ID: 956611486

View in Genome Browser
Species Human (GRCh38)
Location 3:71128010-71128032
Sequence CCTTATATAGTCAAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956611480_956611486 -6 Left 956611480 3:71127993-71128015 CCTCTGCTGCACCGTTCCCTTAT 0: 1
1: 0
2: 0
3: 10
4: 761
Right 956611486 3:71128010-71128032 CCTTATATAGTCAAGGAAGAGGG 0: 1
1: 0
2: 0
3: 10
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956611486 Original CRISPR CCTTATATAGTCAAGGAAGA GGG Intronic
904568492 1:31442959-31442981 CCTTTTACAGACAAGGAAGCTGG - Intergenic
904644550 1:31956025-31956047 CATTAGATATTGAAGGAAGAAGG - Intergenic
906734003 1:48106997-48107019 CTTGAAAAAGTCAAGGAAGATGG - Intergenic
907526771 1:55058281-55058303 CCTTACACAGACAAGGGAGAAGG - Intronic
918495890 1:185135473-185135495 TCTTATCTAGTCAAGAAAAATGG + Intronic
919507565 1:198418732-198418754 CATTATATAGTTAAGGAAACTGG + Intergenic
921568648 1:216751678-216751700 CCTGATAAAGTCAAGGGAAAAGG + Intronic
922997489 1:229976138-229976160 CCTGATAAAATCAAGAAAGAAGG + Intergenic
923794761 1:237142995-237143017 CCTTCTTTTTTCAAGGAAGAAGG - Intronic
1063067905 10:2627552-2627574 TCATATTTAGACAAGGAAGATGG - Intergenic
1066539198 10:36426339-36426361 CCAAGTATTGTCAAGGAAGAAGG - Intergenic
1066962984 10:42237092-42237114 TCTTTTGTAGTCAAAGAAGATGG - Intergenic
1069161178 10:65094132-65094154 CCCTAGATGGTCAAGTAAGATGG + Intergenic
1071118052 10:82246904-82246926 TCTTATGTAGCCAAGGCAGAGGG - Intronic
1072931066 10:99662798-99662820 GCTTATATAGTACAGGGAGATGG + Intronic
1074103582 10:110373033-110373055 CCATATAAAGTAAAGGAGGAAGG + Intergenic
1075655655 10:124159418-124159440 GCTTATATATTAAAGGAAGAGGG - Intergenic
1077711353 11:4540469-4540491 GCTAATATAGTCAGGGAAGGGGG - Intergenic
1078543431 11:12229276-12229298 CCTTAGCTGGGCAAGGAAGATGG + Intronic
1081495512 11:43606094-43606116 CCTAAAATATTCAAGGTAGAAGG + Intronic
1083873140 11:65504076-65504098 CCTTATATAGGGAAGGGAGGGGG + Intergenic
1085216151 11:74834613-74834635 CCATATATAGGTAAGGAAAAAGG - Intronic
1086155367 11:83659644-83659666 CATGATATAGACAAGGAAGCTGG + Intronic
1088096562 11:106107595-106107617 CCTAGTATATTCAAGGAACAGGG - Intergenic
1088931897 11:114360248-114360270 CCTTATATATTCTCAGAAGAGGG - Intergenic
1093865764 12:24225781-24225803 TCTTATATATTCTGGGAAGAGGG - Intergenic
1095073804 12:37892629-37892651 CCTTTTATAGTCAAAGAAAGGGG + Intergenic
1096284784 12:50289715-50289737 CTTTATATACTAAAAGAAGAAGG - Intergenic
1097583938 12:61492671-61492693 CCTTATAAAATAAAGGAAGGAGG + Intergenic
1098251212 12:68571403-68571425 CATAATATAATCAAGGCAGAGGG - Intergenic
1098313055 12:69166576-69166598 CCTTATAGAGTCAAAACAGAGGG - Intergenic
1102731263 12:115112731-115112753 CCTTATAAAGAAAAGGCAGAAGG - Intergenic
1102981379 12:117244105-117244127 TCTTAAATATTAAAGGAAGATGG - Intronic
1103247368 12:119469558-119469580 TCTTATAAAATCAAGGAAGTAGG - Intronic
1104263844 12:127212168-127212190 ACTTATAATTTCAAGGAAGAAGG + Intergenic
1104271823 12:127289163-127289185 CCTTATAAACTCATGGCAGATGG - Intergenic
1107338346 13:39379839-39379861 CCTTCTATATGCAAGGCAGAGGG + Intronic
1110789782 13:79575218-79575240 CATTATCTAGTCTAGGAAGGTGG - Intergenic
1112270774 13:97967475-97967497 CCTTAGATACTAAAGAAAGAAGG - Intronic
1115302998 14:31904864-31904886 CATTTTATAGTCAAGGAAAGTGG - Intergenic
1116366425 14:44071249-44071271 CAGTATATAGACAAGGAACAGGG - Intergenic
1119139217 14:72250326-72250348 TCTTACAAATTCAAGGAAGAAGG - Intronic
1120253004 14:82082864-82082886 CCTTAAATAGACAAGGAACTTGG - Intergenic
1125383007 15:39107429-39107451 TCATATACAGACAAGGAAGATGG - Intergenic
1126835063 15:52653933-52653955 CCTTATTTAAACAATGAAGATGG - Intronic
1128414283 15:67429968-67429990 CATTTTGTAATCAAGGAAGAAGG + Intronic
1128787006 15:70405045-70405067 CCCTATATAAACCAGGAAGAGGG + Intergenic
1133705031 16:8346319-8346341 CCTGATAGTGTCAAGGGAGAGGG + Intergenic
1136354721 16:29736854-29736876 ACTTATACAGTCATGGCAGAAGG + Intergenic
1137031876 16:35531948-35531970 CCTTATTCAGCCCAGGAAGAGGG - Intergenic
1137754984 16:50894042-50894064 CCAAATAAAGTCAAGGAAGCTGG - Intergenic
1138208911 16:55146538-55146560 CATTTTATAGACAAGGAAGCAGG + Intergenic
1140967933 16:79985237-79985259 CCTTATATTGTGAAGGAGAATGG + Intergenic
1144052466 17:11508689-11508711 AATTGTATAGCCAAGGAAGAAGG - Intronic
1149210437 17:54294381-54294403 CCTTCTCTACTCTAGGAAGAAGG - Intergenic
1149958188 17:61077196-61077218 CATTATAAAGTCAAAGAAGTGGG - Intronic
1150123354 17:62621123-62621145 CCTTAAAAAGTCAATGAAGCCGG - Intergenic
1150956022 17:69861512-69861534 GCTTAAATATTCAAGGAAAATGG + Intergenic
1151093019 17:71464041-71464063 CCTTGTATGGGCGAGGAAGATGG + Intergenic
1154416031 18:14175693-14175715 TCTTTTGTAGTCAAAGAAGATGG - Intergenic
1157267956 18:46245230-46245252 CCTTAAAAAGTGAAGGAAGAGGG - Intronic
1158267731 18:55678640-55678662 CTTTTTATAGATAAGGAAGAGGG - Intergenic
1159127789 18:64245326-64245348 CCTTATTCATTCCAGGAAGAAGG + Intergenic
1159529783 18:69640730-69640752 CCTTATATGGTCTTGGAAAAAGG - Intronic
1164423524 19:28119142-28119164 GCTTATATGGTTAAGGAAGATGG - Intergenic
1167376146 19:49113285-49113307 CCTTATATAGCCAAGCACCAAGG + Intergenic
1167770368 19:51511082-51511104 CCTTAGAAAGATAAGGAAGATGG - Intergenic
925475882 2:4214456-4214478 CATTATGGAGTCAAGGAAGAGGG + Intergenic
926392609 2:12409127-12409149 CCTTTTAGAGTTATGGAAGATGG + Intergenic
926811557 2:16759405-16759427 CCTCATATGGACAAGGCAGATGG - Intergenic
926878088 2:17507959-17507981 CCTTATTTAGTTAAGCAAAATGG - Intergenic
926936608 2:18092196-18092218 CCTTCTATAAACCAGGAAGAGGG - Intronic
930846426 2:55909888-55909910 CTTAATAGAGTCAAGGTAGAAGG - Intronic
935423052 2:102890382-102890404 TCTTATAGAGTTAAGGAAGAGGG - Intergenic
937371496 2:121300924-121300946 CATTTTATAGCAAAGGAAGATGG + Intergenic
937622520 2:124005119-124005141 TCTAATATAGTCAAGGATGTTGG + Intergenic
939638497 2:144611405-144611427 CCTTATGTAGAGAAGGAAAAGGG - Intergenic
944487796 2:200224948-200224970 CCTTATATAGAAGAGGAGGACGG - Intergenic
946795612 2:223348419-223348441 TCTTATAAACTCAAGGAAAAGGG + Intergenic
947136850 2:226984351-226984373 CCATCTATAATCCAGGAAGAGGG - Intronic
947862399 2:233369950-233369972 CCTTATAGAATGATGGAAGAGGG + Intronic
948689384 2:239692275-239692297 CCTTATTTATTCAGGGAATAGGG - Intergenic
1169636184 20:7694469-7694491 CATTATATATTGAAGGAAAATGG + Intergenic
1172217605 20:33247433-33247455 CCTTATAGGGTTAAGGAAGAGGG - Intergenic
1173000791 20:39104208-39104230 CATTTTATAGGCAAGGAAGCTGG + Intergenic
1175481078 20:59311478-59311500 CCCTATATGGTCTAGGAAGGGGG - Intronic
1176857313 21:13983601-13983623 TCTTTTGTAGTCAAAGAAGATGG + Intergenic
1176867299 21:14060625-14060647 TCTTTTGTAGTCAAAGAAGATGG - Intergenic
1177757656 21:25367320-25367342 CCTTTCTTATTCAAGGAAGAGGG - Intergenic
1180548729 22:16525937-16525959 TCCTTTATAGTCAAAGAAGATGG + Intergenic
1182603379 22:31484942-31484964 CAGTACATAGACAAGGAAGAAGG + Intronic
1182784792 22:32898375-32898397 CCTTACATAGACAAGGAAACTGG - Intronic
1183463700 22:37968413-37968435 TCTTATAGAGGCTAGGAAGAAGG - Exonic
949645721 3:6091606-6091628 TCTTATATAAGCAAGGAATAAGG - Intergenic
949754818 3:7396981-7397003 CCTTGAACATTCAAGGAAGATGG + Intronic
951152383 3:19306713-19306735 CATTTTATTGGCAAGGAAGATGG - Intronic
952733562 3:36665443-36665465 CCTTATAAAGAAAAGGAAGCAGG + Intergenic
952900882 3:38111157-38111179 CCTAATCTAGTGAAGCAAGAGGG + Intronic
956527209 3:70178310-70178332 ATTTATATATTCCAGGAAGAGGG - Intergenic
956575825 3:70751955-70751977 CACGATATATTCAAGGAAGAAGG + Intergenic
956611486 3:71128010-71128032 CCTTATATAGTCAAGGAAGAGGG + Intronic
956994125 3:74804378-74804400 ACTTATATAGGCAAGGCATATGG + Intergenic
957717368 3:83946091-83946113 CCTTATATAGAGAGGTAAGATGG + Intergenic
958027079 3:88060225-88060247 CATTATATATTGAAGGATGAGGG - Intronic
958916619 3:100057373-100057395 CATTATATCATCAAGGAAAAAGG + Intronic
960397611 3:117156402-117156424 CATTATATATTCAAAGATGAAGG + Intergenic
961161382 3:124729651-124729673 CCTTATATACACAATGGAGAAGG + Intergenic
963392594 3:144686341-144686363 AGTAATATAGTAAAGGAAGAGGG - Intergenic
963430437 3:145194827-145194849 TACTATATAGTGAAGGAAGAGGG - Intergenic
963896377 3:150689245-150689267 CCTTCTATTGTCATGGAAGCAGG - Intronic
964097008 3:152943708-152943730 CCTTATATAGGCAAGTACAAGGG + Intergenic
970007092 4:11421912-11421934 CCTTAAATAGCAAATGAAGATGG + Intronic
973066064 4:45794766-45794788 CCTTGTATGATCAAGGTAGATGG - Intergenic
973899586 4:55454757-55454779 GACTTTATAGTCAAGGAAGATGG - Intronic
975233141 4:71958241-71958263 CTTTAAATATTCAAGGAAAACGG - Intergenic
975800315 4:78054830-78054852 CCCTAAGTAGTCAAGGGAGAAGG - Intergenic
976145189 4:82035686-82035708 TCTAAGATAGTCAAAGAAGAGGG + Intronic
976667591 4:87613417-87613439 CCTTAAATAGTCAAGTAATATGG - Intronic
977747879 4:100572961-100572983 GATTATAAAGTCAAGGAAGCAGG - Intronic
978156352 4:105493332-105493354 CCTTATATAGTAAATGATGCTGG - Intergenic
979977517 4:127214946-127214968 CCTTGGAAAGTCAAGGAAGGAGG + Intergenic
980198188 4:129618978-129619000 CCTTATAGCGCCAAGGCAGAGGG + Intergenic
981393050 4:144214993-144215015 CCTTATATTTTCAAAGATGAAGG + Intergenic
983291115 4:165807136-165807158 CCTTATCTATTCTAGGAAAAAGG + Intergenic
987537207 5:19204665-19204687 CCCTTTATTATCAAGGAAGAGGG + Intergenic
988805285 5:34734321-34734343 TCTGATATAGTCTAGGAAGCTGG + Intronic
990156564 5:52884618-52884640 GCATTTATAGTCAAGGAACAGGG + Intronic
993583746 5:89697582-89697604 GCTTCTATATTCAAGAAAGAAGG + Intergenic
993921193 5:93805298-93805320 CTTTATATAGTGAAGGAGCAAGG - Intronic
994385652 5:99128353-99128375 CCTCATACAATCAAGGCAGACGG - Intergenic
994496543 5:100520176-100520198 CCTTATAGAGTCAAAGTAAATGG + Intergenic
995481684 5:112599273-112599295 CTTTATCTAGTCAGGGAAGCAGG + Intergenic
995837663 5:116414475-116414497 CCATATAAAGTCAAGACAGAAGG - Intergenic
996182436 5:120436146-120436168 CCTTGTATATTCTAGGAAGGTGG - Intergenic
996683054 5:126249230-126249252 CATTACATAGACAAGGGAGAGGG - Intergenic
997425986 5:133802999-133803021 CTTCATATAGTCAGGGAAAATGG - Intergenic
999735849 5:154512292-154512314 CCCTATAGATTCAGGGAAGAGGG + Intergenic
999830402 5:155313505-155313527 CTTCATATAGTCAGGAAAGATGG + Intergenic
1003669763 6:8145894-8145916 CCTTTTCTAGACAAGGTAGAGGG + Intergenic
1003904386 6:10685645-10685667 TCTTATGCAGTCAAGCAAGAGGG + Intronic
1004100706 6:12607570-12607592 CGTGATATAGTTAATGAAGATGG + Intergenic
1004957548 6:20746546-20746568 CCTTACATAGTAATGGAGGAGGG - Intronic
1004970370 6:20903494-20903516 CCTTATATATTTACCGAAGAAGG + Intronic
1009061560 6:58402711-58402733 CCATATACATTCAAGGAAAAAGG + Intergenic
1009630024 6:66185313-66185335 CATTATATGGCCAAGGAAAAAGG - Intergenic
1010281754 6:74030570-74030592 CCTTATCTAGTCAAAGAAAGGGG - Intergenic
1015101867 6:129491002-129491024 CTTTATAAAGTCAAGTAAGAGGG + Intronic
1016282171 6:142430855-142430877 GCAAATATAGTGAAGGAAGATGG - Intronic
1020539606 7:9443630-9443652 CCTTATGTAGTAAGTGAAGATGG - Intergenic
1022677749 7:32515516-32515538 CCTTCTATTGTCATGGAAGCAGG - Intronic
1029494068 7:100887890-100887912 CCCTGGGTAGTCAAGGAAGAGGG - Intronic
1032066356 7:128774467-128774489 CATTTGATAGTCAGGGAAGAAGG - Intronic
1033105777 7:138521361-138521383 CCATGCATAGTCTAGGAAGAGGG + Intronic
1033358898 7:140623873-140623895 CCTTATATTGACATGGATGAAGG + Intronic
1035544282 8:467725-467747 CCTTGAATAGTAAAGCAAGATGG - Exonic
1036530123 8:9577519-9577541 TCTTATATGGTCAGGGAAGGAGG + Intronic
1036674504 8:10818839-10818861 ACTGAGAGAGTCAAGGAAGAGGG + Intronic
1038493139 8:27984003-27984025 CTTTATTTAGTAAATGAAGACGG - Intronic
1040115729 8:43616606-43616628 CCTTATAAAAACAAGAAAGAAGG + Intergenic
1041313047 8:56535974-56535996 ACTTTTATTGCCAAGGAAGAAGG - Intergenic
1043150632 8:76711024-76711046 CCTTTTATATTTAAGGTAGAAGG + Intronic
1043204821 8:77424956-77424978 CCTAATATAATCAAGAAAGTTGG - Intergenic
1043338507 8:79207420-79207442 CGTTATTTATTCAAGGAAGTAGG + Intergenic
1043861262 8:85319907-85319929 TCTTACAAAGTCAAGGTAGATGG + Intergenic
1046631468 8:116626510-116626532 GCTGCTAGAGTCAAGGAAGAAGG - Intergenic
1047080177 8:121451727-121451749 CCTTGAACATTCAAGGAAGAAGG - Intergenic
1047223245 8:122935973-122935995 CCTTAGATACTCAGGGAATAAGG - Intronic
1047550885 8:125871135-125871157 CCTTTGATGGTCAAGGAAGCTGG + Intergenic
1050321931 9:4461259-4461281 CCTTATATACTCCAGAAAGATGG + Intergenic
1050685649 9:8165607-8165629 CCTTATAAAGAAAAGGTAGATGG - Intergenic
1051094985 9:13456340-13456362 CCTTACATAGTCAAGATATAAGG - Intergenic
1051168229 9:14288954-14288976 CATCATATAGTCAAAGAAGTAGG - Intronic
1052051496 9:23853440-23853462 CTTTATTTAGTCAGGGAAAATGG + Intergenic
1052995228 9:34548293-34548315 ACTGATAGAGTCAGGGAAGAGGG + Intergenic
1053826274 9:42028021-42028043 CCTTCTGTACTAAAGGAAGATGG + Intronic
1054604286 9:67159376-67159398 CCTTCTGTACTAAAGGAAGATGG - Intergenic
1055528644 9:77160605-77160627 CCTAAAAATGTCAAGGAAGATGG + Intergenic
1055719418 9:79155095-79155117 CCTTCTATTCTCAAAGAAGAGGG - Intergenic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1058497403 9:105574533-105574555 CCGTTTTTAGTCAAGGAACATGG - Intronic
1187798043 X:23025989-23026011 TCTTTTAGTGTCAAGGAAGAAGG - Intergenic
1189495543 X:41505163-41505185 CTTTACATTGTCAAGGGAGAAGG - Intergenic
1189544505 X:42027586-42027608 CCTTGTAGAGCCAAGGAAGAGGG + Intergenic
1193319747 X:80107329-80107351 CCTTATAGGATTAAGGAAGAGGG + Intergenic
1193426575 X:81347377-81347399 CCTTATAAGGGTAAGGAAGAGGG - Intergenic
1194957777 X:100201077-100201099 CCATATATATACAAGGAAGCTGG + Intergenic
1195097905 X:101523820-101523842 CTTTATAAAGTCAAGTAAGTAGG - Intronic
1197042621 X:121957849-121957871 CCTTCTATTGTCATGGAAGCAGG - Intergenic
1200632061 Y:5600794-5600816 CATAATATAGTAAGGGAAGATGG + Intronic
1201334032 Y:12859885-12859907 CCTTATATATCCAGGAAAGAAGG - Exonic
1202388589 Y:24347757-24347779 CCATATATATTCATGGAAGTGGG - Intergenic
1202482198 Y:25322371-25322393 CCATATATATTCATGGAAGTGGG + Intergenic