ID: 956609144

View in Genome Browser
Species Human (GRCh38)
Location 3:71104392-71104414
Sequence CAGCAACAGCAGCAGAAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 694
Summary {0: 1, 1: 0, 2: 8, 3: 97, 4: 588}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956609144_956609147 17 Left 956609144 3:71104392-71104414 CCGCCCTTCTGCTGCTGTTGCTG 0: 1
1: 0
2: 8
3: 97
4: 588
Right 956609147 3:71104432-71104454 GTTAAGAAGAATCACTTCTTAGG 0: 1
1: 0
2: 1
3: 17
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956609144 Original CRISPR CAGCAACAGCAGCAGAAGGG CGG (reversed) Intronic
900237557 1:1599986-1600008 CAGCAGCAGCAGCAGCGGCGGGG + Exonic
900666085 1:3816479-3816501 CAGCAAGAGCCGCAGAAGAACGG + Intronic
900696627 1:4016164-4016186 GAGCAACCGCAGCAGAAGAATGG + Intergenic
900870166 1:5296691-5296713 CAGCACCGGCAGCAAATGGGTGG + Intergenic
901265084 1:7903792-7903814 TAGCAATAGCAAGAGAAGGGAGG + Intergenic
901604721 1:10450175-10450197 AAGGAAGAGCAGCAGCAGGGTGG + Exonic
901604731 1:10450237-10450259 GAGCAGCAGCAGCAGGAGGCCGG - Exonic
901850469 1:12011732-12011754 CAGCAACAGCAGGCAAAGGTGGG - Exonic
902597024 1:17516526-17516548 CAGCAGCAGCAGCAGAGGTCAGG - Intergenic
902729989 1:18362934-18362956 CAGAAACAGAGGCAGAAGTGGGG - Intronic
903296484 1:22346589-22346611 CAGCTGCAGCAGCAGAAGCTGGG - Intergenic
903349849 1:22711005-22711027 CAGCGGCAGCAGCAGCAGCGCGG - Exonic
903413811 1:23168224-23168246 CAGCAGCAGGAGGAGGAGGGCGG - Intronic
904258623 1:29273779-29273801 GAGCTACCCCAGCAGAAGGGAGG - Intronic
905387112 1:37612792-37612814 CAGCAACAGCAGCAGCAGCAAGG - Exonic
905803068 1:40858037-40858059 GATCAGCAGCTGCAGAAGGGAGG - Intergenic
905805731 1:40875907-40875929 CAGCAGCAGCAGCAGCAATGTGG - Intergenic
905996878 1:42388907-42388929 CACCAAGAGCAGAAGTAGGGAGG + Intronic
906124443 1:43418838-43418860 GAGCAGCAGCAGGAGGAGGGTGG + Intronic
906192188 1:43905538-43905560 CAGGAATAGGAGCAGAAGGAGGG - Intronic
906209680 1:44005595-44005617 CAGCAACAGCAGCACCAGACGGG + Intronic
906217555 1:44052383-44052405 CACCAACAGCAGTAGAAAAGTGG + Intergenic
906223790 1:44104376-44104398 CTGCAGCAGCAGCAGACGGCTGG - Intergenic
906296970 1:44654874-44654896 CAGCAACAGGCGCAGCATGGCGG + Exonic
906823257 1:48951209-48951231 CAGCAAAAGCATCAGAAGGTAGG + Intronic
906964084 1:50439613-50439635 CAGGAACAGCAGCAGGGGTGTGG - Exonic
907488075 1:54790758-54790780 CAGCAGCAGCAGCAGCAGCCAGG - Intronic
907868606 1:58422854-58422876 CAGCAGAAGCAGCAGAAGCAAGG + Intronic
908514916 1:64882814-64882836 CAGTCACGGCAGCAGAAGGAGGG + Intronic
908825979 1:68133064-68133086 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG + Intergenic
909344657 1:74571639-74571661 CAGAAACAGCCGCAGAGGAGAGG - Exonic
911568903 1:99498440-99498462 CAGCAGCTGGAGCAGAAGGAAGG + Intergenic
912318976 1:108692661-108692683 CAGCAACAGCAGCAGTGCGGCGG + Exonic
912715495 1:111980874-111980896 CAGCAATATCATCAGAAGGAGGG - Intronic
912776569 1:112509387-112509409 CAGCAGCAGGAGCAGAAGGCAGG - Exonic
912823820 1:112887711-112887733 CAGCCAAAGCAGCAGGAAGGCGG - Intergenic
913091753 1:115480834-115480856 CAGCATCAGCAGCACAAGCAGGG - Intergenic
913315812 1:117550320-117550342 CAGCAGCAGCCTGAGAAGGGAGG - Intergenic
913609614 1:120497271-120497293 CTGCAACAGCAGCTGGAGAGCGG - Intergenic
914408399 1:147400622-147400644 CAGCCACAGGATCAGAAAGGTGG - Intergenic
914581576 1:149024573-149024595 CTGCAACAGCAGCTGGAGAGCGG + Exonic
914932742 1:151949472-151949494 CAGCCACAGGAGCAGGAGGCTGG + Intergenic
915075567 1:153306036-153306058 CAGCGACAACAGCAGGATGGTGG + Intronic
915839505 1:159203152-159203174 CAGCAAGAGGACCAGAAAGGAGG - Intronic
916143781 1:161722639-161722661 CTGCAGCAGCTGCAGAAGGATGG - Exonic
916170047 1:161995126-161995148 CACCAACAGCAGCCAGAGGGAGG + Intronic
916203626 1:162294960-162294982 CAGCAGCAGCAGCAGTGGTGAGG - Intronic
916456103 1:164972440-164972462 CAGCAGCAGAGGCAGAAGGGAGG - Intergenic
916591705 1:166197340-166197362 AAGCAACAGCAGCAATAGAGTGG + Intergenic
917345210 1:174022257-174022279 CAGCCTCAGCAGCAGCAGGTGGG - Exonic
918013653 1:180611224-180611246 CAGCAACAGCAGCAAATATGTGG + Intergenic
918270897 1:182898217-182898239 CAGTGGCAGCAACAGAAGGGAGG + Intergenic
919075784 1:192810970-192810992 CAGCAAGACCATCTGAAGGGGGG - Exonic
919477035 1:198041822-198041844 CAGCAACAGCAACACAGGTGTGG + Intergenic
919653540 1:200175028-200175050 CAGCAACAGTAGCAGAAATAAGG - Exonic
919756479 1:201069256-201069278 CAGCAGCAGCAGCATAAAGCAGG + Intronic
919787425 1:201268705-201268727 CAGCAGCAGCTGCTGCAGGGAGG + Intergenic
920083610 1:203397067-203397089 CAACAACAGCAGCAGAGAAGAGG + Intergenic
920115710 1:203619652-203619674 CAGCAATAGCAGCAGCAGGCTGG - Intergenic
920600780 1:207321821-207321843 CAGCACCAGCAGCAGCAGCCGGG - Exonic
920845240 1:209588139-209588161 CAGCACCAGCAAAAGGAGGGTGG + Intronic
920876244 1:209838877-209838899 CAGCAACAGCAGCCTTAGTGGGG - Intronic
921739257 1:218665365-218665387 CAGCAACAGCAGCTGAGCTGTGG + Intergenic
921764430 1:218953501-218953523 CAGCAGCAGCAGCAGCAGGAGGG + Intergenic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
921817986 1:219585946-219585968 CAGCAACAGCAGCAGATCCTGGG + Intergenic
921884801 1:220295025-220295047 CTGCAACAGCTGAGGAAGGGAGG - Intergenic
922030698 1:221794724-221794746 CAGCAACAGGAGCTGAACTGGGG - Intergenic
922909815 1:229206089-229206111 CAGCAACAGTGACAGAAGTGTGG - Intergenic
923119712 1:230978802-230978824 CAGCAGCAGCAGCAGCCGGCAGG + Exonic
923199731 1:231699662-231699684 TAGTAAGAGCAGAAGAAGGGAGG - Intronic
923256583 1:232226640-232226662 CAGCAACAGCAGCAGCAGCCTGG + Intergenic
923438788 1:233995652-233995674 TAACAACAGCAGCAGAGGAGAGG + Intronic
923653120 1:235892247-235892269 GAGCAACAGGAGCTGCAGGGAGG - Intergenic
924458129 1:244234421-244234443 CAGCAGCAGCAGCAGCAGCCAGG - Intergenic
924679864 1:246220616-246220638 CATGAACAGCAGCAGGAGGCAGG + Intronic
1064645341 10:17454199-17454221 CAGCAGCAGCAGCAGCAGGCTGG + Exonic
1065236839 10:23660596-23660618 AATCAACACCTGCAGAAGGGAGG - Intergenic
1065403624 10:25336418-25336440 AAGTAACAGCAGCAGAAAGATGG - Intronic
1065879618 10:30027567-30027589 CAGCAGCAGCAGCAGCAGTGAGG - Exonic
1067017451 10:42768793-42768815 CAGCAACAACAGCAGCAGAAAGG - Intergenic
1067192804 10:44085509-44085531 GAGCAACAGCTACAGAAAGGAGG - Intergenic
1067560356 10:47300692-47300714 CAGCAGCAGCAGCAGCAGCTGGG - Exonic
1067712123 10:48657689-48657711 CATTAGCAGCAGCAGAAGGTAGG + Intergenic
1067724481 10:48759539-48759561 CAGCAACAGCAGCAGCAGCCAGG - Intronic
1068453612 10:57226407-57226429 CAGGAAGAGCAGAAGTAGGGAGG + Intergenic
1069580336 10:69561584-69561606 ATGCAAGAGCAGAAGAAGGGGGG + Intergenic
1069772398 10:70908023-70908045 CAGAAACAGAAGCAGATGAGGGG - Intergenic
1069900662 10:71704994-71705016 CATCAACAGCAGCAGCGGCGTGG + Intronic
1069952855 10:72031568-72031590 GAGAAACATCAGCAGATGGGAGG + Intergenic
1070586477 10:77770649-77770671 AAGCAACATAAGCTGAAGGGCGG - Intergenic
1071033719 10:81216546-81216568 CAGCAACAGCCTCAGAAGTAAGG - Intergenic
1071358023 10:84817959-84817981 CAGCAGCAGCAGCAGCATGAGGG + Intergenic
1072121714 10:92410700-92410722 CAGCCACATCAGCAGAAGCCAGG - Intergenic
1072336611 10:94403285-94403307 CAGCAGCTGCAGCAGTAGCGAGG + Exonic
1072688072 10:97550498-97550520 CAGCTCCTGCAGCAGCAGGGAGG - Intronic
1073448215 10:103593413-103593435 CAGCAAAAGCAGGAGAGGGTCGG + Intergenic
1074813860 10:117130507-117130529 GAGAAACAGCTGCAGGAGGGGGG - Intronic
1075189677 10:120295349-120295371 GAGCAACAGCTGGAGAAGGCAGG - Intergenic
1075438470 10:122461669-122461691 CAGCAGCAGCGGGAGAAGAGCGG - Exonic
1076003079 10:126927849-126927871 CAGCCACAGCAACCCAAGGGTGG - Intronic
1076120413 10:127932582-127932604 CAGCAACAGAGACAGGAGGGTGG + Intronic
1076731648 10:132442423-132442445 AAGGGACAGCAGCAGAATGGAGG + Intergenic
1077063347 11:627108-627130 GAGCAGCAGCAGCAGCAGGAGGG + Exonic
1077103310 11:831635-831657 CAACAGCAGCAGCAGCAGGTGGG - Exonic
1077370013 11:2177445-2177467 CAGCAGCAGTAGCAGAAGGGGGG - Intergenic
1077556427 11:3228194-3228216 CCGCAGCAGCAGCATAAGGCTGG + Exonic
1078074796 11:8148794-8148816 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1079113918 11:17628210-17628232 CAGCAAAAGCAGCACTAAGGGGG - Intronic
1079141959 11:17817041-17817063 CAACACCAGCAGCAGAGGAGAGG - Intronic
1079620064 11:22543135-22543157 AAGCTGCAGCAGCAGAAGTGAGG + Intergenic
1080103339 11:28484882-28484904 GACCAACAGCAACAGAAGGTAGG - Intergenic
1080433743 11:32221270-32221292 CAGCAGCAGGAGCAGAAGACAGG - Intergenic
1080682245 11:34487668-34487690 CAGCAGCATCAGCAGAAGGAGGG - Intronic
1081197985 11:40184893-40184915 CAGGAAGCGCAGCAGAAAGGAGG - Intronic
1081489179 11:43554181-43554203 CAGTGGCAGCAGCAAAAGGGAGG - Intergenic
1081801080 11:45859766-45859788 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1081812824 11:45922920-45922942 CAGCAGCAGCAGCAACAGCGCGG - Exonic
1081934377 11:46894939-46894961 CAGCATCAGTACCAGAAGAGTGG + Intronic
1083651602 11:64207716-64207738 GACCAGCTGCAGCAGAAGGGAGG - Intronic
1083796879 11:65021967-65021989 CAGCAGTAGCAGCAGCAGGCTGG - Exonic
1084144629 11:67258159-67258181 CAGCAGCAGCAGCAGAACTAGGG + Intergenic
1084185086 11:67467319-67467341 CAGCAGCAGGAGCAGGAAGGAGG + Exonic
1084209045 11:67612526-67612548 CAGCAGCGGCAGCTGGAGGGTGG - Intronic
1084564386 11:69920938-69920960 CAGCCACAGGTGCAGGAGGGTGG + Intergenic
1084630866 11:70348429-70348451 CAGCCACAGCAGGGAAAGGGCGG - Intronic
1084634072 11:70378659-70378681 ACGGAACAGCAGCAGCAGGGAGG - Intronic
1084697038 11:70761915-70761937 CAGCAGCAGCAGCAGCAGCCGGG - Intronic
1084859763 11:72010781-72010803 CAGCAGCAGAAGCTGAAGGTGGG - Exonic
1086486912 11:87315117-87315139 CAGTAGCAGCAGTAGTAGGGGGG - Intronic
1086980079 11:93186939-93186961 CAGCAACATCAGCAGCACTGGGG - Intronic
1087392058 11:97548443-97548465 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1087448829 11:98291616-98291638 CAGCAATAGCAGCAGTAGTTTGG + Intergenic
1088029563 11:105229852-105229874 CAGCAACAGCAGCTGAAAGAGGG - Intergenic
1088590227 11:111396419-111396441 CTGGAACTGCAGCAGAATGGGGG - Intronic
1089100702 11:115959754-115959776 CAGCACCAGCTGGAGGAGGGGGG - Intergenic
1090911315 11:131122010-131122032 CAGAAACAGCAGGGGAAGGATGG + Intergenic
1091111352 11:132971927-132971949 CAGCAGCAGTAGCAGCAGGGTGG - Intronic
1091293232 11:134454106-134454128 CAGCAGCAGCAGCAGAAGCAGGG - Intergenic
1092119382 12:6033538-6033560 CAGCCTCAGCAGCAAAAGAGAGG - Intronic
1093239461 12:16652066-16652088 CAGCAACAGCAAGAGAGGGAGGG + Intergenic
1093547720 12:20368518-20368540 TAGCGGCAGCCGCAGAAGGGAGG - Intergenic
1094448949 12:30563501-30563523 CAGCAAAAGCAGTAGTAAGGAGG + Intergenic
1094523408 12:31216166-31216188 CAGAAGCAGCAGCAGCAGTGAGG - Intergenic
1094783267 12:33817920-33817942 CAGCAACTGCAGCAGTGTGGTGG + Intergenic
1095616646 12:44198225-44198247 TAGGAAGGGCAGCAGAAGGGTGG + Intronic
1095736856 12:45567040-45567062 CAGAAAGAGCAGCAGAGGAGTGG + Intergenic
1096868633 12:54579543-54579565 CAAAAACAGCAGCAGGAGAGAGG + Exonic
1096872710 12:54604138-54604160 CACAAGCAGCAGCAGAAGTGTGG + Intergenic
1097301729 12:58026345-58026367 CAGCAACAGCAGCATAACCTGGG - Intergenic
1097561249 12:61208885-61208907 CAGCAGCAGCTGCAGAACAGCGG + Intergenic
1097563327 12:61236060-61236082 CAGCAAAAGCAGCACAAAGAAGG - Intergenic
1097585481 12:61510695-61510717 CAGCAGCAGCAGGAGAAGAATGG + Intergenic
1099882519 12:88483909-88483931 CAGCAAAAGCAGTAGTAAGGGGG + Intergenic
1101740466 12:107495987-107496009 CAGCAACAGTGGCAGAATTGAGG - Intronic
1101941363 12:109101509-109101531 CAGCCTCAGCAACATAAGGGAGG + Intronic
1102212459 12:111137335-111137357 CAACAACATCAGCAGAAGAGAGG - Intronic
1102408411 12:112694508-112694530 CAGCAGCAGCAGCATAAGAAAGG + Intronic
1102587635 12:113934242-113934264 CACCAACAGCAGCGGAAGACTGG + Intronic
1102951162 12:117032640-117032662 GGGCAACAGCAGCACCAGGGTGG - Intergenic
1102965029 12:117119130-117119152 CAGCAGCAGCAGCAGCTTGGAGG - Intergenic
1103074154 12:117968888-117968910 CAGCAGCAGCAGCAGCAGCGCGG - Intronic
1104021248 12:124993828-124993850 CAGCAGCAGCAGCAGGAGCCCGG - Exonic
1104759617 12:131289159-131289181 CAGCAACAGCAGCAGCCGATGGG + Intergenic
1104846840 12:131851201-131851223 CGGCAGCAGCAGCAGCATGGTGG - Exonic
1105773872 13:23638683-23638705 CAGGAACATCAGCAGAAGGGAGG - Intronic
1105830987 13:24162534-24162556 CAGAAGCAGTGGCAGAAGGGAGG - Intronic
1106063330 13:26317784-26317806 CAGCAAAAGCAGTAGTAAGGGGG + Intronic
1106161972 13:27209629-27209651 CAGCAATAGCAACATAAAGGAGG + Intergenic
1106570675 13:30924576-30924598 CATCCACAGAAGCAGAAGAGAGG - Exonic
1106587491 13:31069985-31070007 CAGCAGCAGCAACAGAAGACAGG + Intergenic
1106945469 13:34823033-34823055 TACTAAAAGCAGCAGAAGGGAGG + Intergenic
1106995557 13:35476295-35476317 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1107276712 13:38687427-38687449 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1107826439 13:44332727-44332749 AGGCAGCAGCAGCAGCAGGGAGG - Intergenic
1107899255 13:44995822-44995844 CAGCAGCAGCAGCAGCAGCTGGG - Intronic
1108574307 13:51778292-51778314 CAGCAAGAGCAGGACAAAGGCGG - Intronic
1108639708 13:52371709-52371731 CAGCAGCAGCAGCAGGATGGGGG + Intergenic
1110365791 13:74683964-74683986 GAGCAACTGAAGCAGAAGTGAGG + Intergenic
1113301211 13:109021473-109021495 CAGCAGAAGCAGCAGCAGTGTGG + Intronic
1113491186 13:110693328-110693350 CAGCACCAGCAGCAGTAGGTGGG - Intronic
1114842058 14:26275837-26275859 CAGCAACAGGAACAGAAGGAGGG + Intergenic
1115028251 14:28766873-28766895 CAGCAGCAGCAGCCCAAAGGGGG - Intergenic
1115754285 14:36517693-36517715 CAGCAACTGCAGCAGGACAGCGG - Exonic
1115888579 14:38001817-38001839 CAGCAACAGCAGCATTAGCTGGG - Intronic
1116725265 14:48554767-48554789 CAGCAGCAGCAGCAGCAGAGTGG - Intergenic
1117547083 14:56802294-56802316 CAGCAACAACAGCAGAATGGAGG - Exonic
1117644490 14:57837321-57837343 CAGCGAAAAGAGCAGAAGGGAGG + Intronic
1118636865 14:67755909-67755931 CAGCAACAGAGGTAGAAGGCAGG + Intronic
1118712827 14:68536747-68536769 TAGGAAAAGCAGCAAAAGGGGGG - Intronic
1119395168 14:74320924-74320946 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
1119756850 14:77125593-77125615 CACCAGCAGCAGGAGAAGGACGG - Intronic
1119989844 14:79184001-79184023 CAGCCACAACAGCAGAGGTGGGG + Intronic
1120030329 14:79633724-79633746 CAACAACAGCAAAAGATGGGTGG + Intronic
1120764018 14:88311887-88311909 AAACAACAGAACCAGAAGGGGGG + Intronic
1120778627 14:88464987-88465009 CAGAAACAGGAGGAGGAGGGAGG - Intronic
1120940076 14:89939488-89939510 CAGCAACAGGAGCAGGAGGCGGG + Intronic
1121011576 14:90523077-90523099 GGGCAACAGCAGCCCAAGGGAGG + Intergenic
1121195847 14:92071009-92071031 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1121262631 14:92577515-92577537 CGGCAGCAGCAGCAGCAGAGAGG + Intronic
1121570194 14:94941460-94941482 CAGCAACTGCCGCAGCTGGGCGG - Intergenic
1121718610 14:96093971-96093993 CAGGAAAAGCATCAGAATGGAGG - Exonic
1122158359 14:99764701-99764723 CAGGCACAGAAGCAGCAGGGTGG + Intronic
1122752059 14:103943865-103943887 AAGCAACAGGAGCTGTAGGGTGG - Intronic
1122791163 14:104184791-104184813 GAGCCCCAGCAGCTGAAGGGGGG + Intergenic
1122799464 14:104222458-104222480 CAGCACCATCAGAAGACGGGAGG - Intergenic
1124217438 15:27819250-27819272 CAGAAATAGAAGCAGAAGGAAGG + Intronic
1124585690 15:31004394-31004416 TAGCCACAGAAGCAGCAGGGTGG - Intronic
1124929124 15:34101789-34101811 TAGCAGCAGCAGCAGCAGGACGG + Exonic
1125933958 15:43618681-43618703 CAGCAGCAGCAGCAGCAGCAGGG + Exonic
1125947055 15:43718143-43718165 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1126790209 15:52214109-52214131 CAGTGACAGAAGCAGAAGGAGGG + Intronic
1127474076 15:59315772-59315794 CAGCAACAGCAGCAGCATTGGGG - Intronic
1127502000 15:59562321-59562343 CATCAACAGTAGAAAAAGGGCGG - Intergenic
1128134193 15:65250631-65250653 CTGCAGCAGTAGGAGAAGGGAGG - Intronic
1128682341 15:69661178-69661200 CATCCACAGGAGCAGGAGGGAGG + Intergenic
1128731723 15:70025856-70025878 GAGCACCAGCAGCTGAAGAGTGG - Intergenic
1129589675 15:76904667-76904689 CAGCAACAGAGGCAGGAGGCTGG + Intronic
1129919912 15:79311275-79311297 CAGCAGCAGAAGCAGCACGGAGG - Exonic
1130106148 15:80929975-80929997 CAGAAACACCAGCAGAAGAAAGG - Intronic
1130648893 15:85751141-85751163 CAGCCACAGAAGCAGAGGGCGGG + Intergenic
1131145256 15:90006999-90007021 CATCAACAGCAACACAGGGGTGG - Intronic
1131466054 15:92655615-92655637 CAGCAGCAGCGGCAGGAGCGGGG + Exonic
1132391121 15:101438904-101438926 GAGCAACAGCAGGGGAAGGTGGG + Intronic
1132712744 16:1276712-1276734 CAGCAGCAGCAGCAGCTGCGGGG + Intergenic
1132979515 16:2729307-2729329 CAGCACAAGCATCAGAAAGGAGG + Intergenic
1132995071 16:2818482-2818504 CTGCTCCTGCAGCAGAAGGGTGG - Intronic
1133138458 16:3728397-3728419 CAGCAACAGCAGCAGCAGCAAGG - Exonic
1133288418 16:4702102-4702124 CAGCAGCAGCAGCAGCAGTCGGG - Exonic
1133403027 16:5502522-5502544 CAGTAACAGCAACAAAAGGCAGG - Intergenic
1133784313 16:8963248-8963270 CAGCAGCAGCAGCAGAAAGCGGG - Exonic
1134336151 16:13301398-13301420 CAGCAACAGCAGCATTATGTGGG - Intergenic
1134743923 16:16572790-16572812 TAGCAACAGCAGCAGTATGCTGG - Intergenic
1134762321 16:16725155-16725177 AAGCAACAGCAGCAGCAGGATGG + Intergenic
1134983738 16:18634015-18634037 AAGCAACAGCAGCAGCAGGATGG - Intergenic
1135001559 16:18780961-18780983 TAGCAACAGCAGCAGTATGCTGG + Intergenic
1135137970 16:19898661-19898683 CAGCCACAGCCTGAGAAGGGAGG - Intergenic
1136033869 16:27523815-27523837 CAGCCGCAGCAGCAGAGAGGTGG + Intronic
1136394824 16:29987172-29987194 AAGCAGCAGCAGCAGCAGGAGGG - Exonic
1137560672 16:49500194-49500216 GAGAAACAGCAGCAGTAGGTGGG - Intronic
1137655305 16:50153771-50153793 CAGCAGCAGCAGCAGCAGCACGG + Exonic
1138815568 16:60199405-60199427 CACCAACAGCAGGAGGTGGGGGG + Intergenic
1139300766 16:65943519-65943541 CAGCAACAGGGGCAGATGGTTGG - Intergenic
1139347963 16:66316642-66316664 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139447462 16:67006669-67006691 CAGAAGCAGCAGGAGTAGGGTGG + Intronic
1140392867 16:74603114-74603136 CAGCAGCAGCAGCAGCAGCCAGG + Intronic
1141096041 16:81163842-81163864 AAGCAGCAGCAGCCGAAGGCAGG - Intergenic
1141434194 16:83989925-83989947 AATCAAAAGCAGCTGAAGGGAGG - Intronic
1141478980 16:84293714-84293736 ATGCAACAGCAGCAGAGAGGAGG - Intergenic
1141915499 16:87093896-87093918 CAGCCGCAGCAGCCGCAGGGAGG + Intronic
1142041237 16:87895708-87895730 CAGAGACAGAAGCAGCAGGGCGG - Intronic
1143152178 17:4814555-4814577 CAGCATTAGGAGGAGAAGGGGGG + Intronic
1143550953 17:7630198-7630220 CAGCAACAGCAGCAGGCGCGAGG - Exonic
1143631514 17:8142885-8142907 CAGTAAGAGCAGTTGAAGGGAGG - Intronic
1144137756 17:12314618-12314640 CAGTGGCAGCAGCAGGAGGGTGG + Intergenic
1144634249 17:16893972-16893994 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1144794915 17:17884546-17884568 CAAAGGCAGCAGCAGAAGGGTGG + Intronic
1145168363 17:20633867-20633889 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1147262786 17:39218268-39218290 CAGCAGCAGCAGCAGCAGCGTGG + Intronic
1147262789 17:39218271-39218293 CAGCAGCAGCAGCAGCGTGGGGG + Intronic
1147398815 17:40166412-40166434 GAGCAACAGCTGGACAAGGGAGG - Intronic
1147666526 17:42152310-42152332 GAGGAACAGCATCAGAAAGGAGG + Intronic
1147757620 17:42779443-42779465 CAGCACCAGCCTGAGAAGGGAGG - Exonic
1148021692 17:44557711-44557733 CAGCAGCGGCAGCAGCAGGCGGG - Exonic
1148070441 17:44905701-44905723 CAGCAGCAGCAGCAGGTGGCAGG + Intronic
1148821946 17:50364945-50364967 CAGCAGCAGCAGCAGCAGGATGG - Intergenic
1149634694 17:58157219-58157241 CAGCAGCAGTAGCCGCAGGGTGG - Intergenic
1151165811 17:72202839-72202861 CAGCAGCAGCAGCAGGAGTGAGG - Intergenic
1151671263 17:75572945-75572967 CAGCAGCAGCAGCACAGGGCAGG + Intronic
1151895128 17:76974941-76974963 CATGAACAGCAGCAGGAGGCAGG + Intergenic
1152068639 17:78124614-78124636 CACCAGCAGCAGCAGCAGGAGGG + Exonic
1153013792 18:565276-565298 CAGCAGCAGCAGCAGTGGGATGG - Intergenic
1154019271 18:10648242-10648264 CAGCAGCAGCAGCAGCATAGTGG - Intergenic
1155037418 18:22036726-22036748 CAACAACAACAGGAGAAGGCTGG + Intergenic
1155064545 18:22257169-22257191 GAGTAACAGCAGCAGAAGAGTGG - Intergenic
1155384213 18:25259575-25259597 CAAAAACAGCAACAGGAGGGTGG + Intronic
1156156560 18:34309588-34309610 CAGCAATAGCAGCAAGATGGTGG - Intergenic
1156637861 18:39052640-39052662 CAGCAGCAGCAGCAGAAATTGGG + Intergenic
1157469129 18:47974670-47974692 CAGCAACAGCAGAAGCAAGAAGG + Intergenic
1157476774 18:48028879-48028901 CAGCCACAGCAGGAGGAGGTAGG - Exonic
1157535710 18:48455896-48455918 CACCAACAGCAGCTGAGGTGAGG + Intergenic
1157618605 18:49002435-49002457 CAGAAACAGAGGCAGCAGGGAGG - Intergenic
1157720903 18:49923521-49923543 CAGCAAGACCAGTAGAAGTGTGG + Intronic
1157741534 18:50097593-50097615 CTGCAGCAGCAGCAGAATGTAGG + Intronic
1159102221 18:63970153-63970175 CAGCAGCAGCAGCAGGAGGTGGG + Exonic
1159354222 18:67316327-67316349 CAGTAAGAGGAGCAGAAAGGAGG - Intergenic
1159921072 18:74227822-74227844 CAGCAGCAGCAGCAGCAGAAAGG + Intergenic
1160149569 18:76388834-76388856 CAGCAACAGCCGGGGAAGGAAGG + Intronic
1160361874 18:78290205-78290227 GAACACCAGCAGCAGGAGGGAGG + Intergenic
1160377369 18:78423185-78423207 CAGCAGCAGCAATAGCAGGGGGG - Intergenic
1160720333 19:594387-594409 CAGCAGCAGCAGGAGACGGCAGG - Intronic
1160796025 19:945792-945814 CAGCACCAGCAGCAGGAGCCGGG - Intronic
1160800941 19:968454-968476 CAGCAACAGCATCAGCATGTCGG + Exonic
1160865096 19:1252847-1252869 CAGCAGCAGCAGCAGTGGCGTGG + Intronic
1160866178 19:1257143-1257165 CAGCGACAGCAGTAGCAGCGGGG + Exonic
1161009973 19:1955294-1955316 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1161735159 19:5987698-5987720 TGGCAACAGCAGCAGCAGGCTGG - Intergenic
1162018553 19:7858314-7858336 CAGCTACAGGAGCAGCAGGTAGG + Exonic
1162412356 19:10514193-10514215 GAGCAACAGCAGCAGGAAGAGGG + Exonic
1162481105 19:10927682-10927704 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1163048448 19:14662742-14662764 CAGAAGCAGGAGCAAAAGGGAGG - Intronic
1163690896 19:18737723-18737745 GAGGAGCAGCAGCAGGAGGGCGG - Intronic
1164157082 19:22603448-22603470 CAGCAAAGCCAGGAGAAGGGGGG + Intergenic
1164161431 19:22627828-22627850 CAGCAGCAGCAGCAGCTTGGAGG + Intergenic
1165002476 19:32776365-32776387 CAGCAACAGCAACAGCAGTGTGG - Intronic
1165377006 19:35449875-35449897 CAGCAGCAGCAGGAGGAGGTCGG - Exonic
1166105737 19:40597266-40597288 CAGCAACAGCACCAGCAGGAGGG - Exonic
1167338466 19:48900822-48900844 CAGCAGCGGCAACAGAAGGAGGG - Exonic
1167341992 19:48921854-48921876 CAGCAGCAGCAGCAGCAGCAAGG + Exonic
1167443681 19:49525045-49525067 CAGCAGCAGCAGCAGCAGGATGG - Intronic
1167621709 19:50564413-50564435 CAGGAACAGCAGCAGAGGTGAGG + Intronic
1167904510 19:52647699-52647721 AATAAACAGCAGCAGAAGAGAGG - Intronic
1167971714 19:53192065-53192087 GAGAAACAGCAGGAGAAGAGAGG - Intronic
1168104316 19:54157206-54157228 CAGTAACAGCAGGGGAAGGAGGG + Intronic
1168431982 19:56288513-56288535 CAGCAAAAGCATCAAAAGTGGGG - Intronic
925592726 2:5526352-5526374 CAGCAGCAGTAGCAGACCGGAGG - Intergenic
926115762 2:10212260-10212282 CAGCAGCAGCAGCAGCAGAAGGG - Intergenic
926756356 2:16239570-16239592 CAGCAGCAGCAGCAGAATGAAGG + Intergenic
927217735 2:20677968-20677990 CAGCAGCAGCAGCAGCAGCTGGG + Intergenic
928391470 2:30914054-30914076 CAGCAGCAGCAGCAGCAGCCTGG - Intronic
928398181 2:30959097-30959119 CAGCGGCAGCAGCAGGAGAGAGG - Intronic
928647542 2:33370480-33370502 CAGCAGCAGCAGCAGCAGCTTGG - Intronic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
929604195 2:43224599-43224621 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
929604359 2:43225370-43225392 CAGCAGCAGCAGAAGGGGGGCGG - Exonic
929604360 2:43225373-43225395 CTGCAGCAGCAGCAGAAGGGGGG - Exonic
930096428 2:47570252-47570274 CAGCAGCAGCAGCAGCAGGAGGG + Exonic
931395517 2:61885064-61885086 CAGCAACCGCTGCAGATGGGGGG + Exonic
931909895 2:66887820-66887842 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
932086215 2:68764709-68764731 GAGGAACAGCAGCAGCATGGAGG - Intronic
932476355 2:72008774-72008796 GAGCACCAGGAGGAGAAGGGAGG + Intergenic
933186090 2:79280743-79280765 CAGAAAGAGCTGCACAAGGGTGG - Intronic
933336322 2:80964198-80964220 CAGCAGCAGCAGCAGCATGGTGG + Intergenic
933892186 2:86782091-86782113 CATCAACAGCAGAAGTGGGGTGG + Intergenic
933980888 2:87549846-87549868 CAGCCTCAGCAGGAGAATGGGGG + Intergenic
935234173 2:101124189-101124211 CAGAAACAGCAGGAGAGAGGAGG + Intronic
935818437 2:106869570-106869592 GAGCAAAAGCAGCAGCAGGAGGG - Intronic
936312942 2:111400939-111400961 CAGCCTCAGCAGGAGAATGGGGG - Intergenic
936598128 2:113868896-113868918 CAGCAGCAGCAGCAGAAGGAAGG + Intergenic
936989381 2:118346361-118346383 CAGCAAATGCACCAGGAGGGAGG + Intergenic
937022525 2:118671364-118671386 CAGCAACAGCAGCAGCAGCAGGG - Intergenic
937024073 2:118682873-118682895 CAGCAGCAGCAGCAGCACAGAGG - Intergenic
937349665 2:121152970-121152992 ACGCACCAGCAGCACAAGGGTGG - Intergenic
937900092 2:127013382-127013404 CAGAGACAGCAGCAGAGAGGTGG + Intergenic
938190993 2:129280596-129280618 CTTCAACAACAGCAGCAGGGAGG - Intergenic
938260397 2:129891752-129891774 CAGCAGCAGCAGGAGGAGGATGG - Intergenic
940214717 2:151292666-151292688 TAGCAACAGCAGCATAAGCTTGG - Intergenic
940962208 2:159798157-159798179 CAGCAACGGCAGCAGGAGCGCGG + Exonic
940998120 2:160172247-160172269 CAGCCACAGCCTCAGAAAGGAGG - Intronic
941264140 2:163338524-163338546 CAGCAGCAGCAGCAGCAGTACGG + Intergenic
941431247 2:165417202-165417224 CAGCTACAGTAGTAGAAGTGGGG + Intergenic
941933238 2:170963422-170963444 CAGCAGCAGCAGTAGCAGCGGGG - Intronic
941933496 2:170965337-170965359 CTGCGAAGGCAGCAGAAGGGAGG - Intronic
942461169 2:176169844-176169866 CAGCAACAGCACCAGCAGCCTGG - Intronic
942606138 2:177693152-177693174 CAGCAATGGCAGGAGAGGGGTGG - Intronic
944097014 2:195979465-195979487 CAGCAAAAGCAGCACAAAGAGGG + Intronic
944507182 2:200424811-200424833 CAGCAACAGGAGCTCAAGAGAGG - Intronic
945854774 2:215056087-215056109 CAGCAACAAAAACAAAAGGGAGG + Intronic
945928685 2:215832332-215832354 CCGCCACAGCAGCAGAACAGTGG - Intergenic
946211451 2:218150461-218150483 CAGCACCAGGAGCAGGAAGGTGG - Intergenic
946411627 2:219518001-219518023 AAGCAAGAGCAGCAGCAGAGGGG - Intronic
946431980 2:219631014-219631036 CAGCAGTAGCAGCAGGATGGGGG + Intronic
946496120 2:220197207-220197229 CACCAACAGAAGCAGTAGGCAGG + Intergenic
946977060 2:225164719-225164741 CAGCAGCAGCAGCAGCAGCAAGG - Intergenic
947043354 2:225949462-225949484 CAGCAGCAGCAGCCGTAGGTTGG - Intergenic
947722584 2:232378813-232378835 CAGCAGCAGCAGCAGCATGCAGG - Exonic
948006851 2:234616801-234616823 CGGCAGTAGCAGCAGAAGCGAGG + Intergenic
948675688 2:239595273-239595295 CAGCAACAGGTGCAGAGTGGAGG + Intergenic
948858086 2:240739949-240739971 CAGCAACAGACGCAGAGGTGTGG + Intronic
948864275 2:240767541-240767563 CACCAACAGCAGCAGGCCGGTGG + Intronic
1168957543 20:1844898-1844920 CAGCAGCAGCCCCAGAAGGGTGG - Intergenic
1169378749 20:5088441-5088463 CAGCTAGGTCAGCAGAAGGGTGG + Intronic
1170330199 20:15201046-15201068 CAGCAGCAGCAGCACCTGGGAGG - Intronic
1170570540 20:17629822-17629844 GAGCAACAGCAGCAGATGGCCGG - Exonic
1170804981 20:19621716-19621738 CAGCAGCAGCAGCAGAACCCAGG - Intronic
1170999111 20:21396194-21396216 CAGCAGCTGCAGCAGGAGGGCGG - Exonic
1172100802 20:32483282-32483304 CGGCAGCAGCCGGAGAAGGGGGG + Intronic
1172167636 20:32908611-32908633 CAGCAGCAGCAGCTGCAGAGAGG - Intronic
1172532999 20:35646675-35646697 AATGAACAGCAGCAGAATGGAGG + Intronic
1173179743 20:40796822-40796844 CAGGAGCAGCAGCAGAGTGGGGG - Intergenic
1173855997 20:46251220-46251242 CAGCAGCAGCAGCAGTAGCGCGG + Exonic
1174553234 20:51376268-51376290 CAGCAGGAGCAAGAGAAGGGTGG + Intergenic
1174882166 20:54291869-54291891 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1175211182 20:57356973-57356995 CAGCAATGGCAGGAGAAGGGAGG - Intronic
1175241436 20:57552421-57552443 CAGTAACAGCATCAGAAGTAAGG - Intergenic
1175582665 20:60112616-60112638 CAGCATCAGCAGCAGCACAGTGG + Intergenic
1176044514 20:63085418-63085440 CAGGAACAGCAGAGGGAGGGAGG + Intergenic
1176233146 20:64042121-64042143 CAGCCACAGCTGGAGCAGGGGGG - Intronic
1176383090 21:6123108-6123130 CAGCAGCAGCAGCAGGAATGGGG - Exonic
1176873030 21:14099281-14099303 CAGCAATCTCATCAGAAGGGAGG + Intergenic
1177237569 21:18412722-18412744 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1177807673 21:25889906-25889928 CAACAACAGCAGCAAAAAAGGGG + Intronic
1178596851 21:33962131-33962153 CAGCAACAGCAGAAGAACCTGGG + Intergenic
1179740379 21:43415131-43415153 CAGCAGCAGCAGCAGGAATGGGG + Exonic
1180863896 22:19104881-19104903 AAGCAGCAGCAGCAGCAGAGGGG + Intronic
1180962701 22:19769349-19769371 CAGCAGCAACAGCAGCAGTGTGG - Intronic
1181475028 22:23162703-23162725 AAGCAACAGCACGAGACGGGTGG - Exonic
1181493945 22:23277510-23277532 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1181560174 22:23695431-23695453 CAGCAGCAGCAGCAGAGGCCTGG - Intronic
1182090923 22:27594354-27594376 CAGCAACAACAGCAGAGGGCAGG - Intergenic
1182123130 22:27799612-27799634 CAGCAGCAGCAGCAGCAGCATGG - Exonic
1182460747 22:30481882-30481904 CAGCAGCAGCAGGAGCAGGAGGG + Intergenic
1182460748 22:30481885-30481907 CAGCAGCAGGAGCAGGAGGGCGG + Intergenic
1182708426 22:32304988-32305010 GAGCAAAAGCAACAGAATGGAGG - Intergenic
1183330640 22:37219036-37219058 CAGCAAGAGCAGATGGAGGGTGG - Intergenic
1184301546 22:43563659-43563681 CACCAGCAGCAGCAGCAGCGCGG - Intronic
1184365953 22:44051511-44051533 TAGCAACAGCAGGAAAAGGAAGG + Intronic
1184761255 22:46545958-46545980 CAGCAACAGCATCAGGGGGTGGG - Intergenic
1184925290 22:47632204-47632226 CAGCAGCAGCAGCAGCAGCCCGG + Intergenic
1184933727 22:47702252-47702274 CAGCAGCAGCAGCAGCGGGGTGG - Intergenic
1184933728 22:47702255-47702277 CAGCAGCAGCAGCAGCAGCGGGG - Intergenic
949322769 3:2829465-2829487 CAGCAAAAGAAGCAAAAGGGAGG + Intronic
950375630 3:12569972-12569994 CAACAAGTGCAGCAGAAGGAGGG + Intronic
951009162 3:17656360-17656382 CAGCAACTAAGGCAGAAGGGAGG - Intronic
951477199 3:23119469-23119491 GAACAGCAGCAGCAGCAGGGGGG - Intergenic
951927199 3:27921512-27921534 CACCAACCACAGCAGAAGGTAGG - Intergenic
952546023 3:34420091-34420113 CAGGCATAACAGCAGAAGGGTGG + Intergenic
952558018 3:34556004-34556026 CAGCAACAGTAGGAAAAGAGAGG - Intergenic
952583982 3:34869235-34869257 CAGCAGCATCAGCAGAGTGGAGG + Intergenic
952641804 3:35605092-35605114 CAGCAACAACATCAGGAGGAAGG + Intergenic
952745351 3:36771685-36771707 CACCACCACCAGCAGAAGGATGG + Intergenic
952942490 3:38454762-38454784 CAGCAGCAGCAGCAGCATGCGGG + Intronic
953087996 3:39691981-39692003 CAGCAAGAGCAGCAGTAAGAGGG + Intergenic
953369537 3:42375804-42375826 CACCAGCAGCAGCAGAAAGCAGG + Intergenic
954419869 3:50413112-50413134 CAGCGGCAGCAGCAGCTGGGTGG - Intronic
955229885 3:57089369-57089391 CAGCAACAGTAGCAGAGGCCAGG + Intergenic
956070106 3:65439878-65439900 CAGCAGCAGCAGCAGACAGAAGG - Exonic
956135323 3:66092786-66092808 CAGGAACAGCGGCAGAATTGTGG + Intergenic
956193468 3:66629574-66629596 CTGCAGCAGCAGCAGCGGGGAGG + Intergenic
956609144 3:71104392-71104414 CAGCAACAGCAGCAGAAGGGCGG - Intronic
956681381 3:71785011-71785033 CAGCAAGAGGAGCAGGAGTGGGG + Exonic
956754830 3:72374121-72374143 CAGCACCTGCAGCAGCAGGCAGG + Exonic
957933503 3:86912747-86912769 AAGAAACAGAAGCAGAGGGGTGG - Intergenic
958931634 3:100213819-100213841 CAACAACAGAAGCAGGAGGTTGG + Intergenic
959143438 3:102514502-102514524 CAGCAACAGCTACAGATAGGAGG - Intergenic
959291086 3:104475133-104475155 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
959598083 3:108149328-108149350 CAGCAAAAGCAGGAGCAAGGAGG - Intergenic
960688145 3:120314231-120314253 CAGCAGCAGCAGCAGCATGGTGG - Intergenic
961016120 3:123469744-123469766 CGGGGACAGCAGCAGAGGGGAGG - Intergenic
961410775 3:126718796-126718818 CACCAACAGAACCAGAGGGGAGG - Intronic
961781132 3:129320542-129320564 CTGCAGCAGCAGCGGATGGGAGG + Intergenic
962212740 3:133492310-133492332 CAGCAGCTGCAGCAGCATGGCGG - Intergenic
962230575 3:133661994-133662016 CGGCAGCTGCAGCAGAAGAGCGG + Intergenic
962382419 3:134908661-134908683 CAGCAACAACAGCACAAAGAGGG + Intronic
963260442 3:143186697-143186719 CATCCACTGCAGCAGAAGGAAGG + Intergenic
963542283 3:146607910-146607932 CAGCAATAGCAACAGGAGAGAGG - Intergenic
963809991 3:149766862-149766884 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
964763250 3:160154252-160154274 ATGCCACAGCAGCAGAAGAGAGG + Intergenic
965419137 3:168435513-168435535 CAGTAACAGCAGCAGCAGCAGGG + Intergenic
965842414 3:172922137-172922159 CAGCCACAGCTTCATAAGGGAGG - Intronic
966016855 3:175150709-175150731 CAGAGTGAGCAGCAGAAGGGAGG - Intronic
966448178 3:180027116-180027138 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
966921872 3:184617473-184617495 CAGCAGCAGCAGCAGCAAGATGG + Intronic
967006390 3:185387109-185387131 CATCAACATCAGCAGAATGAAGG + Intronic
968262120 3:197333974-197333996 CAGCAGCAGCAGCAGGAGCTAGG + Intergenic
968509609 4:989658-989680 CAGCACCAGCAGCACCACGGTGG + Exonic
968971905 4:3800236-3800258 CAACAACAGCAACAAAAGGTCGG + Intergenic
969006136 4:4021336-4021358 CAGCAGCAGCAGCAGCTGGAGGG + Intergenic
969320820 4:6411396-6411418 CAGCAGGAGCAGCAGGAAGGAGG + Intronic
969481915 4:7451282-7451304 CAGCAGCAGCAGCGGCAGTGGGG + Intronic
969721507 4:8895027-8895049 GAGCAGCAGCAGGACAAGGGCGG - Intergenic
969806812 4:9615954-9615976 CAGCAGCAGCAGCAGCTGGAGGG - Intergenic
970180274 4:13384367-13384389 CAGCAGCAGCAGCAGCACGGTGG - Intronic
970180275 4:13384370-13384392 CAGCAGCAGCAGCAGCAGCACGG - Intronic
970592562 4:17572212-17572234 CAGCAGCAGCAGCAGCAAGATGG - Intergenic
971321866 4:25612181-25612203 CAGTGGAAGCAGCAGAAGGGTGG + Intergenic
972083432 4:35182708-35182730 CAGCAGCAGCAGTAGCAGTGTGG - Intergenic
973306689 4:48659986-48660008 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
973639814 4:52891797-52891819 CATCAACTGCAGCAGATGAGAGG - Intronic
973916078 4:55636112-55636134 CAGCAGCAGCAGCAGGAGCGGGG + Exonic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
974636642 4:64572413-64572435 AAGAAACAACAGCAGTAGGGTGG - Intergenic
975096473 4:70462859-70462881 CAGGAACTGCAGCAGGAGGATGG + Intronic
976088181 4:81427732-81427754 AAGCAGCAGCAGCAGCAGGCAGG + Exonic
976122650 4:81800033-81800055 CAGCAGCAGCAGCAGAGGAAAGG + Intronic
976459582 4:85293915-85293937 CAGCAAAAGCAGCACAAAGCAGG + Intergenic
977320009 4:95501944-95501966 CAGCCACAGCAGAAGAAGAGAGG + Intronic
977929808 4:102738077-102738099 TAGCTGCAGTAGCAGAAGGGGGG - Intronic
978205547 4:106076396-106076418 CAGCAACAGCAGCAGTATTGTGG + Intronic
978417777 4:108495719-108495741 CAGCAAAAGCAGTACAAGGAGGG + Intergenic
979407845 4:120336998-120337020 CAGCAACAGGGGCATAAGGGTGG - Intergenic
979489465 4:121308648-121308670 CAGCACAAGCAGCAGAAGATGGG + Intergenic
980461914 4:133125766-133125788 CAACCAGAGCAGCAGAATGGGGG + Intergenic
980710722 4:136563842-136563864 CAGCAACATCAGCTGAAAAGTGG + Intergenic
980792028 4:137632454-137632476 CAGCAGCAGCAGCAGCATGGGGG - Intergenic
980970074 4:139559304-139559326 CAGCAGCAGCAGAAGTAGTGTGG + Intronic
981354705 4:143774723-143774745 GAGCAACAGCAGCAGAAGTTTGG + Intergenic
981511962 4:145567021-145567043 CAGCAGCAGCAGCAGCATGGCGG - Intergenic
981511963 4:145567024-145567046 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
981600360 4:146481400-146481422 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
984057541 4:174948652-174948674 CAGCAGCTGCAGCAGCATGGTGG + Intronic
984592755 4:181635141-181635163 CTGCATCAGCAGCAGAAGGGAGG + Intergenic
984820518 4:183877660-183877682 CAGCAGCAGCAGCGGAAGTGCGG - Intronic
985164623 4:187079341-187079363 CAGGCACAGCAGCAGCAGGCAGG + Intergenic
985341467 4:188959219-188959241 CAGCCAAAGCAGCAGCAGGAAGG - Intergenic
985482474 5:124003-124025 CAGCAAAAGCAGCATTAAGGGGG - Intergenic
986153190 5:5146657-5146679 CTAGAACAGCAGCAGCAGGGTGG - Intronic
986466924 5:8034997-8035019 GAGCAGCAGCAGCACCAGGGAGG + Intergenic
988565947 5:32320249-32320271 CATGAACAGCAGCAGGAGGCAGG - Intergenic
989341976 5:40386378-40386400 CAGCAACAGCAGCAGCAGCTGGG - Intergenic
989358529 5:40572501-40572523 CAGAAACAGCAGCAGACCGGAGG + Intergenic
990626383 5:57616855-57616877 CAGCAACAGCCACACAAGTGCGG + Intergenic
990825520 5:59893682-59893704 CAGCAGCAGCAGCATCAGGAAGG - Exonic
994497794 5:100535577-100535599 CAGCAACAGCAGGAGGAGGACGG - Exonic
995052747 5:107724809-107724831 CAGCAGCAGCAGCAGAAAGTGGG + Intergenic
995350824 5:111173459-111173481 AAGGAACAGCAGCAGAAGGAAGG + Intergenic
995963374 5:117873008-117873030 CAGCAACAGCAGCAGTTCAGAGG + Intergenic
996127771 5:119746024-119746046 CAGCAAAAGCATGAGAAGGCAGG - Intergenic
996552308 5:124743863-124743885 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
997098713 5:130943673-130943695 CAAAAACAACAGAAGAAGGGGGG + Intergenic
997310635 5:132878022-132878044 CAGCTACAGCTGCCGAAGAGTGG - Exonic
997659513 5:135578740-135578762 CAGCAGCAGCAGGAGCAGCGCGG + Exonic
997727535 5:136133732-136133754 TAGTAACAGCAGCTGAAAGGAGG - Intronic
997980707 5:138465944-138465966 CAGCAGCAGCAGCAGCAGCGGGG + Exonic
998136649 5:139677594-139677616 CAGCCACAGAAGTTGAAGGGAGG - Intronic
998322999 5:141250159-141250181 CAGCCACATCAGCAGAAGCCAGG + Intergenic
998570822 5:143255135-143255157 CAGCAACAGCAGAGAAATGGAGG - Intergenic
998641454 5:144016107-144016129 CAACAACAACAACAGAAAGGTGG + Intergenic
999772046 5:154783084-154783106 CAGCAATACCATCTGAAGGGAGG - Intronic
1000113609 5:158133017-158133039 AGGGAACAGCAGAAGAAGGGTGG + Intergenic
1000926316 5:167198840-167198862 CAGCAACAGCGGCAGGAGAAAGG + Intergenic
1001108566 5:168876307-168876329 CAGCTTCAGCAGCAGTGGGGAGG - Intronic
1001546454 5:172573570-172573592 CAGCAACAGGAGGAGAAAGAAGG - Intergenic
1002190663 5:177475812-177475834 GGGCAACAGCAGCTGAAAGGAGG - Intergenic
1002209884 5:177592285-177592307 CAGCCACAGCACCAGCAGGAGGG - Exonic
1002455906 5:179345266-179345288 CAGCAGCAGCAGCAGCAGCGCGG + Exonic
1002940213 6:1709211-1709233 CAGCAGCAGCACTACAAGGGTGG - Intronic
1003424920 6:5992660-5992682 CAGCAACCACAGAACAAGGGCGG - Intergenic
1003592890 6:7450474-7450496 CAGCAGCAGCAGCAGGAGAAAGG + Intergenic
1003870388 6:10398307-10398329 CAGCAGTAGCAGCAGCAGGAAGG + Exonic
1004421259 6:15472205-15472227 CAGAAACAGCAGTAGGAGGTGGG - Intronic
1004675864 6:17841548-17841570 AAGCAGCAGCAGCAGAGGGGTGG + Intronic
1005712866 6:28519045-28519067 TAGCAAGTGCAGCAGAAGGCAGG + Intronic
1005948313 6:30611664-30611686 GAGCAGCAGCAGAAGCAGGGAGG + Intronic
1006516648 6:34549276-34549298 CAGAGACAGGAGCAGAATGGTGG + Intronic
1007342578 6:41200976-41200998 CAGCAGCAGCAGCAGCAGGAAGG + Exonic
1007415914 6:41691074-41691096 CAGCAACAGCAGCAGCTCGGAGG - Exonic
1007576681 6:42929617-42929639 CAGCAGCAGCAGCAGCAGCAAGG - Exonic
1008383662 6:50862172-50862194 CAGCAGTAGCAGCAGAAGCAAGG + Intergenic
1008716396 6:54295097-54295119 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1008716397 6:54295100-54295122 CAGCAGCAGCAGCAGCGGGGTGG + Intergenic
1010083140 6:71886860-71886882 CAGCAGCAGCAGCAGAGCCGGGG - Intronic
1012247165 6:96938632-96938654 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1012668917 6:102015650-102015672 CAGTAGCAGCAGCAGCACGGTGG - Intronic
1012964401 6:105657686-105657708 CAGCAGGAGCAGCAGAGGGGTGG - Intergenic
1013425624 6:110010095-110010117 CAGCAACAGAAGCAAAAAGCAGG + Intergenic
1013804770 6:113985045-113985067 CAGCAACAGCAGCAGCAAATGGG - Intronic
1015320392 6:131866421-131866443 CAGCAACAGCAGAGGAAGGAAGG + Intronic
1015693715 6:135956402-135956424 GAGCATCAGCAGCAGAAGGTGGG + Intronic
1016026418 6:139291989-139292011 CAGCAACAGCAGGAGAGGGCGGG + Exonic
1016491555 6:144609920-144609942 CAGCAAAATTAGCAGAAAGGGGG + Intronic
1016548615 6:145252100-145252122 CAGCAACAGAGGCAGACGCGTGG - Intergenic
1017013322 6:150079838-150079860 CAGCAAGAGCAGCAGATGCCTGG + Intergenic
1018166079 6:161098317-161098339 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1019091061 6:169534061-169534083 CAGCAACAGCAGCAAATGGAAGG - Intronic
1019224711 6:170500398-170500420 CAGAAACAGCAGGGGCAGGGGGG - Intergenic
1019484192 7:1281141-1281163 CAGCAGCAGCAGCAGCAGCCAGG + Intergenic
1019484193 7:1281144-1281166 CAGCAGCAGCAGCAGCCAGGAGG + Intergenic
1020049471 7:5072387-5072409 CAGCAGCAGCAGCAACAGCGGGG - Exonic
1020055982 7:5117750-5117772 TAGCACCAGCAGCAGCAGGCAGG - Intergenic
1020725663 7:11810547-11810569 CAGTAACAGCAGCATTGGGGTGG - Intronic
1021131140 7:16913976-16913998 CAGTAGCAGCAGCAGCAGTGTGG - Intergenic
1021511768 7:21440881-21440903 CAACAACAGCAGCAAACAGGTGG + Intronic
1022459864 7:30594962-30594984 CGGCAGCAGCAGCAGCAGAGCGG - Exonic
1023048514 7:36231703-36231725 CAGAATCAGCAGAAGAAAGGCGG + Intronic
1024049124 7:45607396-45607418 CAACAACAGCAGGAGAAGAAGGG + Intronic
1024299531 7:47876569-47876591 CAGCAGGAGGAGCAGGAGGGAGG + Intronic
1025020205 7:55474655-55474677 CAGCAGCACCAGGACAAGGGCGG + Intronic
1026764986 7:73154820-73154842 CAGCAGCAGCAGCAGCACCGGGG + Intergenic
1026822177 7:73557258-73557280 CAGCAGCCGCAGCAGGTGGGCGG + Intronic
1027859832 7:83563489-83563511 CAGCAGCAGCAGCAGCAGCTAGG + Intronic
1028849059 7:95515833-95515855 CAGCAACAGCAGCAAAAGCAAGG - Intronic
1029110943 7:98212769-98212791 CAGCAGCAGCAGCAGGTGGCTGG + Exonic
1029399684 7:100336101-100336123 CAGCAGCAGGGTCAGAAGGGAGG + Intronic
1029506481 7:100966478-100966500 CAGCAGCAGCACCAGCAGCGCGG - Exonic
1029528246 7:101108615-101108637 CAGAAACAGCAACAGGTGGGGGG + Intergenic
1029677085 7:102077230-102077252 CAGAGAAAGCAGCAGCAGGGAGG + Intronic
1031629705 7:124032396-124032418 CAGCAGCAGCAGCAGCGGAGGGG - Exonic
1032281731 7:130508654-130508676 CTGCAACTGGAGGAGAAGGGAGG + Exonic
1033148025 7:138887864-138887886 CAGCAGCAGCAGCAGCAGTGAGG + Intronic
1033673015 7:143511272-143511294 CAGCAGCAGCAGCACCAGGCAGG + Intergenic
1034366351 7:150551805-150551827 TAGCAGCAGCAGCAGAACAGTGG - Intergenic
1034440035 7:151081666-151081688 CAGCAACAGCAGGAGCAGCAGGG + Exonic
1034485790 7:151361079-151361101 CAGCAATAAATGCAGAAGGGAGG - Intronic
1034728685 7:153364796-153364818 CAAGAACAGCACCAAAAGGGTGG + Intergenic
1034800485 7:154052685-154052707 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
1035013726 7:155744630-155744652 CAGGAATGGCAGCAGTAGGGAGG - Intronic
1035484436 7:159211704-159211726 CAGCAACTCCGGCAGAAAGGAGG - Intergenic
1035696911 8:1605018-1605040 AAGCAACAGCACCAGAAGCCAGG + Intronic
1036391459 8:8327934-8327956 GAGCAACATCAGCAGCAAGGAGG - Exonic
1036579689 8:10062230-10062252 CAGCAGCAGCAGCAGCTGGCTGG + Intronic
1036607364 8:10319322-10319344 CAGTCTCAGCAGCTGAAGGGTGG - Intronic
1037143057 8:15540507-15540529 CAGCAGCAGCAGGAGAAGGAAGG - Exonic
1037585059 8:20270425-20270447 CATCAACAGCAGCTGAGGGCAGG + Intronic
1037906387 8:22718275-22718297 CAACCCCAGCTGCAGAAGGGAGG - Intronic
1038018858 8:23536426-23536448 CAGGAACAGAGGCAGCAGGGTGG - Intronic
1038379835 8:27082261-27082283 CTGCAACAGCAACAGGAGTGAGG + Intergenic
1039443216 8:37610196-37610218 CAGCTGCAGCTGCAAAAGGGAGG + Intergenic
1039968078 8:42298349-42298371 CAGGGACAGCAACAGAGGGGTGG - Intronic
1041429136 8:57759220-57759242 CAGCAACAGTGGCAGCATGGTGG - Intergenic
1041572875 8:59357615-59357637 CAGCAACAGCAGGAGAGAGAAGG + Intergenic
1042444024 8:68862548-68862570 CGGCAGCAGCAGCAGCAGGTGGG - Intergenic
1042656020 8:71097424-71097446 AGGCAACAGCAGCAGAAATGAGG - Intergenic
1044313882 8:90727060-90727082 CAGCGGCAGCAGCAGCATGGTGG - Intronic
1044975822 8:97664445-97664467 AAGCAACAGCAACTGAAAGGTGG - Intronic
1045051966 8:98335675-98335697 CAGCCCCAGGAGCAGAAGGCTGG - Intergenic
1045544242 8:103113889-103113911 CAGCAAACACAGTAGAAGGGAGG + Intergenic
1045705479 8:104917522-104917544 CAGCAACAGCACAAGTGGGGAGG + Intronic
1045718319 8:105074905-105074927 CAGCAGCAGCAGCGGGAGGGAGG - Intronic
1045718320 8:105074908-105074930 CAGCAGCAGCAGCAGCGGGAGGG - Intronic
1046056681 8:109086655-109086677 CAGCAGGAGCAGCAGCAGTGAGG - Exonic
1047961804 8:130016514-130016536 CAGCAGCAGCAGCAGCAGCCCGG + Intronic
1048274468 8:133055852-133055874 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1048281991 8:133112490-133112512 CAGCAACACCAGAACAAGGAAGG + Intronic
1048752629 8:137697379-137697401 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1048912871 8:139152854-139152876 CAGAAACAGCAGCAGCACAGAGG - Intergenic
1048980906 8:139703132-139703154 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1048980907 8:139703135-139703157 CAGCAGCAGCAGCAGCGGGGAGG + Intergenic
1049214964 8:141403293-141403315 CAGCATCAGCAACACCAGGGAGG - Intronic
1049409027 8:142464242-142464264 CAGCAGCAGCAGTAGCAGCGGGG - Exonic
1049457302 8:142700285-142700307 CTCCAACAGCAGCACAAGGCGGG + Exonic
1049478579 8:142808232-142808254 CAGCAGCAGCAGCAGTGGGCTGG + Intergenic
1049777272 8:144412562-144412584 CAGGGACAGCAGCAGCAGGACGG + Exonic
1049802581 8:144524936-144524958 CAGCAGCAGCGGCAGCAGTGCGG + Exonic
1050112877 9:2234822-2234844 CAGCCCCTGCTGCAGAAGGGAGG - Intergenic
1050928472 9:11296463-11296485 CAGCAGCAACAGCAGCACGGTGG + Intergenic
1051266699 9:15316166-15316188 CAGCAGCAGCAGCAGCAAGTGGG - Intergenic
1051973066 9:22914156-22914178 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1052535325 9:29739055-29739077 GAGCAAAAGCACCAGAGGGGAGG - Intergenic
1053104249 9:35396815-35396837 CAGCCACAGCAGGAGAACAGGGG - Intronic
1053329498 9:37190210-37190232 CAGTGACAGCAGCAGCAGTGGGG - Intronic
1053607823 9:39679020-39679042 CTGCAGCAGCAGCAAAAAGGCGG - Intergenic
1054245712 9:62663389-62663411 CTGCAGCAGCAGCAAAAAGGCGG + Intergenic
1054559837 9:66697920-66697942 CTGCAGCAGCAGCAAAAAGGCGG + Intergenic
1054754272 9:68941400-68941422 CAACATCAGAAGCAGAAGGCAGG + Intronic
1054782032 9:69174313-69174335 CAGGAGCAGAAGCAGAAGCGGGG + Intronic
1054832870 9:69645665-69645687 CAGCAGTGGCAGGAGAAGGGTGG + Intronic
1055231761 9:74074812-74074834 CACCAACAGCTGCAGCAGTGTGG + Intergenic
1055561062 9:77522229-77522251 TAGCAACAGTAGGAGAAGGCAGG + Intronic
1055840773 9:80500456-80500478 CAGCAGCAGCAGCAGCAGTACGG - Intergenic
1056180198 9:84075622-84075644 CAGCAACAGCAGCAGCAGCAGGG - Intergenic
1056456533 9:86766163-86766185 CAGCAGCAGCTGCAGGAGGAGGG + Intergenic
1056856332 9:90132704-90132726 CAGAATCAGCAGCGGAAGGAAGG - Intergenic
1057131215 9:92655841-92655863 CCACAGCAGCTGCAGAAGGGTGG + Intronic
1057941161 9:99286157-99286179 CAGCTCCAGCTCCAGAAGGGAGG + Intergenic
1057962698 9:99471650-99471672 CATCAGCAGTAGCAGAAGGTAGG + Intergenic
1059386645 9:113969775-113969797 CAGCAACAGCAGCGGCAGCATGG - Intronic
1059424788 9:114214176-114214198 GAGCAACAGCAACAGAGGGATGG - Intronic
1060486172 9:124048178-124048200 CAGCAACACCAGAAGAAACGTGG - Intergenic
1060531585 9:124350099-124350121 CAGCAGCAGCAGCAGGAAGCTGG - Intronic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1060724296 9:125997019-125997041 CAGAAAGAGCAGTAGAAAGGAGG - Intergenic
1061035098 9:128109012-128109034 AAGCAAGGGCAGCAGAAGGCTGG - Exonic
1061396378 9:130346076-130346098 CAGCGGTAGCAGCAGAAGGCGGG + Intronic
1062084622 9:134642249-134642271 CAGCAGCAGCAGCAGCAGCGGGG - Exonic
1062156457 9:135051500-135051522 CAGCATCAGCAGCCGAGGGTAGG + Intergenic
1062403702 9:136383536-136383558 CAGCAGCAGCAGCAGCGAGGAGG - Exonic
1062403703 9:136383539-136383561 CAGCAGCAGCAGCAGCAGCGAGG - Exonic
1062584088 9:137241301-137241323 GACAAACAGCAGCAGAAGAGCGG - Exonic
1186165725 X:6824142-6824164 CAAGAACAGCAGCATAGGGGTGG - Intergenic
1186470343 X:9816579-9816601 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1186758728 X:12700935-12700957 CAGCCACAGCAGCTGCAGGGAGG - Intronic
1189104316 X:38220748-38220770 CGGCAGCAGCAGCAGCAGCGCGG + Exonic
1189926468 X:45960095-45960117 CAGTAACAGCAGCAGGGGTGGGG - Intergenic
1189992818 X:46610626-46610648 CAGCAGCAGCAGCAGGACCGAGG + Intronic
1190187747 X:48250644-48250666 CAGCAACAACAGCAAAAGGCCGG + Intronic
1190237924 X:48631671-48631693 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1190459504 X:50658259-50658281 CACCAGCACCAGCAGAAGAGTGG - Intronic
1191225741 X:58040910-58040932 CAGCAACAGTAGCAGCATGGTGG - Intergenic
1192637913 X:72837531-72837553 GAGCAAAAGAAGCAGAAGGAAGG + Intronic
1192643801 X:72883284-72883306 GAGCAAAAGAAGCAGAAGGAAGG - Intronic
1194144566 X:90246663-90246685 CAACAACTCCAGCAGAATGGAGG + Intergenic
1194179377 X:90694264-90694286 CACCAACAGCCTAAGAAGGGAGG - Intergenic
1194300645 X:92182061-92182083 CAGTAAAAGCAGCTGGAGGGAGG + Intronic
1194353299 X:92849654-92849676 CAGCTGCAGAAGCAGTAGGGAGG - Intergenic
1195963540 X:110409618-110409640 CAGCAACAACAGAAAAATGGGGG - Intronic
1195974876 X:110515721-110515743 TAGAAACAGCAGCAGAGGTGAGG - Intergenic
1196047370 X:111270388-111270410 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1196824710 X:119732019-119732041 CAGCAGGACCAGCAGAAGGAAGG + Intergenic
1197104996 X:122703134-122703156 TAGCAGCAGCAGCAGCAGGCAGG + Intergenic
1197141558 X:123122464-123122486 CAGCAGCAGCAGCAGCTTGGTGG - Intergenic
1197773597 X:130106202-130106224 CAGCAGCAGCTGGAGGAGGGAGG - Intronic
1198685685 X:139225736-139225758 CAGGAACTGCAGCAGAAGCCAGG + Intergenic
1198688452 X:139252913-139252935 CAGCAACAGAAGCAGAAACAGGG + Intergenic
1199177961 X:144814220-144814242 CAGCAAAAGCAGTAGAAAGTGGG + Intergenic
1199439131 X:147848572-147848594 CAGGAACAGCAGCAGAAAACTGG + Intergenic
1199497022 X:148464019-148464041 CATGAACAGAAGCAGAAGGAGGG - Intergenic
1199681250 X:150225960-150225982 CAGCAGCGGCAGCATTAGGGAGG + Intergenic
1200490323 Y:3815968-3815990 CAACAACTCCAGCAGAATGGAGG + Intergenic
1200526043 Y:4276437-4276459 CACCAACAGCCTAAGAAGGGAGG - Intergenic
1200661657 Y:5966727-5966749 CAGCTGCAGAAGCAGTAGGGAGG - Intergenic
1201300196 Y:12498566-12498588 CAGCAGCAGGAGCGGCAGGGAGG - Intergenic