ID: 956610604

View in Genome Browser
Species Human (GRCh38)
Location 3:71118614-71118636
Sequence ACTGGAAAGTTTCTAGTCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956610601_956610604 14 Left 956610601 3:71118577-71118599 CCAACTGACACATGGAGGTCTTC 0: 1
1: 1
2: 0
3: 12
4: 111
Right 956610604 3:71118614-71118636 ACTGGAAAGTTTCTAGTCACGGG 0: 1
1: 0
2: 1
3: 22
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956610604 Original CRISPR ACTGGAAAGTTTCTAGTCAC GGG Intronic
901149874 1:7094168-7094190 ACTTGAAAGCTTCTTGTCCCAGG + Intronic
901183618 1:7358142-7358164 ATTGGAAAGGTTGTAGTCACTGG + Intronic
909406732 1:75298663-75298685 AGTGGAAAGATTCTGGTCACAGG + Intronic
910720748 1:90283886-90283908 ACTGGACAATTTGTACTCACTGG + Intergenic
911367056 1:96951213-96951235 AGTGGAAAGTCCCTAGTCAGAGG - Intergenic
914509511 1:148318507-148318529 ACTGGAAAGTTTCTTCTTCCTGG - Intergenic
914701069 1:150134451-150134473 ACTGGCAATTTTCTAGTCCTTGG - Intronic
918669142 1:187191903-187191925 ACTGGAAAATTTTTGGTCAAAGG + Intergenic
922366893 1:224874051-224874073 AGTGGAAAGTTCCTAGTTAGAGG + Intergenic
922976411 1:229787397-229787419 GCTGGCAAGTTTCTAGTCAGAGG + Intergenic
923405842 1:233658932-233658954 ACTGTAGACTTTCTAGACACTGG + Intronic
923953762 1:238991465-238991487 ACAGGAGAGTTTCTACTCACAGG + Intergenic
924371394 1:243354523-243354545 ACTGGAAAGATTTGAGGCACTGG + Intronic
1062928953 10:1339993-1340015 ACAGGAAAGTTGATAATCACAGG - Intronic
1065234236 10:23631725-23631747 ACTTGAAATTTTCTAGTCTGAGG + Intergenic
1065429552 10:25639455-25639477 TCTGGGAAGTTTCTAGTAATAGG - Intergenic
1068901839 10:62278172-62278194 TCTGGAAAGTTGCCTGTCACTGG - Intergenic
1072353390 10:94579905-94579927 AGTCAAAAGTTTCTAGCCACTGG - Intronic
1072470921 10:95712336-95712358 ACAGCAAAGTTTATAGACACAGG - Intronic
1072890288 10:99317202-99317224 ACTGGAAATATTCCAGTCTCTGG + Intergenic
1073630784 10:105146635-105146657 AATGGATGGTTTCCAGTCACTGG - Intronic
1075217343 10:120547783-120547805 AGTGGGAAGTTCCTAGGCACTGG + Intronic
1077633921 11:3829027-3829049 ACTGGAAAGTGTTTTGGCACAGG + Intronic
1079407822 11:20160967-20160989 AATGAAAAGTTTCAAGTCAGTGG + Intergenic
1080560514 11:33458408-33458430 ACTGGATAGCTTCAAGTCATAGG + Intergenic
1083403353 11:62440053-62440075 ACTGGACAGTTCCTTGCCACGGG + Intronic
1086415438 11:86584800-86584822 AATGGGAAGTTTCTAATCAATGG + Intronic
1089087278 11:115831867-115831889 ACTGGACAGTCACTAGACACTGG + Intergenic
1090895042 11:130964489-130964511 ACGGGAAAGCTGGTAGTCACAGG + Intergenic
1091494398 12:959749-959771 ATTGGAAAGTCTCTAGTTAAAGG + Intronic
1095360153 12:41327695-41327717 ACTGGAGAGGTTGTAGTGACTGG - Intronic
1095868668 12:47001910-47001932 ACTAGAGAGTTTCCAGGCACAGG + Intergenic
1098899269 12:76096316-76096338 ACTGGAAAGGATGGAGTCACAGG - Intergenic
1100080995 12:90849947-90849969 AGTGGAAAGTTTCTAGTTACAGG - Intergenic
1101206978 12:102498383-102498405 CCTGGAAAGGTTCCATTCACTGG + Intergenic
1101257408 12:102992343-102992365 CCTGGAAAATCTCTAGCCACAGG - Intergenic
1102681665 12:114694701-114694723 ACAGGAAAGTTTCCAGGCAGTGG + Intergenic
1103297869 12:119903650-119903672 ACTGGATAGTTTGTTGTTACTGG - Intergenic
1108246669 13:48522329-48522351 ATTGGAAAGTTCCAAATCACGGG + Exonic
1109338197 13:61019792-61019814 ACTAATAACTTTCTAGTCACTGG - Intergenic
1110388776 13:74946628-74946650 AGTGGAAAGTTTGTAGCAACAGG + Intergenic
1111726825 13:92021478-92021500 ACTGGGAAGGTTCTAATCAGTGG + Intronic
1119139626 14:72254633-72254655 TCTAGAAAGTTCCTATTCACAGG + Intronic
1119521757 14:75291592-75291614 ACTGGAGAGGTTCTTGTCGCAGG - Intergenic
1120315948 14:82893260-82893282 AGTGGAAAGTTCCTAGTTAGAGG - Intergenic
1202829812 14_GL000009v2_random:15456-15478 ACTGGAAAATAAGTAGTCACAGG + Intergenic
1124094892 15:26640178-26640200 ACTGGAAAGTTTGCATTCAGTGG - Intronic
1125407970 15:39372596-39372618 TCTCGAAAGTTTCTAGTCATTGG - Intergenic
1127049023 15:55060729-55060751 ACTCGCAAGTTTCTGTTCACTGG - Intergenic
1127277894 15:57463507-57463529 AATGGACAGTTTCCAGGCACCGG + Intronic
1127559120 15:60118329-60118351 ACTGGAAAGTCACAAATCACTGG + Intergenic
1131863289 15:96677609-96677631 ATTGGCAAGTTTTAAGTCACTGG - Intergenic
1132119765 15:99166742-99166764 CCTGGTAGGTCTCTAGTCACAGG + Intronic
1134287197 16:12872166-12872188 ACTGAAATGTTTCTGTTCACTGG - Intergenic
1134432060 16:14218972-14218994 GCTGGAGTGTTTGTAGTCACAGG - Exonic
1137357770 16:47783147-47783169 AATGGAAATTTTCAAGTCAAGGG - Intergenic
1141917308 16:87108189-87108211 ACAGCAAAGTTTCTAGTGTCGGG - Intronic
1144458617 17:15439446-15439468 GCTGGGAAGTTTCTAGTGAGAGG - Intronic
1149325729 17:55528003-55528025 TCTGGAAAACTCCTAGTCACTGG + Intergenic
1149785158 17:59428513-59428535 ACTGGGATTTTTCTAATCACAGG - Intergenic
1153213945 18:2799815-2799837 CCTGCACAGTTACTAGTCACTGG - Intronic
1154930431 18:20989223-20989245 ACTGAAAACTTTCTATGCACAGG + Intronic
1154962816 18:21327302-21327324 ACTGGGAAGTTTCTAGTTTGAGG - Intronic
1157283249 18:46359906-46359928 AATGGACAGATTTTAGTCACAGG + Intronic
1157421099 18:47548121-47548143 AGTGGAAAGCTTCTAGTTAGAGG + Intergenic
1157885883 18:51365839-51365861 TCTGGAAGGTTCCTAGGCACGGG - Intergenic
1158387835 18:57014822-57014844 AAAGGAAAGGTTATAGTCACTGG + Intronic
1162171781 19:8795541-8795563 ATTGGAATGTTTCTGGTCAAAGG - Intergenic
1202642876 1_KI270706v1_random:112330-112352 ACTGGAAAATAAGTAGTCACGGG - Intergenic
925160574 2:1680914-1680936 CCTGGAAAGTTTCTAGTGAGTGG + Intronic
925352543 2:3211595-3211617 ATTGGAAAGTTTCTAATCAGAGG - Intronic
927477209 2:23423138-23423160 CCTGGGAAGTTCCTGGTCACAGG + Intronic
928625219 2:33133040-33133062 ACTTGAAAATCTCTAGTGACGGG - Intronic
930827633 2:55710339-55710361 AGTGGAAAGTTCCTAGTTAGAGG + Intergenic
933145022 2:78841427-78841449 ACTGGAAAGGTACAAGTAACTGG + Intergenic
935862283 2:107346071-107346093 ACATGAAAGTTTCTATACACTGG - Intergenic
936848133 2:116862595-116862617 AGTGGAAAGTTTTTAGACCCAGG + Intergenic
937578152 2:123449692-123449714 AGTGCAAAGTTTCCAGTCATAGG - Intergenic
939761554 2:146188213-146188235 AGTGGAGAGTTTCTATTCAATGG + Intergenic
940904599 2:159157606-159157628 TTTGGAAAGTTCTTAGTCACAGG + Intronic
941557426 2:166998739-166998761 AGTGGAAAGTCACTAGTCAAAGG - Intronic
942192088 2:173480381-173480403 AATGGAGAGTTTCTATTCAATGG + Intergenic
942608874 2:177720572-177720594 GCTGGAAAGGTTCTGGTCTCTGG - Intronic
944218870 2:197282382-197282404 ACTGAGAAGTTTATAGTAACAGG + Intronic
948198255 2:236111206-236111228 ACTGCAGTGTTTCCAGTCACTGG + Intronic
1170001304 20:11617724-11617746 ACTAGAAAATTGCTAGTCCCGGG - Intergenic
1170146403 20:13179944-13179966 ACTGGAGAGTTTGTAGTCTATGG + Intergenic
1174836223 20:53857915-53857937 GCTGGAAAGTTTCTGGGCAGGGG - Intergenic
1174849396 20:53977550-53977572 ACCAGAAACTTTCTAGACACAGG - Intronic
1175208057 20:57327143-57327165 ACAGAAATGTTTCTAGTCCCAGG + Intergenic
1175842345 20:62037039-62037061 ACTGGGAGGCTTCTAGACACCGG - Intronic
1176360192 21:5988796-5988818 GCTGGAAGGTCTCAAGTCACAGG - Intergenic
1176609001 21:8860296-8860318 ACTGGAAAATAAGTAGTCACAGG + Intergenic
1179763326 21:43549754-43549776 GCTGGAAGGTCTCAAGTCACAGG + Intronic
1180359091 22:11870128-11870150 ACTGGAAAATAAGTAGTCACAGG + Intergenic
1182193935 22:28494531-28494553 AGTGGAAAGTCTCTAGTGAGGGG - Intronic
949758080 3:7436775-7436797 ACTGCAAAGTTCATAGGCACAGG - Intronic
956610604 3:71118614-71118636 ACTGGAAAGTTTCTAGTCACGGG + Intronic
957471620 3:80666326-80666348 ACTTGAAAGTTTCTGCTCAGAGG - Intergenic
958066248 3:88547262-88547284 TCTAGAAATATTCTAGTCACTGG + Intergenic
959402794 3:105923221-105923243 CCTGGAAACTTTCTAGTTCCTGG + Intergenic
963811767 3:149784439-149784461 ACAGGAAAGTCTCTAGGCAATGG + Intronic
965368237 3:167826101-167826123 ACTGGAAAATGGCAAGTCACGGG + Intergenic
966045355 3:175542238-175542260 ACTAAGAAGTTTCTAGACACAGG + Intronic
967720697 3:192813102-192813124 ACAGAAAAGTTACAAGTCACTGG - Intronic
967735189 3:192944178-192944200 TCTTGAAAGTTTCTGGTCAGGGG + Intergenic
968778504 4:2560726-2560748 AGTGGAAAGATTCAAGACACAGG - Intronic
970945903 4:21691344-21691366 TCTGGAAGCTTTCTAGACACAGG + Intronic
973816874 4:54627194-54627216 ACTGGAAGGGTGCTAGGCACAGG + Intergenic
975592302 4:76012054-76012076 ACTGGAATTTTTCAAGGCACAGG - Intronic
975800811 4:78057675-78057697 GCCGGAAAGTTGCTGGTCACTGG - Exonic
976498295 4:85756599-85756621 ACTGAAATGTTTCAAGTCATTGG - Intronic
977517980 4:98046069-98046091 ATTGGAAATTTTCTAATCAAAGG - Intronic
978498067 4:109381044-109381066 GCTGGAAAGCTGCCAGTCACAGG + Intergenic
979353701 4:119676696-119676718 ACTGGAAAATTTTTACTCACTGG - Intergenic
982403400 4:154993772-154993794 AATGCAGAGATTCTAGTCACTGG - Intergenic
1202770246 4_GL000008v2_random:198224-198246 ACTGGAAAATAAGTAGTCACAGG - Intergenic
987125896 5:14812458-14812480 ACTGGAAAATATGTAGTTACGGG - Intronic
987240377 5:15992203-15992225 ATTTGAAAGTATCTAGTCAGTGG - Intergenic
987699057 5:21371631-21371653 CCTGGAAAGGTTCTAGACACAGG - Intergenic
988355694 5:30171270-30171292 AGAGGAAAATTTCTATTCACAGG - Intergenic
988753596 5:34219846-34219868 CCTGGAAAGGTTCTAGACACAGG + Intergenic
989427165 5:41309599-41309621 ACTGGAAAGTTGGAAGTCTCAGG - Exonic
989794650 5:45452375-45452397 ACAGGAAAATTGCAAGTCACAGG + Intronic
991524327 5:67539677-67539699 TCTGGAAAGTATTTAGACACAGG + Intergenic
991741381 5:69680695-69680717 CCTGGAAAGGTTCTAGACACAGG + Intergenic
991756237 5:69873746-69873768 CCTGGAAAGGTTCTAGACACAGG - Intergenic
991792955 5:70260433-70260455 CCTGGAAAGGTTCTAGACACAGG + Intergenic
991820840 5:70556769-70556791 CCTGGAAAGGTTCTAGACACAGG + Intergenic
991835640 5:70749659-70749681 CCTGGAAAGGTTCTAGACACAGG - Intergenic
991885404 5:71260740-71260762 CCTGGAAAGGTTCTAGACACAGG + Intergenic
994473863 5:100242546-100242568 ACAGCATAGTTTCTAGTCTCTGG - Intergenic
994624473 5:102201057-102201079 ATTGGCATGTTTCTGGTCACAGG + Intergenic
996307762 5:122069454-122069476 ACTGGAAGATATCTATTCACAGG - Intronic
997922717 5:137998000-137998022 AGTGGAAAGTTCCTAGTTAGAGG - Intronic
999802419 5:155050277-155050299 AGTGGAAAGTCTCTAGTTAGAGG - Intergenic
1005551765 6:26926667-26926689 CCTGGAAAGGTTCTAGACACAGG + Intergenic
1005731748 6:28704151-28704173 ACAGGAAAGTTTGGAGACACAGG - Intergenic
1005758274 6:28944989-28945011 ACTGGCAAGTTTCTTGACTCTGG - Intergenic
1006342631 6:33454922-33454944 ACTGGAAACTTTTAAGTCAGTGG - Intronic
1008681923 6:53881555-53881577 ACTGGAATATTTATAATCACTGG - Intronic
1009477187 6:64107867-64107889 ACTGGTAAGTTCCTAGTCTGAGG - Intronic
1009498360 6:64378951-64378973 ACTGAACAGTATCTAGTTACAGG - Intronic
1009650797 6:66475690-66475712 ACTGGGAAGTTTCTAATGACAGG - Intergenic
1011223577 6:85083384-85083406 AGTGGAAAGTTATTACTCACTGG + Intergenic
1014492202 6:122076226-122076248 TCTGAAAAGCTTCTACTCACTGG + Intergenic
1019975412 7:4577342-4577364 ACTGGAAATTCTCTGGTCAAGGG - Intergenic
1020456250 7:8376558-8376580 AATGGAATTTTTCTAGTCTCGGG + Intergenic
1024361212 7:48470659-48470681 AATGGCAAGTTTCTTTTCACTGG + Intronic
1025223031 7:57132485-57132507 ATTGGACAGTTTCTAGTCCACGG + Intronic
1026572646 7:71545022-71545044 ATTGGCAAGTTTCTAGTGGCTGG + Intronic
1028877495 7:95840283-95840305 ACTGGAAATCCTCTAGTCAGAGG - Intronic
1028881646 7:95886998-95887020 CCTGGAAAGTTTTTAGGCAGGGG - Intronic
1030062253 7:105631822-105631844 ACTGGAGAGATTCTAGACACGGG + Intronic
1030340406 7:108373203-108373225 AATGGAAAATTACTAGTCATTGG + Intronic
1034738404 7:153450752-153450774 ACTGGAAAATTTGTAGTGAAAGG + Intergenic
1036449278 8:8851591-8851613 ACTGTAAACTTTCTAGTCCCTGG - Intronic
1037302538 8:17467871-17467893 ATTTGAAATTTTCTAGTCAGAGG - Intergenic
1042110277 8:65374305-65374327 ACTGGAAAGTTGCTAATATCTGG + Intergenic
1042991583 8:74646351-74646373 ACAGGAAAGTTTTAAGACACAGG + Intronic
1043421516 8:80103327-80103349 AGTGGAAAGTTTCTAGTTAGAGG - Intronic
1044052063 8:87517160-87517182 ACTGGAAAATATCAAGTAACAGG - Intronic
1046268693 8:111864859-111864881 ATTGGAATGTTTCTGGTCAGAGG - Intergenic
1052064684 9:24003395-24003417 AGTGCCAAGTCTCTAGTCACAGG - Intergenic
1053658417 9:40244744-40244766 ACTGGAAAATTAGTAGTGACAGG + Intronic
1053806402 9:41806509-41806531 TATGGAAATTTTTTAGTCACTGG - Intergenic
1053908791 9:42874018-42874040 ACTGGAAAATTAGTAGTGACAGG + Intergenic
1054370538 9:64391015-64391037 ACTGGAAAATTAGTAGTGACAGG + Intronic
1054526181 9:66131477-66131499 ACTGGAAAATTAGTAGTGACAGG - Intronic
1054678168 9:67880774-67880796 ACTGGAAAATTAGTAGTGACAGG + Intronic
1058008105 9:99941283-99941305 ACTGTAAAGTTTCTAAGAACGGG - Intronic
1058495297 9:105552951-105552973 ACTGGATAGTCTTGAGTCACAGG + Intergenic
1060610783 9:124962707-124962729 TCTGTAAGGTTTCTAGTTACTGG - Intronic
1186623314 X:11264417-11264439 ACTGGAAAGGTTCTTTCCACTGG - Intronic
1187601366 X:20835006-20835028 ACAACAAAATTTCTAGTCACAGG - Intergenic
1188508507 X:30909046-30909068 ACTGGCATATTTATAGTCACAGG + Intronic
1188832524 X:34917466-34917488 TCTGGAATGTTTCTCATCACTGG + Intergenic
1190113302 X:47609264-47609286 ACTGGGAATTGTCTTGTCACAGG + Intronic
1192120977 X:68455348-68455370 AGTGGAAAGTTTCTAGTTAGAGG + Intergenic
1193016540 X:76739993-76740015 ATTTGAAAGTTTTTAGTCAGAGG + Intergenic
1194146472 X:90271490-90271512 ATGGGCAAGTTTCTAGGCACTGG - Intergenic
1194160688 X:90448316-90448338 TCTGGAGAGTATCTAGACACAGG + Intergenic
1194943022 X:100035357-100035379 AATGGAAAGTTTCCAAACACAGG - Intergenic
1195768814 X:108326825-108326847 ACTGGAAATTTTAAAGTCTCAGG - Intronic
1196088674 X:111714832-111714854 AATGGAAAGTTTTTAGGCAAAGG + Intronic
1197080179 X:122403371-122403393 ACTGCAAAATTTCTAGCCATTGG - Intergenic
1197589470 X:128390563-128390585 AAGAGAAAGTTACTAGTCACAGG - Intergenic
1198144938 X:133845753-133845775 CCTGGAAAGTTTGTAATCAGCGG - Intronic
1199417727 X:147605364-147605386 ACTGGAAAGTCTTTGGTGACAGG - Intergenic
1200492211 Y:3840669-3840691 ATGGGCAAGTTTCTAGGCACTGG - Intergenic
1200506979 Y:4025244-4025266 TCTGGAGAGTATCTAGACACAGG + Intergenic
1201638066 Y:16147375-16147397 ACTGGATAGCTTATATTCACAGG + Intergenic