ID: 956606968

View in Genome Browser
Species Human (GRCh38)
Location 3:71082965-71082987
Sequence GGAGTAACTTGTTGCCACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 62}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956606968_956606975 26 Left 956606968 3:71082965-71082987 CCTGAGTGGCAACAAGTTACTCC 0: 1
1: 0
2: 0
3: 5
4: 62
Right 956606975 3:71083014-71083036 TAAGGGAGCCAACATCATCCGGG 0: 1
1: 0
2: 0
3: 11
4: 175
956606968_956606976 27 Left 956606968 3:71082965-71082987 CCTGAGTGGCAACAAGTTACTCC 0: 1
1: 0
2: 0
3: 5
4: 62
Right 956606976 3:71083015-71083037 AAGGGAGCCAACATCATCCGGGG 0: 1
1: 0
2: 0
3: 3
4: 90
956606968_956606974 25 Left 956606968 3:71082965-71082987 CCTGAGTGGCAACAAGTTACTCC 0: 1
1: 0
2: 0
3: 5
4: 62
Right 956606974 3:71083013-71083035 TTAAGGGAGCCAACATCATCCGG 0: 1
1: 0
2: 2
3: 6
4: 107
956606968_956606973 9 Left 956606968 3:71082965-71082987 CCTGAGTGGCAACAAGTTACTCC 0: 1
1: 0
2: 0
3: 5
4: 62
Right 956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG 0: 1
1: 0
2: 0
3: 6
4: 89
956606968_956606971 0 Left 956606968 3:71082965-71082987 CCTGAGTGGCAACAAGTTACTCC 0: 1
1: 0
2: 0
3: 5
4: 62
Right 956606971 3:71082988-71083010 TTATCTATTCTGGATCTACGTGG 0: 1
1: 0
2: 0
3: 6
4: 76
956606968_956606969 -10 Left 956606968 3:71082965-71082987 CCTGAGTGGCAACAAGTTACTCC 0: 1
1: 0
2: 0
3: 5
4: 62
Right 956606969 3:71082978-71083000 AAGTTACTCCTTATCTATTCTGG 0: 1
1: 0
2: 2
3: 12
4: 159
956606968_956606977 28 Left 956606968 3:71082965-71082987 CCTGAGTGGCAACAAGTTACTCC 0: 1
1: 0
2: 0
3: 5
4: 62
Right 956606977 3:71083016-71083038 AGGGAGCCAACATCATCCGGGGG 0: 1
1: 0
2: 0
3: 16
4: 89
956606968_956606972 8 Left 956606968 3:71082965-71082987 CCTGAGTGGCAACAAGTTACTCC 0: 1
1: 0
2: 0
3: 5
4: 62
Right 956606972 3:71082996-71083018 TCTGGATCTACGTGGTTTTAAGG 0: 1
1: 0
2: 0
3: 4
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956606968 Original CRISPR GGAGTAACTTGTTGCCACTC AGG (reversed) Intronic
902726813 1:18341884-18341906 GGTGTGGTTTGTTGCCACTCTGG - Intronic
908537713 1:65093394-65093416 GGAGTTACTTGTGGCCTCTAAGG - Intergenic
921002066 1:211054254-211054276 GGAGTCTCATTTTGCCACTCAGG - Intronic
924675873 1:246177373-246177395 GGGGTAACTTGGTGCAACTCTGG - Intronic
1067793269 10:49303312-49303334 GGAGTATCATTTTCCCACTCAGG - Intronic
1076439541 10:130471665-130471687 GGAGAGACTTGCTGCCTCTCTGG - Intergenic
1078923260 11:15851053-15851075 GGATTCACTTGGGGCCACTCAGG - Intergenic
1079966422 11:26985667-26985689 GGAGTAAGTTGGTTCCACCCTGG + Intergenic
1084814124 11:71635898-71635920 GGAGGAACATGCTTCCACTCAGG - Intergenic
1092429956 12:8400291-8400313 GGAGGAACATGCTTCCACTCAGG + Intergenic
1097956837 12:65495184-65495206 GGAGAACCTTGTTGGGACTCCGG - Intergenic
1101546337 12:105716897-105716919 GGAGTTCCTTGGTGCCTCTCTGG - Intergenic
1106249641 13:27973698-27973720 GGGCTAACATGTTACCACTCAGG + Intergenic
1114177690 14:20337960-20337982 GGAGTAACTTGTTAGCAGTTTGG - Intergenic
1123989280 15:25671409-25671431 TGAGTAACTTGTTGGAACCCAGG - Intergenic
1125364211 15:38896489-38896511 GGAGGGAATTGTTACCACTCAGG - Intergenic
1130104844 15:80921556-80921578 GGAGTGCCGTGCTGCCACTCTGG - Intronic
1130287438 15:82567662-82567684 GGACTAACCTGTTCACACTCTGG - Intronic
1133366246 16:5212592-5212614 GGAGGAACATGGTTCCACTCAGG - Intergenic
1135235599 16:20752589-20752611 GGAGTAACCTAGTGCCACTGAGG - Intronic
1135789311 16:25379022-25379044 GATGTAAATTGGTGCCACTCTGG - Intergenic
1138296779 16:55892816-55892838 GGAATAACTTGTTCCCTCTGTGG - Intronic
1153761352 18:8335189-8335211 GGAGCCACTTGTTGCCACTTGGG - Intronic
1155331101 18:24717200-24717222 GGAGAAACTTTTTGTCACTTAGG - Intergenic
1156527419 18:37779502-37779524 AGATTAACTTGTTGTCACTTTGG - Intergenic
1158019192 18:52821237-52821259 GAAGTAACGTGGTGCCACTCAGG - Intronic
927981244 2:27376478-27376500 GGAGTCACCTGATGCCACCCGGG + Exonic
929103916 2:38345099-38345121 GGAGTAACTAGTTGCTACGTGGG - Intronic
944680043 2:202069059-202069081 GGAGTAAATGAATGCCACTCTGG - Intergenic
944680201 2:202070338-202070360 GGAGTAAATGAATGCCACTCTGG - Intergenic
1169022541 20:2340491-2340513 GCAGTTGCTTGGTGCCACTCCGG - Exonic
1173182967 20:40818471-40818493 GTGGTAACTTCTTGCCACTAGGG - Intergenic
1175526226 20:59635955-59635977 GGAGGACCTCGTGGCCACTCTGG - Intronic
1177605442 21:23371599-23371621 AGAGTGATTTGTTGCCCCTCTGG - Intergenic
1184378952 22:44133048-44133070 GGAGGAAGATGTTGCCTCTCTGG - Intronic
1185248425 22:49786027-49786049 GGACTCACTTGCTGCCACTCTGG + Intronic
952039253 3:29241570-29241592 GGAGTAACTTGTTCTCATTTAGG + Intergenic
956606968 3:71082965-71082987 GGAGTAACTTGTTGCCACTCAGG - Intronic
959088716 3:101879285-101879307 GGAGTGTCCTGTTGGCACTCTGG + Intergenic
961873893 3:130006613-130006635 GGAGGAACATGGTTCCACTCAGG + Intergenic
966630075 3:182062805-182062827 AGAGTCACTTGTTCCCACACTGG - Intergenic
978935144 4:114365321-114365343 GAGGTAACTTGTTGCCCCTGTGG - Intergenic
978987963 4:115038952-115038974 GTAGTATCTTGCTGTCACTCAGG - Intronic
987427243 5:17787223-17787245 GAAGTAACTTCTAGCCCCTCAGG + Intergenic
991614912 5:68486103-68486125 GGAGCAACATGGTGCCACCCAGG - Intergenic
995911735 5:117196053-117196075 GGAGTACCTTTTTGCCTCTGGGG + Intergenic
1001341059 5:170845799-170845821 GGAGTATCTCTTTGTCACTCAGG - Intergenic
1007915905 6:45561458-45561480 TGAGTAATTCCTTGCCACTCAGG + Intronic
1008342781 6:50387883-50387905 TGAGTCACATGTTGACACTCTGG - Intergenic
1008526334 6:52411030-52411052 GGAATAACTTGATGTCAGTCTGG - Intergenic
1011829640 6:91355908-91355930 GGAGTAACTCGTTTCCAGTTGGG - Intergenic
1014160176 6:118158465-118158487 TGAGCCACGTGTTGCCACTCTGG + Intronic
1029032186 7:97480206-97480228 GGAGGAACTTTTTGCAACTCAGG - Intergenic
1029075663 7:97931948-97931970 GGAGGAACATGGTTCCACTCAGG + Intergenic
1030189376 7:106795179-106795201 TGAGAAACTGGTTACCACTCAGG - Intergenic
1036241860 8:7088384-7088406 GGAGGAACATGCTTCCACTCAGG - Intergenic
1036728223 8:11239337-11239359 GCACTAACCTGTTGCCTCTCAGG + Intergenic
1036757667 8:11482013-11482035 GGTGTCACTTGGTGCCACTTGGG - Intergenic
1036830870 8:12018700-12018722 GGAGGAACATGCTTCCACTCAGG + Intergenic
1036901006 8:12669138-12669160 GGAGGAACATGCTTCCACTCAGG + Intergenic
1039257878 8:35739075-35739097 GGAGTAAATTGCTGCCATTTAGG + Intronic
1042569754 8:70150374-70150396 ATAGTAATTTGCTGCCACTCTGG - Intronic
1046541263 8:115586838-115586860 TGAGTTACTTGCTGCCACTTTGG + Intronic
1186366806 X:8903883-8903905 GGAGTAACTAGTTGACCCTTTGG + Intergenic
1187900162 X:24020519-24020541 GAAGTAATTTGGTGCCAGTCTGG - Intronic
1191256720 X:58282671-58282693 GGAGTCACTGGTTCCCACCCAGG - Intergenic
1193551480 X:82898025-82898047 GGAGTAACATGTTGGAACTTGGG + Intergenic
1196177704 X:112658397-112658419 GGAGTAACACTTTGTCACTCAGG - Intronic