG - Intronic
1179638196 21:42728221-42728243 CTCAAATTCCTTATATAAGATGG - Intronic
1180258848 21:46652158-46652180 CTGAGGTTTATTTTAGCAGATGG - Intronic
1180683464 22:17646048-17646070 CTCAAGTTCCTTATACAAAATGG - Intronic
1181905235 22:26189683-26189705 CTCAAGTTCCTTATAGAAAATGG - Intronic
1182155249 22:28065638-28065660 CTCAGGTGCCCTTCAGAAAAAGG + Intronic
1182906465 22:33941772-33941794 CTCAGCTTCCTTATTGAAGGTGG - Intergenic
1182920705 22:34076391-34076413 CTCAGGTCCCATCTGGAAGATGG + Intergenic
1184044885 22:41966880-41966902 CTCAGTTGCCTTTTAAAATAGGG - Intergenic
1184072937 22:42157269-42157291 CTCAGGTTCCTTATGTAAAATGG + Intergenic
1184369125 22:44071470-44071492 CTAAGTTTTCTTTTAGAAAAGGG + Intronic
949443183 3:4105478-4105500 CTGAGGTACATTTTGGAAGAAGG + Intronic
950698762 3:14725528-14725550 CTCAGGTCCTTTTTGGAAGCAGG + Intronic
950814049 3:15680007-15680029 CTCAAGTCCCTTATAGAAAATGG - Intronic
952342319 3:32456691-32456713 CTCAGGTACGTTCTAGAAGCAGG + Intronic
952396719 3:32927488-32927510 CTCAGGTTCCTTACATAAAATGG + Intergenic
954505834 3:51072054-51072076 CTCTGGTTACTTCTAGGAGAGGG + Intronic
955070400 3:55567948-55567970 ATCTGTTTCCTTTTAGAAGGTGG + Intronic
955940889 3:64146403-64146425 CTCAGCAGCCTATTAGAAGAGGG + Intronic
955996199 3:64683361-64683383 CTCAGGGTTCTTTTATAAAAAGG - Intronic
956367199 3:68517179-68517201 CTCAGTTTCTTTTAAGAAGTTGG - Intronic
956606966 3:71082948-71082970 CTCAGGTTCCTTTTAGAAGATGG - Intronic
957426108 3:80041310-80041332 CTCAGGTCCCTTGTATAAAATGG - Intergenic
957522598 3:81338530-81338552 TTCACTTTCCTTTTAGAATATGG - Intergenic
958541512 3:95481227-95481249 CTCTGGTTCCTTCTATAAAATGG + Intergenic
960033343 3:113077662-113077684 CTCTAGTTCCTTTTATAAAATGG + Intergenic
960058790 3:113297492-113297514 ATCAGCTTGCTTTTAGAAAATGG - Intronic
960523706 3:118684901-118684923 CCCAGATTCCTTTCAAAAGATGG - Intergenic
961056507 3:123793537-123793559 CACAGGTTCGTTTTACATGAAGG + Intronic
961409641 3:126709909-126709931 CTCAAGTCCCTTTTATAAAATGG - Intronic
962100957 3:132342111-132342133 CTCAGATTCTTTTTAGAAGTGGG - Intronic
962429796 3:135308449-135308471 CTCATCTTCCTTTGAGAAGATGG - Intergenic
963633503 3:147763888-147763910 CTCAGGGTTCTTTTATAAGGTGG + Intergenic
963917317 3:150871033-150871055 CCTAGTTTCCCTTTAGAAGAAGG + Exonic
963947038 3:151157081-151157103 TTCTAGTTCCATTTAGAAGAGGG + Intronic
964006869 3:151840719-151840741 CTCAAGTTCCTGTTATAAAATGG + Intergenic
964006872 3:151840775-151840797 CTCAAGTTCCTGTTATAAAATGG + Intergenic
964052765 3:152417003-152417025 CTCAGGATACCTTTAGCAGAAGG - Intronic
964505352 3:157392935-157392957 CTCAGGCTCCTTTTAAACTAGGG + Intronic
965115782 3:164485977-164485999 GTCAGCTTCCATTTAAAAGATGG + Intergenic
965330897 3:167373277-167373299 CTCAGGTTCCTTATATAAAATGG - Intronic
965691271 3:171359313-171359335 CTCAGTCTCCTTTAAGGAGAAGG - Intronic
966090822 3:176133433-176133455 ATTTAGTTCCTTTTAGAAGATGG + Intergenic
966851410 3:184167191-184167213 CTCAGTTTCCTCTTACAAAATGG + Intronic
966980047 3:185124175-185124197 CTCAAGTTCCTTATATAAAAGGG - Intronic
967476794 3:189930819-189930841 CTCAAGTTCCTTATATAAAATGG + Intergenic
971111799 4:23593286-23593308 CTCATGTTCCTTATATAAAATGG - Intergenic
972887876 4:43515100-43515122 CTCAAGTTCCTTATATAAGATGG - Intergenic
973628831 4:52799475-52799497 CTCAAGTTCCTTATATAAAATGG - Intergenic
974113482 4:57552524-57552546 CTCAGGTCCCTTGTAAAAAATGG - Intergenic
974124473 4:57678875-57678897 CTGAGGTTCCATTTAAATGAGGG - Intergenic
974519769 4:62968209-62968231 CTCAGGTGACTTCTAGAAGCTGG - Intergenic
975620499 4:76291488-76291510 TTCAGGTGCCTCTTAGAATATGG + Intronic
976438923 4:85051051-85051073 CTCAAGTTCCTTTTTGGAGCAGG + Intergenic
977645477 4:99406985-99407007 CTCCGTTTTCTTTAAGAAGAAGG - Intergenic
977908453 4:102502311-102502333 GCCAGGTTTCTTTTAGAAGTAGG - Intronic
978399165 4:108312857-108312879 CTGATTTTCCTGTTAGAAGATGG - Intergenic
978491803 4:109317905-109317927 CTCAGGTTCCTCTGGGAGGAAGG - Intergenic
978679333 4:111359865-111359887 CTCAGGAACATTTTAGAGGAAGG + Intergenic
979832336 4:125317292-125317314 CTCAGGGTCCATTTGGAAGGGGG - Exonic
979836432 4:125374233-125374255 CTCAGTTTCCTTTTACAACGAGG - Intronic
979952856 4:126916274-126916296 CCCAGGTGCCTTTAAGAAAAAGG - Intergenic
980339449 4:131524526-131524548 CTCAAGTACCTTTTATAAAATGG - Intergenic
981971398 4:150666652-150666674 CTCAAGTTCCTTGTATAAAATGG - Intronic
982089342 4:151866961-151866983 CTGGTGTTCCTTTAAGAAGAGGG - Intergenic
982149056 4:152431881-152431903 CTCACAATCATTTTAGAAGAGGG - Intronic
983090806 4:163499589-163499611 CTCAGGTCCCTTATATAAAATGG + Intronic
983773619 4:171579217-171579239 CTGAGATTCCTTATAGAACAGGG - Intergenic
983993648 4:174154311-174154333 CTCAAATTCCTTTTTGAATAAGG + Intergenic
986100775 5:4608888-4608910 CTTAAGTTCCTTTTAGATGCTGG - Intergenic
986170271 5:5309162-5309184 CACAAGTTCCTGATAGAAGATGG + Intronic
986362057 5:6988320-6988342 CTGAGGTTTCTTGGAGAAGAAGG + Intergenic
986398796 5:7358852-7358874 CTCAAGTTCCTTATATAAAATGG - Intergenic
986575975 5:9213480-9213502 CTTGGGTTCCATTAAGAAGATGG + Intronic
988921023 5:35942772-35942794 TTCAGATTCCTTTAAAAAGATGG - Intergenic
989179340 5:38560920-38560942 CTTAAGTCCCTTTTGGAAGAAGG - Intronic
992075404 5:73188299-73188321 CTGATGTTCATTTTAGCAGATGG + Intergenic
992578226 5:78142308-78142330 CTCAAATTCCTTTTGGAATAGGG - Intronic
993593260 5:89822510-89822532 TTCATGTTTATTTTAGAAGACGG - Intergenic
995752570 5:115469767-115469789 CTCAAGTTGCTGTTAGCAGAGGG + Intergenic
995860758 5:116637928-116637950 CACAGGTGCCTTTAAGGAGATGG - Intergenic
996851683 5:127959999-127960021 CTCTGGTTCCTTGCAGAACAAGG + Intergenic
997148577 5:131466242-131466264 CTCTGGTTCCTTCTGTAAGAAGG + Intronic
1000478873 5:161745869-161745891 CTGAGGGTCCTTTTAGATAATGG + Intergenic
1000491495 5:161920074-161920096 CCCAGGTGGTTTTTAGAAGAAGG + Intergenic
1001396952 5:171424557-171424579 TTCAGGATTCTTTGAGAAGAAGG - Intronic
1003187258 6:3842674-3842696 CACAGGCACCTTTTAGGAGAAGG - Intergenic
1003224967 6:4195372-4195394 CTCAGGTTCCTGATATAAAATGG - Intergenic
1003379496 6:5610572-5610594 CTCAGGTCCCTTATATAAAATGG - Intronic
1003923751 6:10857486-10857508 CTGAGGTTCCTCAGAGAAGAAGG + Intronic
1003947990 6:11093018-11093040 CTCTGATTCCTTCTAAAAGAGGG + Intergenic
1003964980 6:11244098-11244120 CTGAGGTTCCCTGAAGAAGAGGG + Intronic
1004495371 6:16157924-16157946 ATCAGCTTCCTTGAAGAAGAAGG + Intergenic
1004632111 6:17432038-17432060 CTCCGGGTCCTTTCAGATGAAGG - Intronic
1004646597 6:17568128-17568150 CTCAGGTTCCTTAAAGAAAATGG - Intergenic
1005140820 6:22629608-22629630 CTGAGGTTCCTATTAAAAAAAGG + Intergenic
1005365983 6:25077428-25077450 TCCAGGTTCCTATTAGAAAAAGG + Intergenic
1006884980 6:37373880-37373902 CTCAAATTCTTTTTAAAAGAAGG - Intronic
1007334848 6:41148320-41148342 CTCAAGTCCCTTTTATAAAATGG + Intergenic
1008795874 6:55302397-55302419 CTCAGGTCCCTTATATAAAATGG + Intergenic
1009285760 6:61814902-61814924 CTCAAGTTCCTTATATAAAATGG + Intronic
1009419443 6:63449056-63449078 CTCAAGTTCCTTATATAAAATGG - Intergenic
1009764122 6:68047104-68047126 CTGAAGTTCTTTATAGAAGATGG + Intergenic
1010903312 6:81454465-81454487 CTCAGGTTCAGTGTACAAGAAGG - Intergenic
1014855749 6:126398467-126398489 CACAAGTTCCTTATATAAGATGG + Intergenic
1014916386 6:127154479-127154501 GTCAGGTTAATTTTAGAAGCAGG + Intronic
1015027093 6:128548035-128548057 CTCAAGTCCCTTTTATAAAATGG - Intergenic
1015097931 6:129439099-129439121 CTCAAGTCCCTTTTATAAAATGG + Intronic
1015154100 6:130072360-130072382 CTCAAGTCCCTTTTACAAAATGG - Intronic
1016764265 6:147774430-147774452 CTCAGGTTCCTTATATAAAATGG + Intergenic
1016929699 6:149391951-149391973 CTCTGATTCCTTTTCGAGGAAGG + Intronic
1019432396 7:1005335-1005357 CTCAGTTTTCTTTTGGAAGGGGG - Intronic
1021195340 7:17668049-17668071 CTCTGATTCCCTTTAGAAAAGGG - Intergenic
1021286546 7:18787969-18787991 CTCAGATTCCTCTTTGAAGATGG + Intronic
1023020977 7:36011557-36011579 CTCAGGGTCCTTTTGGAGCAAGG + Intergenic
1023957239 7:44896237-44896259 CTCTGGTTCCTTTTAGAGCATGG - Intergenic
1024052472 7:45636233-45636255 CTCAGGTCCCTTATAAAAAATGG + Intronic
1027405619 7:77856827-77856849 CTCAAGTCCCTTATAGAAGATGG - Intronic
1027465130 7:78505859-78505881 CTAAGGGTTCTTTCAGAAGAAGG + Intronic
1028507077 7:91582579-91582601 CTCAAGTTCCTTATATAAAATGG - Intergenic
1030623476 7:111817765-111817787 CTGGGATTCCTTTTAGAATATGG - Intronic
1030836307 7:114291266-114291288 CTGGGGTTCCTTTTATAAAAAGG + Intronic
1031185327 7:118472646-118472668 CTCAAGTCCCTTTTATAAAATGG - Intergenic
1031750984 7:125573881-125573903 CTCAGGTTTCTTTTATAGCAAGG - Intergenic
1032678822 7:134160283-134160305 CTCAAGTAGCTTTTAGAAAAAGG + Intronic
1033677679 7:143559351-143559373 CTCAAGTTCTTTTTAGAAGCAGG - Intergenic
1033694157 7:143770089-143770111 CTCAAGTTCTTTTTAGAAGCAGG + Intergenic
1034535729 7:151724643-151724665 CACAGGGTCCTTTGAAAAGAGGG - Intronic
1035131094 7:156654368-156654390 CTCAAGTCCCTGATAGAAGATGG - Intronic
1035750389 8:1992056-1992078 CTCAGGGACCTTTCAGAAGAGGG - Intronic
1036037674 8:5037827-5037849 CTCAAGTTCCTTATATAAAATGG + Intergenic
1036438187 8:8755444-8755466 CTCTGGTTCCTTTCAGTGGAGGG + Intergenic
1037414433 8:18634138-18634160 TTTAGGTTCCTTATAGAAGCTGG + Intronic
1037620791 8:20561809-20561831 CTCTGCTCCCCTTTAGAAGAAGG - Intergenic
1038262759 8:26011656-26011678 CTCAGGGTCCTTTTAGTCAATGG - Intronic
1039601430 8:38841633-38841655 GTTAGGTTCATTTTAGAAGATGG + Intronic
1041137556 8:54776490-54776512 CTCAAGTCCCTTATAGAAAATGG - Intergenic
1041595555 8:59646630-59646652 CTCAAGTTCCTTATATAAAATGG + Intergenic
1041780304 8:61571396-61571418 CTCAGGTTCCTGATATAAAATGG + Intronic
1042299275 8:67258923-67258945 CTCAAGTTCCTTATAAAAAATGG + Intronic
1042401499 8:68353895-68353917 CTCAAGTTCCTTATATAAAATGG - Intronic
1043245420 8:77993790-77993812 TTTAGTTTCCTTTTAGAAGTTGG + Intergenic
1044102415 8:88157373-88157395 CTCAAGTCCCTTATATAAGATGG - Intronic
1044200044 8:89423954-89423976 CTCAAGTTCCTTATAGATGCTGG - Intergenic
1046569221 8:115941808-115941830 CCCAGGTTCATTTTGAAAGATGG + Intergenic
1046678835 8:117144147-117144169 CTCAGGTTCCTCTGAGATGATGG + Intronic
1047784737 8:128142733-128142755 CTCAGTTTCCTCTTCAAAGAAGG - Intergenic
1047889236 8:129289298-129289320 CTCAAGTTCCTTATATAAAATGG + Intergenic
1047935976 8:129778730-129778752 CTCAAGTTCCTTATAGATGCTGG - Intronic
1048187146 8:132251717-132251739 CTCAAGTTCTTTCTGGAAGAAGG + Intronic
1048352858 8:133629987-133630009 CTCTGGAACCATTTAGAAGAAGG + Intergenic
1048927177 8:139281516-139281538 CACAGGTACCTTCCAGAAGATGG + Intergenic
1050449180 9:5761749-5761771 CTGAGGTTCCTTTTAAAACAGGG + Intronic
1050870436 9:10561258-10561280 GTCAGGGTCGTTTTATAAGATGG + Intronic
1051162550 9:14224690-14224712 CTCAAGTTCCTTGTATAAAATGG - Intronic
1052893890 9:33729720-33729742 CTGAGGTTCCTTGGAAAAGAGGG + Intergenic
1053227934 9:36377692-36377714 CTCAGGTTCCTGATATAAAATGG + Intronic
1056410072 9:86317045-86317067 CTCAAGTTCCTTATATAAAATGG - Intronic
1057116688 9:92530104-92530126 CTCAAGTTCCTTATATAAAATGG - Intronic
1058404202 9:104653332-104653354 TTCAAGTTCCTTATATAAGATGG + Intergenic
1058965106 9:110030159-110030181 CTCCGTTTCCTCTAAGAAGAAGG - Intronic
1059631436 9:116127758-116127780 CTCAAGTTCCTTATATAAAATGG - Intergenic
1060262252 9:122086532-122086554 CTCAGATTCCTTCTGGAAGAAGG - Intronic
1060333318 9:122696475-122696497 CTCAAGTTCCTTTTATAGAATGG - Intergenic
1186555246 X:10551035-10551057 CTCAGGTCCCTTATATAAAATGG + Intronic
1186925781 X:14331895-14331917 CTCAAGTTCCTTATAGAAAATGG - Intergenic
1188014346 X:25091460-25091482 CTCAAGTTCCTTATAGAAGCTGG + Intergenic
1188147472 X:26630936-26630958 CTCAAGTTCCTTATATAAAATGG - Intergenic
1188394425 X:29663024-29663046 CTCATGGTCCTTGCAGAAGAAGG - Intronic
1188489807 X:30725388-30725410 CTCAGCTTCATTTTCCAAGATGG + Intronic
1189381685 X:40506810-40506832 CTCAGATTCCTTATGCAAGAGGG - Intergenic
1189595392 X:42559580-42559602 CTCCTGTTCTTTTTTGAAGAAGG - Intergenic
1190934351 X:54982644-54982666 CTCAAGTCCCTTTTATAAAATGG - Intronic
1192383060 X:70637025-70637047 CTTAGGTTCCTTGTAGATGCTGG - Intronic
1193500345 X:82266587-82266609 CTCACGTTGGTTTTAGATGAGGG + Intergenic
1193553757 X:82929790-82929812 CTCAGCTTCGTCTTAGAGGAAGG - Intergenic
1194126722 X:90027319-90027341 CTCAGGTTTGTTTTAGAAATGGG + Intergenic
1194731975 X:97465561-97465583 CTCAAGTTCCTTATATAAGATGG - Intronic
1195612236 X:106880966-106880988 CTCTGGTCCCTGTTGGAAGAGGG + Intronic
1196052214 X:111317682-111317704 CTTAAGTTCCTTATAGATGATGG - Intronic
1196100195 X:111839626-111839648 CTCAAGTTCCTTATATAAAATGG + Intronic
1196490650 X:116261967-116261989 CTTAGGGTCCTTTTAGAATCAGG + Intergenic
1200845386 Y:7827279-7827301 CTCAGGGTTCCTTTAGAAGCAGG + Intergenic