ID: 956606973

View in Genome Browser
Species Human (GRCh38)
Location 3:71082997-71083019
Sequence CTGGATCTACGTGGTTTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956606966_956606973 26 Left 956606966 3:71082948-71082970 CCATCTTCTAAAAGGAACCTGAG 0: 1
1: 0
2: 0
3: 31
4: 367
Right 956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG 0: 1
1: 0
2: 0
3: 6
4: 89
956606965_956606973 29 Left 956606965 3:71082945-71082967 CCTCCATCTTCTAAAAGGAACCT 0: 1
1: 0
2: 0
3: 17
4: 194
Right 956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG 0: 1
1: 0
2: 0
3: 6
4: 89
956606968_956606973 9 Left 956606968 3:71082965-71082987 CCTGAGTGGCAACAAGTTACTCC 0: 1
1: 0
2: 0
3: 5
4: 62
Right 956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG 0: 1
1: 0
2: 0
3: 6
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956606973 Original CRISPR CTGGATCTACGTGGTTTTAA GGG Intronic
908206428 1:61855057-61855079 CTGGATTTGTGTGGTTTTATAGG + Intronic
912425879 1:109589450-109589472 CTTGAGCAACGTGGGTTTAAAGG + Intronic
917948702 1:180005474-180005496 CTCGATCTAGGTGGTGGTAATGG - Intronic
918306116 1:183248471-183248493 CTGGATCCACATGGTCTTGAGGG - Exonic
919616007 1:199809872-199809894 CTGGGACTACCTGCTTTTAATGG + Intergenic
1064692272 10:17930464-17930486 CTGGAGCTAAGTGGCTATAATGG + Intergenic
1069182304 10:65376788-65376810 CTGCATCTACTTGTTTTTCAGGG + Intergenic
1071995044 10:91139454-91139476 CATGATCTTGGTGGTTTTAATGG - Intergenic
1072883719 10:99254253-99254275 CTGCATCTATGTTGTTTCAATGG - Intergenic
1073597518 10:104815878-104815900 CTGGAACTACATGGTCTTATGGG - Intronic
1074973243 10:118560117-118560139 CTGGGCCTACTTGGTTTTACAGG + Intergenic
1075536693 10:123277545-123277567 CTGGTTCTGCGGGGTTTTATTGG + Intergenic
1079564202 11:21861226-21861248 CTGGATTTTGGAGGTTTTAAAGG + Intergenic
1080423239 11:32132065-32132087 CTGCATCCATGTGGCTTTAAAGG - Intergenic
1093092092 12:14933461-14933483 CTGGATAAATGTAGTTTTAATGG + Intronic
1094299823 12:28950596-28950618 CTGGAGCTACATGGTGATAATGG - Intergenic
1094501555 12:31025735-31025757 ATGTATTTACGTGGTTTCAAAGG - Intergenic
1096044057 12:48546302-48546324 CTGGATCTCAGTCTTTTTAATGG - Intergenic
1104085175 12:125467723-125467745 CTGGATATAGGTGTTTTTACAGG - Intronic
1104888302 12:132125000-132125022 CAGGAGCCACGTGGTTCTAATGG - Intronic
1108317471 13:49250890-49250912 CTGGCTCTACATGTTATTAACGG + Intronic
1110689976 13:78421604-78421626 CTGGATATATGTGGTTATATAGG - Intergenic
1112566944 13:100560025-100560047 CTGGATCTACCCGGATCTAATGG - Intronic
1118709693 14:68509128-68509150 CTGGATAAAGGTGGTTTTCAAGG + Intronic
1119913064 14:78368803-78368825 ATGGATTTATGAGGTTTTAAGGG + Intronic
1120502621 14:85315722-85315744 CTGGATCTCCATGGTTTGAATGG - Intergenic
1124040684 15:26100106-26100128 CTGGATTTATGTGTTTTTAATGG + Intergenic
1124365276 15:29066793-29066815 CTGGCTCAACTTGGTTTTAGAGG - Intronic
1130474771 15:84254856-84254878 CTGGTTTTCCGTGGTTTTCATGG + Intergenic
1130482187 15:84368912-84368934 CTGGTTTTCCGTGGTTTTCATGG + Intergenic
1130749525 15:86695764-86695786 CTGTATCTCAGAGGTTTTAATGG + Intronic
1132326687 15:100976200-100976222 CTAGGTCTACATGGTTTTACTGG + Intronic
1138765716 16:59600767-59600789 CTTGAGCTAGGTGATTTTAAAGG - Intergenic
1138942909 16:61811715-61811737 CAGGATCTCCTTGTTTTTAAAGG - Intronic
1139263773 16:65621103-65621125 CTGCATGTATGTGATTTTAAAGG - Intergenic
1141730966 16:85822599-85822621 CTGGAAATACCCGGTTTTAAAGG + Intergenic
1147555642 17:41477293-41477315 CAGGATCAAGGTGGTTTTTAGGG - Intronic
1153883873 18:9445984-9446006 TTGGATCCACGTGGTGTCAACGG - Intergenic
1154040651 18:10852410-10852432 CTGAATTTAAGTGGTCTTAAAGG + Intronic
1158751812 18:60270868-60270890 CTGGATATGCTTGGTTTTGAAGG + Intergenic
1162709864 19:12584792-12584814 CTGGATTTGCATGGTTCTAATGG - Intronic
1163456128 19:17406643-17406665 CTGGCTCTAAGTGGCTTTAATGG - Intronic
1165766564 19:38355033-38355055 CATGATGTACTTGGTTTTAAAGG + Intronic
1168011025 19:53532410-53532432 CTGGATTTTCCTGGTTTTTAAGG + Intronic
927624002 2:24693400-24693422 CTGGATATAATTAGTTTTAAGGG - Intronic
928077933 2:28282170-28282192 TTATATCTACGGGGTTTTAATGG - Intronic
933433247 2:82212340-82212362 ATGGATTTACATGGTTTTGAGGG + Intergenic
937014382 2:118590322-118590344 CAGGATCTACCTGATTTAAAAGG + Intergenic
939191020 2:138916906-138916928 CTGGTAATACGTGGTATTAAAGG + Intergenic
941227517 2:162867541-162867563 CTGGATCTGTCTGGTTTTATAGG + Intergenic
944031512 2:195240272-195240294 CTGGATTTAGGTAGTTCTAAAGG - Intergenic
944140072 2:196446504-196446526 CTGGACCTACATGGTTTTCTTGG + Intronic
944696294 2:202203109-202203131 CTGGATTTACGTGGTTCTGAAGG - Intergenic
1170179106 20:13509170-13509192 CAGGATTTTCTTGGTTTTAAAGG - Intronic
1184164265 22:42718563-42718585 CTGGAAAAACGTGTTTTTAAAGG + Intronic
949240113 3:1861013-1861035 TTGCATCAACGTGGTATTAATGG - Intergenic
949893679 3:8753147-8753169 CTGGATCTACATGCTGTTCACGG - Exonic
953421323 3:42755701-42755723 CTGGATTTAAGTGGTTTTCAGGG + Intronic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
966685253 3:182686486-182686508 CAGGATCTACTTGTTTTTGAGGG - Intergenic
970993214 4:22236643-22236665 CTGGCTTCACCTGGTTTTAATGG + Intergenic
971748925 4:30621295-30621317 CTGGAGCTAGGTGGCTTTGAGGG - Intergenic
973007330 4:45029324-45029346 TTGGATCTAGGTGGTATTGATGG + Intergenic
974646417 4:64699123-64699145 CTGGATCTACCAGGATTTTACGG - Intergenic
978916780 4:114135326-114135348 CAGGACCCAGGTGGTTTTAATGG + Intergenic
988623418 5:32846531-32846553 CTGAATTTACCTGGGTTTAAGGG - Intergenic
990762843 5:59149636-59149658 CTGGTTCTCCGTGGTTATATGGG + Intronic
996025461 5:118640292-118640314 ATGTATTTGCGTGGTTTTAAAGG - Intergenic
997193105 5:131958283-131958305 CTGGGCCTACGTGGATTTGAAGG - Intronic
997212123 5:132083036-132083058 CTGCATCTGCCTGGTCTTAATGG - Intergenic
998116718 5:139543441-139543463 CAGGATCTACGTGGGTATAGAGG - Intronic
1004560084 6:16741299-16741321 CTGGATAACTGTGGTTTTAAAGG + Intronic
1006199190 6:32271342-32271364 ATGTATTTGCGTGGTTTTAAAGG - Intergenic
1007837940 6:44690370-44690392 CTGAATCTCTGTGCTTTTAATGG + Intergenic
1008326146 6:50184533-50184555 CTGGAACTACATGGTTGGAATGG - Intergenic
1008430894 6:51415432-51415454 CTGTAACTAGGTGGTCTTAATGG - Intergenic
1015739740 6:136441304-136441326 TTGCATATAAGTGGTTTTAATGG - Intronic
1017050897 6:150392376-150392398 CTGGACCTTCGTGGTTGTGAAGG + Exonic
1017258543 6:152361946-152361968 ATGGATCTACATGGTTTTCCTGG + Intronic
1020455624 7:8371120-8371142 ATGTATTTACGTGGTTTTGAGGG + Intergenic
1026674598 7:72418266-72418288 CTGCATCTATGTTGTTGTAAAGG + Intronic
1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG + Intronic
1044892626 8:96853635-96853657 CTGAATTTACGTGTTTTGAAAGG + Intronic
1044903562 8:96974712-96974734 ATGTATTTACATGGTTTTAAGGG - Intronic
1047684864 8:127294766-127294788 CTTCATCTACGTGGTTCCAATGG + Intergenic
1050599364 9:7234991-7235013 CTGGAGATACCTGGTTTTTAAGG - Intergenic
1054873660 9:70073239-70073261 CTGAAAATACGTGGTTTAAAAGG + Intronic
1055275789 9:74613877-74613899 CTGCATTTACGTTGCTTTAAAGG + Intronic
1059383996 9:113950007-113950029 CAGGATCTACGGGGGTTTAATGG - Intronic
1191727145 X:64293363-64293385 CTGGCTCTACGTGGTTTGCTTGG - Intronic
1191878549 X:65821923-65821945 CTGGAGATACATGGTTTAAATGG + Intergenic
1193611512 X:83636923-83636945 CACAATGTACGTGGTTTTAATGG - Intergenic
1194284596 X:91994474-91994496 CAGGATCTCCTTGTTTTTAAGGG + Intronic
1200602162 Y:5219038-5219060 CAGGATCTCCTTGTTTTTAAGGG + Intronic
1202376214 Y:24240024-24240046 CTGGTTTTCCGTGGTTTTCATGG - Intergenic
1202494566 Y:25430094-25430116 CTGGTTTTCCGTGGTTTTCATGG + Intergenic