ID: 956608670

View in Genome Browser
Species Human (GRCh38)
Location 3:71099628-71099650
Sequence TCTTATCTAGAGAATGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956608670_956608673 24 Left 956608670 3:71099628-71099650 CCAGCCACATTCTCTAGATAAGA 0: 1
1: 0
2: 2
3: 16
4: 146
Right 956608673 3:71099675-71099697 CTACTTTTCCAAGGTCACACAGG 0: 1
1: 0
2: 14
3: 72
4: 526
956608670_956608672 15 Left 956608670 3:71099628-71099650 CCAGCCACATTCTCTAGATAAGA 0: 1
1: 0
2: 2
3: 16
4: 146
Right 956608672 3:71099666-71099688 GAAGTTAAGCTACTTTTCCAAGG 0: 1
1: 0
2: 30
3: 198
4: 1208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956608670 Original CRISPR TCTTATCTAGAGAATGTGGC TGG (reversed) Intronic
906441310 1:45848086-45848108 TCTTATCTATAGAATGTATAGGG + Intronic
908204401 1:61830788-61830810 TCTTATTTGGAAAATGTTGCTGG + Intronic
909891126 1:81007952-81007974 TCTTATCTAGAAGTTGTTGCAGG - Intergenic
912331418 1:108823388-108823410 TTTCATCTAAAGAATGGGGCTGG + Exonic
913196783 1:116463487-116463509 TCTGATTTAGAGAATGTGCGGGG + Intergenic
915198084 1:154205358-154205380 TTTTCTCCAGAGAATGAGGCAGG + Intronic
915799303 1:158772015-158772037 TCTTACCTAGAGATTGTTGGTGG + Intergenic
917439390 1:175053690-175053712 TCTCATCTAGAGAAGCTGGCTGG - Intergenic
919844302 1:201631564-201631586 ACTTATCTAGAGAATTTGTTGGG + Intronic
921647209 1:217632794-217632816 ATTTATTTAGAGTATGTGGCAGG + Intronic
922230794 1:223683907-223683929 TCTCACCTGTAGAATGTGGCTGG - Intergenic
922627522 1:227064591-227064613 TATTACCTAGAGAAAGAGGCTGG + Intronic
923374707 1:233349568-233349590 ACTTCTCTAGAGAATGTGTGGGG - Intronic
923380221 1:233410204-233410226 TCTTAACTAGGGAATTAGGCTGG + Intergenic
1065891175 10:30122615-30122637 TTTTATCTAGAGAGAGAGGCAGG - Intergenic
1066518914 10:36194577-36194599 CCTATTCTAGAGAATTTGGCAGG + Intergenic
1067712306 10:48658838-48658860 TCTGATCCAGAGGCTGTGGCCGG + Intergenic
1069902975 10:71716411-71716433 ACTTACCTAGGGAATGTGGATGG + Intronic
1071985471 10:91045974-91045996 TCTAATGTAGAGAATATGGCAGG - Intergenic
1072142413 10:92600794-92600816 TTTTATATAGAAAATCTGGCCGG - Intronic
1073274729 10:102300340-102300362 TCTAATCCAGAGACTATGGCTGG - Intronic
1074761848 10:116672752-116672774 TCTTATTTGTAGAATATGGCTGG + Exonic
1077874263 11:6290452-6290474 TCTTCTCTAGAGTGTGTGCCTGG + Intergenic
1080662336 11:34307333-34307355 TCTCGTTGAGAGAATGTGGCTGG - Intronic
1084728214 11:71055861-71055883 TCTTAGCTAGACAATGGGGATGG + Intronic
1084855399 11:71981891-71981913 GCTTATCTAGAGTATGCGGCTGG - Intronic
1085483839 11:76845154-76845176 TCTTATCTATAAAATGAGGATGG + Intergenic
1086840726 11:91681014-91681036 TCTCATCTACAGAATGGGGGTGG - Intergenic
1087016084 11:93555749-93555771 ACTTGTGTAGGGAATGTGGCAGG - Intergenic
1087297678 11:96396697-96396719 CCTTCTCTAGAGGAAGTGGCTGG - Intronic
1087301634 11:96443009-96443031 TCTTATCCAGAGGATGAGGATGG + Intronic
1088295731 11:108291862-108291884 TCTTATCTTGAGCATGTGTGTGG + Intronic
1089058492 11:115607095-115607117 TCTGAGCTAGAGAACTTGGCAGG + Intergenic
1090429734 11:126635716-126635738 CCTTATCTGTAAAATGTGGCTGG + Intronic
1093647887 12:21609877-21609899 TCTAGACTAGAGAAGGTGGCTGG + Intergenic
1094038867 12:26102045-26102067 CCTTATCTATAGAATGGGGATGG - Intergenic
1095827628 12:46546772-46546794 TCTTATCTGGAGGAATTGGCAGG + Intergenic
1097472094 12:60006999-60007021 TTTTATCTTGAGAATTTCGCTGG - Intergenic
1103430023 12:120875831-120875853 TCTTATACATAGCATGTGGCCGG - Intronic
1106784441 13:33092862-33092884 ACTTATCTATAGGGTGTGGCTGG - Intergenic
1112798418 13:103083310-103083332 TCTTTTCTACCTAATGTGGCTGG + Intergenic
1112956288 13:105062865-105062887 TCTTTTCTATAGAATGTTGTAGG + Intergenic
1114539897 14:23447195-23447217 TCTTATCTGTAAAATGTGGATGG + Intergenic
1115071093 14:29322331-29322353 TCTTTTGTAGAAAATTTGGCAGG - Intergenic
1115165203 14:30440387-30440409 TCGTATCAAGAGAATGCTGCTGG + Intergenic
1118327972 14:64794295-64794317 TGCTCTCTAGAGAATTTGGCTGG + Intronic
1120719441 14:87874459-87874481 TCTTATCTACAAAATGGGGGTGG + Intronic
1122387357 14:101358227-101358249 TCTGATCAACAGAATGAGGCTGG - Intergenic
1122614667 14:103008924-103008946 TGTTCTTTAAAGAATGTGGCTGG - Intronic
1123434505 15:20245188-20245210 TCTTTTCTAAAGAATCTGCCTGG + Intergenic
1126056323 15:44733255-44733277 TCTTATCAAGAGAAAGTGGCTGG - Intronic
1128441905 15:67717896-67717918 TGTGATCAACAGAATGTGGCAGG - Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1131959120 15:97769892-97769914 TTTTATTTAAAAAATGTGGCCGG + Intergenic
1132393210 15:101453801-101453823 TCTCATCTAGAGAATTTGCCAGG + Intronic
1132949452 16:2552685-2552707 TGTTCTCAACAGAATGTGGCTGG - Intronic
1132964896 16:2647481-2647503 TGTTCTCAACAGAATGTGGCTGG + Intergenic
1135038308 16:19096911-19096933 TCTGATCTGGAAAAGGTGGCTGG - Intergenic
1135844212 16:25903778-25903800 TATTGTTTAGAGAATGTGGGAGG - Intronic
1135941914 16:26829255-26829277 TTTAATTTAGATAATGTGGCCGG + Intergenic
1137584579 16:49656855-49656877 TCTCATCTATAAAATGGGGCTGG - Intronic
1140432671 16:74917949-74917971 TCAGACCTTGAGAATGTGGCGGG - Exonic
1144283572 17:13750730-13750752 TCTTTTCTAGACCCTGTGGCAGG - Intergenic
1146799695 17:35808887-35808909 TCTGACCCTGAGAATGTGGCGGG - Intronic
1146994819 17:37310495-37310517 TTATATATAGAAAATGTGGCTGG + Intronic
1149447512 17:56725041-56725063 TCATGTCTAGAGAAAGTGGGAGG - Intergenic
1151038682 17:70831996-70832018 TCTTATTAAAAGGATGTGGCTGG - Intergenic
1152086602 17:78223399-78223421 TCTTATCTACAGGATGTGACTGG + Intronic
1154222473 18:12468692-12468714 TTTTATCTAGAAAATGTGGTTGG + Intronic
1157380256 18:47208073-47208095 TCTTATCTATAAAATGTGGATGG - Intergenic
1157831359 18:50859711-50859733 TCTTATGGAGACAATGTAGCAGG - Intergenic
1159064540 18:63555362-63555384 TCTTCTCCACAGATTGTGGCTGG - Intergenic
1163195087 19:15713254-15713276 AGTTATTTAGAGAATGTGGAAGG + Intergenic
1167722543 19:51188184-51188206 TCTGATCTAGACAATGGGGGTGG - Intergenic
925797105 2:7557690-7557712 TCTTAGCTAGAGAAGGTGTTGGG + Intergenic
926075545 2:9940020-9940042 TTTTATCTTGAGTATGTAGCTGG + Intergenic
926297538 2:11579561-11579583 TCTCATCTAGAAAATGGGGGTGG - Intronic
928654894 2:33440325-33440347 TCTCAACTACAAAATGTGGCTGG - Intronic
929810489 2:45185349-45185371 TCTTCTCTGGTGAATGTGCCAGG - Intergenic
934523107 2:95032316-95032338 CCTTCTCTGGAGAATGTGTCTGG - Intronic
937077602 2:119118225-119118247 TCTTATCTAGGGGAGGGGGCAGG - Intergenic
937881917 2:126874615-126874637 TCCTATTTATAGAATGTGTCTGG - Intergenic
943600521 2:189914794-189914816 TCTCATCTATAAAATGGGGCAGG - Intronic
945428569 2:209737439-209737461 TCTTATTTAGTGATTGTGCCAGG + Intergenic
945430034 2:209753447-209753469 TCCTCTCTATAAAATGTGGCAGG - Intergenic
945763172 2:213940539-213940561 TCTACTCTAGAGAATAAGGCAGG - Intronic
946890152 2:224267139-224267161 TATTTCCTAGAAAATGTGGCAGG - Intergenic
1172080167 20:32334193-32334215 TCTGATCTGGAGAATGTATCTGG + Exonic
1177716385 21:24844612-24844634 TATAAATTAGAGAATGTGGCTGG + Intergenic
1178184370 21:30202857-30202879 TCTTTTATAGCAAATGTGGCAGG - Intergenic
1179014522 21:37584282-37584304 GCTTATCTTGGGAGTGTGGCAGG - Intergenic
1179979014 21:44886890-44886912 TCTTCCCTAGAGTGTGTGGCAGG - Exonic
1181559415 22:23691577-23691599 TCATATCTACAGAATGTTACAGG + Exonic
1184088121 22:42278035-42278057 TAATTTCTAGAGAATGTGGAAGG - Intronic
1184341445 22:43888213-43888235 CCTTATCTAGAAAATGGGGCTGG + Intronic
952638317 3:35558097-35558119 TCTTATCTAGAGATTCTGGGTGG - Intergenic
953188192 3:40657825-40657847 TCTTATCAATAGAATATGACAGG + Intergenic
953761982 3:45695555-45695577 TCTTACGTAAAGAATTTGGCTGG - Intronic
955785143 3:62529691-62529713 TGCTTTCTAGAGAATGTGGCAGG - Intronic
955870215 3:63430645-63430667 TATTATATAGACAATGTGGAAGG + Intronic
956205897 3:66754402-66754424 TTTGATCAAGAGAATGAGGCAGG + Intergenic
956608670 3:71099628-71099650 TCTTATCTAGAGAATGTGGCTGG - Intronic
957291009 3:78278160-78278182 AGTTATCTTGACAATGTGGCAGG - Intergenic
959429086 3:106229921-106229943 TCTTATCTAAAGAATGAGAATGG - Intergenic
961546428 3:127637118-127637140 TCATAACTAGAGGATGGGGCTGG - Intronic
964002514 3:151792942-151792964 CCTTATCTAGAAAAAGTGGCGGG - Intergenic
966901262 3:184487631-184487653 TCTAATATACAGAATCTGGCCGG - Intronic
968613790 4:1568486-1568508 TCTCAGCTGGAGAATGGGGCAGG + Intergenic
970851559 4:20609728-20609750 ACATATTGAGAGAATGTGGCTGG + Intronic
973668846 4:53192664-53192686 TCTTATCTACAAAATGGGGATGG + Intronic
977889073 4:102286574-102286596 TCTTATCCATACACTGTGGCAGG - Intronic
979585432 4:122409875-122409897 TCTTTAGTAGAGAATGTTGCTGG + Intronic
984246667 4:177283205-177283227 TCTTATCTTGAGAAGGATGCTGG - Intergenic
984676348 4:182552267-182552289 TCTTTTGTAGAGATGGTGGCGGG - Intronic
985781622 5:1874666-1874688 TCTTAACTAGAGAGAGAGGCAGG - Intergenic
992092544 5:73330782-73330804 TCTTATAGACAGAATGTAGCTGG + Intergenic
996874610 5:128227071-128227093 TGTAATCAAGAGTATGTGGCAGG + Intergenic
1000828485 5:166074976-166074998 TATCATCAAGAGAATGTGGCTGG - Intergenic
1001121932 5:168987987-168988009 TCTCTTCTAGGGAATGTGGCTGG + Intronic
1001464858 5:171954759-171954781 TTTTTTCTACAGAATTTGGCAGG + Intronic
1001684331 5:173582220-173582242 TCTTATCTTGTGACTGTGGGAGG + Intergenic
1002194325 5:177494055-177494077 TCTTATCTAGCGAGTGAGGAAGG - Intronic
1003373791 6:5554925-5554947 TCTAATCTAGAGTATGAGGCAGG + Intronic
1010011827 6:71056568-71056590 TCATCTGTAGAGAATGTGACTGG - Intergenic
1010329327 6:74604311-74604333 TCTTATCTGGAAAATGTGTGTGG + Intergenic
1014567737 6:122971308-122971330 TCTTGTTTAGAGAATATAGCAGG - Intergenic
1019373286 7:674858-674880 TCTTATCCAGAGCATGTGGCTGG - Intronic
1021441644 7:20684327-20684349 TCTTTTCTTGAGAAGGTCGCTGG - Intronic
1021448806 7:20761958-20761980 TCTTCTCTAGAGACTGTAGAAGG - Intronic
1023759790 7:43454232-43454254 TCTGAACTAGAGACTGTGCCAGG - Intronic
1024115700 7:46191124-46191146 TCTTCTCTTGAGAATTTGGTTGG - Intergenic
1024755871 7:52530297-52530319 TCCTGTCTGGAGAGTGTGGCTGG + Intergenic
1026893565 7:73997254-73997276 TCTTCTCTTGCGACTGTGGCTGG - Intergenic
1027245914 7:76367285-76367307 TCTTCTCTAGAGAACATGGCAGG - Intergenic
1029591596 7:101510683-101510705 TTTTTTGTAGAGAATGAGGCTGG + Intronic
1031003076 7:116439919-116439941 TCATATCTAGACATTTTGGCTGG + Intronic
1032543904 7:132726428-132726450 CATTATTTAGAGAATGAGGCTGG + Intronic
1032715399 7:134505017-134505039 TCTTTTCTATACAATGTTGCTGG + Intergenic
1035171273 7:157018605-157018627 TCTCATTTACAGAATGTCGCAGG - Intergenic
1036668460 8:10764020-10764042 TTTGATATAGAGATTGTGGCTGG - Intronic
1036984736 8:13515945-13515967 TCCTCTTTAGAGAATGTGGAAGG + Intergenic
1036987134 8:13546536-13546558 TCTTATTTACAGAATATGACTGG + Intergenic
1037510102 8:19574030-19574052 GCTTATCTGGAGGCTGTGGCGGG - Intronic
1038015741 8:23513084-23513106 TCTTACATTTAGAATGTGGCAGG + Intergenic
1038337969 8:26660771-26660793 TCTTATCTATAAAACTTGGCCGG - Intergenic
1038669768 8:29573371-29573393 TCTTATCTACAGATTGTGTAAGG + Intergenic
1038985108 8:32800666-32800688 TCTCATCTAGAAAATGGGGGGGG - Intergenic
1039563082 8:38528706-38528728 CCTTATCTAGCGAAAGGGGCTGG - Intergenic
1042375086 8:68040712-68040734 TCTAATCTAGTAAAGGTGGCAGG - Intronic
1043746046 8:83874751-83874773 TTATATTTAGAAAATGTGGCTGG - Intergenic
1043888379 8:85628939-85628961 TCTAATCTAGAGAATGTTCAAGG - Intergenic
1043946199 8:86255617-86255639 CTTTAACTCGAGAATGTGGCAGG + Intronic
1045058897 8:98394257-98394279 TCTTATGGAGACAATGTGGTTGG + Intergenic
1045387482 8:101685850-101685872 TCTGATCCTGAGAAGGTGGCTGG - Intergenic
1046754884 8:117962812-117962834 TCTAATCTAGAGGCTGAGGCAGG + Intronic
1048683367 8:136872579-136872601 TTTTATTTAGATAATGTTGCAGG + Intergenic
1055848597 9:80597278-80597300 TTTTATCTATAAAATGTAGCTGG - Intergenic
1056770027 9:89471484-89471506 TGTTATCTGGAGAGTGTGGTGGG - Intronic
1056879804 9:90380307-90380329 ATTTATCTACAGAATGTGGCAGG + Intergenic
1058730406 9:107844579-107844601 TATTAATTAGAGAATGAGGCAGG + Intergenic
1059486130 9:114628269-114628291 TCTTCTGGAGAGAGTGTGGCAGG - Intronic
1060239734 9:121892723-121892745 TCTTCCATGGAGAATGTGGCGGG - Intronic
1060470798 9:123946630-123946652 TCTTATCTCAAGAATGAGCCGGG + Intergenic
1060957945 9:127657578-127657600 TATTGTATAGAGAATGTGGTTGG + Intronic
1195245262 X:102989670-102989692 TCTTATCTAGAGTCTTTGACAGG + Intergenic