ID: 956612327

View in Genome Browser
Species Human (GRCh38)
Location 3:71136669-71136691
Sequence CAGCAAAAAACAGTTGTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 1, 2: 0, 3: 23, 4: 360}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956612327_956612329 9 Left 956612327 3:71136669-71136691 CCATCAACAACTGTTTTTTGCTG 0: 1
1: 1
2: 0
3: 23
4: 360
Right 956612329 3:71136701-71136723 TGACTGAACATTATGAGAGCAGG 0: 1
1: 0
2: 1
3: 7
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956612327 Original CRISPR CAGCAAAAAACAGTTGTTGA TGG (reversed) Intronic
901102478 1:6729673-6729695 CAGCAAAAAACACTTTGTGCTGG - Intergenic
901171570 1:7262206-7262228 CAGCAAAACTCACTTGTTCATGG - Intronic
902105569 1:14033066-14033088 CACAAAAAGACATTTGTTGAAGG + Intergenic
902273013 1:15318162-15318184 AAGCAAGAAACAGTTTTAGAAGG - Intronic
902868984 1:19301485-19301507 CAGAAAATAACAAGTGTTGAGGG - Intergenic
902980040 1:20116022-20116044 CAGAAAAAAAGAGGTGGTGAGGG + Intronic
904016373 1:27424521-27424543 CAAAAAAAAAAAATTGTTGAAGG - Intronic
904842909 1:33385150-33385172 CTGCAAAAAGCAGATGTAGAAGG + Intronic
906174563 1:43759456-43759478 AAACAAAAAACAAATGTTGAGGG + Intronic
909270637 1:73618903-73618925 CAGAAAAAAAAATTTGTTAAGGG + Intergenic
910340240 1:86178750-86178772 AAACAAATAAAAGTTGTTGAGGG + Intergenic
910439424 1:87237671-87237693 AAGAAAAAAATACTTGTTGATGG - Intergenic
911815639 1:102346292-102346314 AAGCAAAAAAGAGGTGATGATGG + Intergenic
912127685 1:106560106-106560128 CAGGAAACAACAGATGTTGCAGG + Intergenic
913952782 1:143253643-143253665 CAAAAAAAAACAATTGATGATGG + Intergenic
913974587 1:143444898-143444920 CACCAAAAAACCGAAGTTGAAGG + Intergenic
914068977 1:144270514-144270536 CACCAAAAAACCGAAGTTGAAGG + Intergenic
914110178 1:144695840-144695862 CACCAAAAAACCGAAGTTGAAGG - Intergenic
915745208 1:158150783-158150805 CAGCACTAAAGAGTTTTTGAGGG - Intergenic
915847281 1:159279629-159279651 GAGCAGAAAGCAGTTGTTGATGG + Intergenic
915874539 1:159598620-159598642 GAGCAAGAAGCAATTGTTGATGG - Intergenic
916898354 1:169191845-169191867 CATCAATAAACATTTGCTGAAGG + Intronic
916922549 1:169484768-169484790 CAGCAAGAAACTCTTGATGATGG + Intronic
920140844 1:203811504-203811526 CAGAAAAAAAAAGTTTTTAAGGG - Intronic
921412170 1:214847220-214847242 CAGAAAAAAAAAGTTGTGAAAGG + Intergenic
923906660 1:238392530-238392552 CAGGAAAAAACACTACTTGATGG - Intergenic
924272080 1:242344353-242344375 CTGCAAAACACAGTTGATGGTGG + Intronic
924502146 1:244647759-244647781 CAGCTTAAAACAGTTTCTGAAGG - Intergenic
924736907 1:246766035-246766057 CTGCAGAAAACAGTTGATCAGGG - Intronic
1063948600 10:11201663-11201685 CAGCAAAGGACAGCTGTTGCAGG - Intronic
1066354708 10:34671149-34671171 CAGCATAAGACAGTTGCTGTGGG + Intronic
1066670253 10:37829557-37829579 AAATAAAAAACAGTTATTGAGGG + Exonic
1066975401 10:42363660-42363682 CTGCAAAAAAAGGTTATTGAAGG - Intergenic
1067421682 10:46157349-46157371 TAGCACAAAACAGTTGATTAAGG - Intergenic
1069223296 10:65910347-65910369 CAGCCAAAAATATTTCTTGAGGG - Intergenic
1069420009 10:68238753-68238775 AAAAAAAAAAAAGTTGTTGAAGG - Intergenic
1070674615 10:78403885-78403907 CCACAACAAACAGTTGTTGAAGG + Intergenic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071721735 10:88153307-88153329 CAGAAAGAAACAGTGCTTGAGGG - Intergenic
1072815390 10:98503352-98503374 AATCAAAAAACAGTAGTTGTTGG + Intronic
1073109534 10:101053061-101053083 AAAAAAAAAAAAGTTGTTGAGGG + Intergenic
1074155589 10:110796044-110796066 CAGCAAAAACCTGTGGTTTAGGG - Intronic
1077471911 11:2767756-2767778 GAGCAAAAAGCAGTTGCTGAAGG - Intronic
1079188677 11:18259623-18259645 CAGAAAAGAACATTTGTTAAGGG + Intergenic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081490158 11:43561446-43561468 GAGCAAAAGGCAGTTGATGAAGG - Intronic
1081985160 11:47296742-47296764 CAACAAAAAACAGATGTCTACGG - Intronic
1082668150 11:56000964-56000986 CAGAAAATAACAGATGTTCATGG - Intergenic
1082716423 11:56619211-56619233 CAGGACAAAACAATTGTTCAGGG + Intergenic
1082930162 11:58594666-58594688 CAGGAAAAAACATATGTAGATGG + Intronic
1083972447 11:66087883-66087905 AACCAAAAAACAATTGTTGGTGG - Intronic
1084286711 11:68136272-68136294 CAGCAGGAAGCAGTTGTAGAGGG + Intergenic
1084779725 11:71400245-71400267 CAGGAAAAAACACTTGTGAACGG + Intergenic
1085652275 11:78278980-78279002 CAGTAAAAAAAAGTGGTAGAGGG - Intronic
1086878158 11:92122606-92122628 CACCAGGAAGCAGTTGTTGAAGG + Intergenic
1087982636 11:104634804-104634826 CAGCAAAACACAGGTTTAGAAGG + Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088286172 11:108190526-108190548 CAGCAACAAACATTTTTTGATGG - Intronic
1088360731 11:108986236-108986258 CAGCAAAACAGAGCTGTTGGAGG + Intergenic
1088407103 11:109493992-109494014 CATCCAAAAACATTTATTGAGGG + Intergenic
1088564071 11:111149083-111149105 CAGGAAGAAACAGTTTTTGGAGG + Intergenic
1091361986 11:134985161-134985183 CAGCAAAGAACAGTTTGTGGGGG + Intergenic
1092497154 12:9008099-9008121 AAGAAAAAAACAGTTCTTAAGGG - Intronic
1093306975 12:17532601-17532623 GAGCAAAGAAAAGTTCTTGAAGG + Intergenic
1093657269 12:21709627-21709649 AAGCAAAAAAAAGTTGAGGAAGG - Intronic
1094001242 12:25696914-25696936 CAGCAAAAATCAAATGGTGAAGG - Intergenic
1095479842 12:42623405-42623427 CAGCAAAAGACAGGTTTCGAGGG + Intergenic
1098550852 12:71759537-71759559 GAGTAAGAAACAGTTGTTAATGG + Intronic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1100555414 12:95688314-95688336 GAGGAAGAAAGAGTTGTTGAGGG + Intronic
1100608961 12:96175154-96175176 CAGGAAATAACAGATGTTGGTGG - Intergenic
1102849012 12:116220711-116220733 AAGCAAAAAACTTTTGTTTATGG - Intronic
1103311618 12:120013917-120013939 CCGCATATTACAGTTGTTGAAGG + Intronic
1104761150 12:131298391-131298413 CCGCAAGAAACGCTTGTTGAAGG - Intergenic
1105506551 13:21015230-21015252 CAGAAAAAAAGATTTGATGATGG - Intronic
1106091052 13:26594351-26594373 CAGCAAAGAGCAGGTTTTGATGG - Intronic
1106528926 13:30569190-30569212 TAGCAAAAAGAAGTTGTTAAAGG + Intronic
1108115026 13:47118214-47118236 TGTCAAAAAACATTTGTTGAAGG - Intergenic
1108922949 13:55698896-55698918 CAGCAAAAAACAGTTATTGATGG - Intergenic
1108982618 13:56537824-56537846 CAAGAAAAAACAGATGTTGAAGG - Intergenic
1109506397 13:63307941-63307963 CAGAAAAAAAAAGTCGCTGAAGG + Intergenic
1110056347 13:70978277-70978299 CTGTAACAAACAGTTATTGAAGG - Intergenic
1110813258 13:79834148-79834170 CAGAGAAAAGCAGATGTTGAGGG + Intergenic
1111366052 13:87246542-87246564 CAGTAAACAACAGTTTTTTAAGG + Intergenic
1111628449 13:90818666-90818688 CAGGAAAAAACAGATGCTGCAGG + Intergenic
1111754982 13:92381488-92381510 AATCAAAAAACAGTAGTTGTTGG + Intronic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1112493957 13:99891023-99891045 AAGCAGAAAACAGCTGTGGAAGG - Intronic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1115778746 14:36745945-36745967 CAAAAAACAACAGATGTTGATGG + Intronic
1116740324 14:48746699-48746721 CAACAAACAACAGTGGTGGATGG - Intergenic
1117732692 14:58739751-58739773 CAGAAGGCAACAGTTGTTGAAGG - Intergenic
1118422809 14:65625973-65625995 AAGCAAATCACAGTTGTTGAGGG + Intronic
1118678443 14:68214100-68214122 CTGCAAACAACAGTTGTCCAGGG - Intronic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1122625185 14:103081762-103081784 CACCAAAAAAGAGATGGTGATGG + Intergenic
1123983297 15:25622705-25622727 CAGCACAGAACACTTGTTAAAGG + Intergenic
1124162549 15:27286290-27286312 CAGCATAAAGCAGGTGATGATGG + Intronic
1124434793 15:29638181-29638203 CAGCAAAAAACAGTGGCTATGGG + Intergenic
1124697701 15:31879525-31879547 AACCACAAAACATTTGTTGAAGG + Intergenic
1126929057 15:53626463-53626485 CGGCAAAGAACAGTGGTGGACGG + Intronic
1127438999 15:58987589-58987611 CAGAAACAAACAGATGTTAATGG + Intronic
1128255920 15:66196470-66196492 CAGAAAAAAAAAGTTGGTGGTGG + Intronic
1129562917 15:76590528-76590550 GACAAAAAAACAGATGTTGATGG + Intronic
1129806211 15:78460655-78460677 AAACAACAAACAGTTGTTAAGGG + Intronic
1130028240 15:80288553-80288575 CAGCAATAGACAGTTGTTAAAGG + Intergenic
1131404588 15:92153992-92154014 AAGCAAATGAAAGTTGTTGATGG + Intronic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131734600 15:95318688-95318710 CAATAAAAAACAGTTGTTATTGG - Intergenic
1131945994 15:97622473-97622495 CAGCAAAATAAGGTTGTTAAGGG + Intergenic
1135858759 16:26036057-26036079 AAGGAATAAACAGTTGTTCAAGG + Intronic
1139102508 16:63785620-63785642 CAGCAAGAAGCAGTTATAGAAGG - Intergenic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1142850474 17:2702118-2702140 CAGCACAAAACAGGTTTTGGAGG + Intronic
1142945048 17:3419531-3419553 CCACAAAAATGAGTTGTTGAAGG + Intergenic
1143398840 17:6627120-6627142 CAGAAAAAAACAATTGTGTAAGG - Intronic
1143699826 17:8650102-8650124 GATCAAAAAATAGTTGCTGAGGG - Intergenic
1144377913 17:14664094-14664116 TAGGAAAGAACAGTTGTAGAGGG - Intergenic
1148749706 17:49938353-49938375 CAACAAAAAAAATTTGTTGTTGG + Intergenic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1149101661 17:52913517-52913539 TAGGAAAAAACAGTTATTTACGG - Intergenic
1150449800 17:65257339-65257361 CGGCAACAAACTGTTGTGGATGG + Intergenic
1150620870 17:66806972-66806994 CAGCCAAAGACAGTTATTGTTGG + Exonic
1150713544 17:67551747-67551769 CAACAAAATACAGTTGTAGTGGG - Intronic
1152011339 17:77720488-77720510 CAGCAACTCACAGTTGTAGAGGG + Intergenic
1153189160 18:2518800-2518822 CAGCAAAATACAGCTGTTAGTGG + Intergenic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153434663 18:5056687-5056709 CAGAGAAAAACAGTGGTAGAGGG + Intergenic
1158087435 18:53669075-53669097 CAGCTAAAAACAATTATTGGAGG - Intergenic
1159430417 18:68345075-68345097 CAGAAAACAACAGTTATTGAAGG + Intergenic
1159639409 18:70845941-70845963 CAGAAAGAAATAGTTGTAGAAGG - Intergenic
1164166193 19:22677686-22677708 CAGGAAAAAACAGGTGCTGGAGG + Intergenic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1164228707 19:23268959-23268981 CTGCAAAAAAGAGGAGTTGATGG + Intergenic
1164386771 19:27778022-27778044 CAGCAAAAAACAGATGAAGAAGG - Intergenic
1164856395 19:31527868-31527890 CAGCAAAATGCAGTTGTAGAGGG - Intergenic
1164866769 19:31610875-31610897 AGGCAGAAAACAGTTGTGGAAGG - Intergenic
1166273660 19:41735286-41735308 CAGCAAAGAACAATTTGTGAGGG + Intronic
1166274240 19:41740864-41740886 CAGCAAAGAACAATTTGTGAAGG + Intronic
1166278761 19:41775484-41775506 CAGCAAAGAACAATTTGTGAGGG + Intergenic
1168278182 19:55288509-55288531 CAACAAAAAAAAATGGTTGATGG + Intronic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
926264204 2:11299677-11299699 AAGAAGAAAATAGTTGTTGATGG + Intronic
926855327 2:17250322-17250344 CAGGAAATAACATTTGATGAAGG - Intergenic
930601030 2:53443346-53443368 CAGCAAAAAAGAGATGTAAATGG + Intergenic
931125980 2:59276721-59276743 AAACAAAAAACAGTTTTTAAAGG + Intergenic
932728881 2:74203429-74203451 CAATAAAAAACACTTATTGAAGG + Intronic
933452153 2:82468241-82468263 AAGGAAGAAACAGTTTTTGAGGG - Intergenic
933515841 2:83300501-83300523 CAGCAAACTACAGGTGTTGAGGG + Intergenic
934179291 2:89605873-89605895 CACCAAAAAACCGAAGTTGAAGG + Intergenic
934289577 2:91680136-91680158 CACCAAAAAACCGAAGTTGAAGG + Intergenic
934910476 2:98249222-98249244 TATCAACAAACATTTGTTGAGGG + Intronic
935114995 2:100127721-100127743 CATCAGAAAACAGTTCTTCACGG + Intronic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936106318 2:109627492-109627514 CTGCAAAAAACAATTTTTAATGG + Intergenic
937516225 2:122658796-122658818 CAGCAGAAAACATTCTTTGAAGG + Intergenic
937715876 2:125031799-125031821 AAGCAAATATCAGTTGTAGAAGG + Intergenic
937767194 2:125675104-125675126 AAGCAAAAAACAGTAGATGTTGG - Intergenic
938050546 2:128166512-128166534 ATACAAAAAACAGTTGTAGAAGG - Intronic
938645480 2:133325930-133325952 CATCAAAAAGAAGTTGTTGATGG + Intronic
939329576 2:140740010-140740032 AATCAAAAAACAGTAGTTGTTGG + Intronic
940269383 2:151874686-151874708 CAACAGAAAACAGAGGTTGAGGG + Intronic
940506489 2:154560846-154560868 AAGAAAATAACAGTTGGTGATGG - Intergenic
940513924 2:154655665-154655687 CAGAAAAAAATAGTTCTTAAAGG - Intergenic
940601495 2:155867340-155867362 CAGCAAAAAACTGTTGATGTGGG - Intergenic
940632855 2:156260596-156260618 AAGAAAAAAAAAGTGGTTGAAGG + Intergenic
941647009 2:168051393-168051415 CACCAAAAAAAAGCTGTTTAAGG + Intronic
941733044 2:168940289-168940311 CAGAAAAAAAAAGTTCTTGAAGG + Intronic
942153615 2:173104505-173104527 CAGAAAAAAAAAGATGTTGGTGG + Intronic
942469486 2:176244825-176244847 CAGGAAAAGAAAGTTTTTGAAGG - Intergenic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
944360417 2:198848288-198848310 CATCAAAAAACAGTAGATGTTGG + Intergenic
944919647 2:204398534-204398556 AATCAAAAAACAGTTGATGCTGG + Intergenic
945228876 2:207562872-207562894 CACCAATAAACATTTGTTGTAGG - Intronic
945558608 2:211310061-211310083 TATCAAAAAAAAGTTGTTAAGGG - Intergenic
946010690 2:216561308-216561330 AACAACAAAACAGTTGTTGAAGG - Intronic
946204690 2:218095622-218095644 CAGGACAAAACAGTTGTTCAGGG - Intergenic
1168846509 20:948585-948607 CACCCAAAAACAGATATTGATGG + Intergenic
1171364729 20:24616042-24616064 CATCACATAACAGCTGTTGATGG + Intronic
1172612513 20:36262403-36262425 CCCCAAAAAACAGGAGTTGAGGG + Intronic
1172650961 20:36501054-36501076 AAAAAAAAAAAAGTTGTTGAAGG - Intronic
1172684127 20:36740336-36740358 CAAAAAAAAATTGTTGTTGATGG - Intronic
1173028689 20:39334183-39334205 AAGCAAATAACAGTTGTGTAGGG + Intergenic
1175307406 20:57986012-57986034 CAGGAAAAACTATTTGTTGATGG + Intergenic
1176589053 21:8622649-8622671 CCTCAATAAACATTTGTTGAAGG + Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177613047 21:23478499-23478521 CAGCTATAAACAGTTGCTGAAGG + Intergenic
1178164098 21:29952117-29952139 CAGCATAGCACAGTTGGTGAAGG - Intergenic
1179041002 21:37802203-37802225 AAGCAAGAAGCAGTTGTTGCAGG + Intronic
1179129282 21:38620175-38620197 CAGCAGAAGACACTTGCTGAAGG - Intronic
1180271877 22:10599646-10599668 CCTCAATAAACATTTGTTGAAGG + Intergenic
1182239207 22:28901397-28901419 CAGCAAATCACAATTGCTGAAGG - Intronic
1182943843 22:34303664-34303686 CAGCCAAAATCAGTTGTTTGAGG - Intergenic
1183416154 22:37683144-37683166 CAGGCAAAAACAGGTGCTGAGGG - Intronic
1184178124 22:42801399-42801421 CAGCAAACATCAGTTGTGGGTGG - Intronic
949138265 3:599120-599142 CCTCAATAAACATTTGTTGAAGG - Intergenic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
952214413 3:31262583-31262605 CTGCACAACAGAGTTGTTGATGG + Intergenic
952628704 3:35439272-35439294 CAACAAAAAAAACTTGTTTAAGG + Intergenic
952725580 3:36581196-36581218 GAGCAAAAATAAGTTGCTGAGGG - Intergenic
953070631 3:39515979-39516001 AACCAATAAACACTTGTTGACGG + Exonic
953077560 3:39584084-39584106 CACCAAAGAACAATTGATGAGGG + Intergenic
953714983 3:45309678-45309700 CAGTAAAATACAGTGGTTAATGG - Intergenic
953808285 3:46090522-46090544 CTGCTAAAAACAGCTGGTGAAGG + Intergenic
954102167 3:48382114-48382136 CAAAAAAAAAAAGTTGTTTAGGG - Intronic
954545718 3:51432996-51433018 AAGAAAAAAACAGTAGTTGAAGG - Intronic
954753332 3:52825941-52825963 CAGCAAGAAACAGTCCTGGACGG - Exonic
955498324 3:59559835-59559857 CAGGAATAAACAGATGGTGATGG + Intergenic
956612327 3:71136669-71136691 CAGCAAAAAACAGTTGTTGATGG - Intronic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957061401 3:75484107-75484129 CAGGAAACAACAGGTGTTGGAGG - Intergenic
957557721 3:81782297-81782319 CAGCAAACAACAATGGTGGATGG - Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
957885289 3:86280288-86280310 CGTCAAAAAACAATTGATGATGG + Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
958464029 3:94436471-94436493 CAGTAAAACACAGCTGTTGCTGG - Intergenic
958589834 3:96142183-96142205 CAGCAAAACACATTTTTTAAAGG - Intergenic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
959875581 3:111378722-111378744 AAGCAAAAAACACTTGATGTTGG + Intronic
960397024 3:117150498-117150520 GGGAAAAAAAAAGTTGTTGAAGG - Intergenic
960931643 3:122856890-122856912 CAGAAAAAAACACTTGAGGAAGG - Intronic
962809497 3:138948729-138948751 CAGCAGACAACACTTGTAGATGG - Intronic
963094491 3:141521640-141521662 TAGTAAAAATCAGTTGTTTAGGG + Intronic
963751543 3:149184875-149184897 AAGCAACAAACAGTTGCTAAGGG + Intronic
964693574 3:159481514-159481536 CACTAAAAAAAAGTTGTTTATGG + Intronic
965438698 3:168685946-168685968 AAGAAAAAAAAAGTTATTGAAGG + Intergenic
965673749 3:171173669-171173691 CAGCCAAATACATTTGTGGAGGG + Intronic
966294167 3:178399300-178399322 CAGCAAAATACACATCTTGAAGG - Intergenic
966340483 3:178920333-178920355 CATCAAAAAACAGTAGATGTTGG + Intergenic
966959784 3:184923732-184923754 CAGAAAAACACATTTGTTAAGGG - Intronic
967540531 3:190662056-190662078 CCCCAAAGAAAAGTTGTTGAAGG + Intergenic
967553610 3:190829581-190829603 CAACAAAAAATATTTTTTGAAGG + Intergenic
968126241 3:196162619-196162641 CAGCAAAAAATACTTGATGTGGG + Intergenic
968539669 4:1158879-1158901 CAGCCAAGAAAAGTTCTTGAAGG - Intergenic
970050568 4:11909872-11909894 CAGAAAACAACAGTCGTTTAGGG + Intergenic
971760322 4:30756885-30756907 TAGCAAAAAACAGTTGGAAAAGG - Intronic
972013814 4:34218618-34218640 AATCAAAAAACAGTTGATGTTGG + Intergenic
974361417 4:60885636-60885658 CAGCAATAACTAGTTGTTTATGG - Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
975678430 4:76851049-76851071 AAACAAAAAAAAGTTGATGATGG - Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
976914964 4:90360696-90360718 CTGCAGAAAAGAGTTGTTCATGG + Intronic
977381572 4:96280851-96280873 CAGCAGAAAATAATTTTTGAAGG + Intergenic
979298616 4:119061834-119061856 CAGGAAAAAAAAGTGTTTGAAGG - Intergenic
979723482 4:123932193-123932215 AATCAAAAAACAGTAGATGATGG + Intergenic
979820458 4:125163381-125163403 TAGCAAAGAAAAGTTGTAGATGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980779025 4:137472941-137472963 CAGAAAAAAAGATTTTTTGAAGG + Intergenic
980857769 4:138460603-138460625 CAGAAAAAGAAAGTTCTTGAAGG - Intergenic
981294098 4:143109886-143109908 AAGAAAAAAACTGTCGTTGAGGG - Intergenic
981861307 4:149360131-149360153 AAGCAAAATACAGTTCTAGATGG + Intergenic
982435721 4:155382325-155382347 CAGTAAGATTCAGTTGTTGAAGG + Intergenic
982513066 4:156308571-156308593 CATCAAAAAGCAGTTGTGAAAGG - Intergenic
982651909 4:158097097-158097119 CAGCAACAAGCATTTGTTTATGG - Intergenic
982886242 4:160786398-160786420 CTACAAAAAACAGTTGTGGATGG - Intergenic
983298258 4:165893323-165893345 CAGCAAAGAAAAGTTATTGCTGG + Intronic
984049336 4:174844189-174844211 CAGCAAAATAGAGTTGCTGCAGG + Intronic
984519903 4:180788756-180788778 CAGAAAAAAACTAGTGTTGAAGG + Intergenic
985274645 4:188225968-188225990 AAGCAAAAAACTGTTGTCGACGG + Intergenic
985992043 5:3570592-3570614 CAGAAACAAACAGTTCTTCAAGG - Intergenic
986435036 5:7721046-7721068 CAGGAAACAACAGGTGTTGAAGG - Intronic
986790526 5:11155173-11155195 CAACCAAAAACATGTGTTGAGGG - Intronic
986795829 5:11211068-11211090 CAGAAGAACCCAGTTGTTGATGG - Intronic
986860853 5:11924849-11924871 AAGAAAAAAAAAGTTGTTGGTGG + Intergenic
987957307 5:24756819-24756841 AAGAAAAAAAAAGATGTTGATGG - Intergenic
988437988 5:31198167-31198189 CAACAAAGAAAAGTTATTGAAGG + Intronic
988452843 5:31360669-31360691 TAGGAAAAAACAATTTTTGATGG + Intergenic
989407796 5:41080793-41080815 CAAAACAAAATAGTTGTTGATGG - Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
990913113 5:60873702-60873724 CAAAAGTAAACAGTTGTTGAGGG - Intergenic
991381762 5:66035418-66035440 CAGGGAAAAACAGTAGTTAAGGG - Intronic
992015310 5:72569211-72569233 CAGCATAAAACACATGATGATGG - Intergenic
992021610 5:72630340-72630362 CATCAAGAAACAGGTGGTGAAGG - Intergenic
994734942 5:103541062-103541084 AAGCAAAATACAGTTCTTCAGGG - Intergenic
994997174 5:107078804-107078826 CACAAAAAAACAGTGATTGAAGG - Intergenic
995187265 5:109285033-109285055 CAGCAAAAAGCAGTGCTAGAAGG + Intergenic
995617301 5:113979424-113979446 CAGCCAAAAATATTTATTGAGGG - Intergenic
996708932 5:126524968-126524990 TAGCAATAAACAGTTATTGTTGG + Intergenic
996949176 5:129104980-129105002 CAGAAAAACACAGTGCTTGAAGG - Exonic
996991127 5:129633674-129633696 AAACAAAAAACAGTCTTTGAAGG - Intronic
996999666 5:129744593-129744615 CAGCTAAAAACAGATATTAACGG - Intergenic
998580829 5:143374003-143374025 CAAAATAAGACAGTTGTTGAAGG - Intronic
998723663 5:144984303-144984325 CAGAAAAATACAATTGTTGATGG + Intergenic
999108269 5:149093194-149093216 CAGCCATAAGCAGCTGTTGAGGG - Intergenic
999179034 5:149655799-149655821 CAGAAAAAAACAGCTCTTAAAGG - Intergenic
999707673 5:154288676-154288698 TAGCAAAAGATGGTTGTTGAAGG + Intronic
999852680 5:155559873-155559895 CTGCAAAAAAGAGTTGCTGTGGG - Intergenic
1000226879 5:159270679-159270701 AAGAAAAAAAGAGTTGTTGTGGG - Intronic
1000268990 5:159665038-159665060 CAACAAAAAATACTTTTTGATGG + Intergenic
1000600084 5:163262420-163262442 CAGGAGCAAACACTTGTTGAGGG - Intergenic
1000653040 5:163841597-163841619 CAGCAAAAAATAGTTTTAGCTGG + Intergenic
1001418175 5:171563693-171563715 CATCAAAAATCTGTTGTTAATGG + Intergenic
1002544332 5:179928927-179928949 CATCAAAATACAGTTTTGGATGG - Intronic
1003137223 6:3443072-3443094 AAGCAAAACACACTTTTTGAGGG - Intronic
1003730343 6:8814874-8814896 AAGAAATAAACAGTTGTTAAAGG + Intergenic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1007693788 6:43719126-43719148 CAGCTAAAGACATTTGCTGAAGG + Intergenic
1008102531 6:47407300-47407322 CAGGAAAAAACAGATGAGGATGG + Intergenic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1012191636 6:96287263-96287285 CAGCAAAGAACAGTTTGTGCAGG - Intergenic
1012989909 6:105914961-105914983 CATCAAAACACAGTGGTTCAAGG - Intergenic
1014478849 6:121910191-121910213 CAACAAAAAACAGTTGTGAGAGG - Intergenic
1014655128 6:124093494-124093516 CAACAATTAACATTTGTTGAAGG - Intronic
1015145652 6:129983189-129983211 CAGAGAAAAAAAGTTGGTGAAGG + Intergenic
1015224971 6:130847085-130847107 CAGCTGGAAACATTTGTTGAAGG - Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1015676595 6:135756800-135756822 CAGCAACAAACAGGAGTTGTGGG + Intergenic
1015857267 6:137638455-137638477 CAGCATAAAATAGTTATTTAGGG - Intergenic
1015935093 6:138401116-138401138 CAGATAAAAACACGTGTTGATGG + Intergenic
1016676730 6:146778957-146778979 CAGCAAAAAAAGTTTGTTCAAGG + Intronic
1016872709 6:148834748-148834770 AAACAAAAAACAGTTACTGAGGG + Intronic
1017555157 6:155556163-155556185 GAGGAAAAAACAGTTTTTAAAGG - Intergenic
1018177215 6:161187466-161187488 CAGCAAAAATCAGTTAAGGATGG + Intronic
1018479542 6:164176092-164176114 CAGCAAAAAACACTGCTTAAAGG - Intergenic
1022657572 7:32334285-32334307 CAGAAAAAAACATTTTTTAAAGG - Intergenic
1022863145 7:34389028-34389050 CTGCAAAAGACAGTTTTTCAGGG - Intergenic
1023269882 7:38450790-38450812 CAGCAAAAAATATTTGCTCAGGG + Intronic
1023473417 7:40550489-40550511 CAGGCATAAACAGTTCTTGATGG - Intronic
1023645378 7:42307237-42307259 CAGTAAACAACAGTTTTTCAAGG + Intergenic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024779752 7:52834202-52834224 CAGAAAAAAAAAGTTCTTGTAGG - Intergenic
1028469954 7:91195025-91195047 GAGCAAAGAACAGTGGTTGCAGG - Intronic
1031025687 7:116677200-116677222 CAGCAAGAGGCAGTTGCTGATGG + Intronic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1040888647 8:52292064-52292086 CAGTAAATAAAAGTTGTTTATGG - Intronic
1041001134 8:53455000-53455022 CAAAAAAAAACAATTTTTGATGG + Intergenic
1042638633 8:70907046-70907068 CAGATAACAACAGTTGTTGCTGG - Intergenic
1043441256 8:80278914-80278936 CAGGAAAAAACACTTGAAGAGGG + Intergenic
1043743724 8:83846345-83846367 AAACAAAAAACATTTTTTGATGG - Intergenic
1045431488 8:102118934-102118956 CAGAAAATAACAAGTGTTGATGG + Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1046840319 8:118849164-118849186 CAGAAAAAAACAGTGTGTGAGGG - Intergenic
1046923952 8:119766841-119766863 TAACAAAAAAAAGTTGCTGATGG + Intronic
1047260844 8:123258137-123258159 CAGCACCAAACTGTTGATGAGGG - Intronic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1047948251 8:129904542-129904564 TAGCAAGAAACAGAAGTTGAAGG - Intronic
1048070478 8:131015940-131015962 CATCAATACACAGTTATTGATGG + Intronic
1048400918 8:134069418-134069440 CCTCAAAAAAAATTTGTTGAAGG + Intergenic
1048890913 8:138945658-138945680 CAGAAAAAAACAGTAGTGCAAGG + Intergenic
1049998002 9:1049284-1049306 CCGCAACAAATATTTGTTGAAGG - Intergenic
1050516385 9:6448281-6448303 AAGGAAAACACAGTTGTGGAAGG + Intronic
1051546693 9:18283567-18283589 CTGCAAACCACAGTGGTTGAAGG + Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1052947124 9:34177535-34177557 CAACAAAAAACAGTTGGGCATGG - Intergenic
1055453391 9:76451524-76451546 TGGCAAAAATCAGTTGTTTAAGG + Intronic
1056421734 9:86434776-86434798 CATAAAACAACAGTTGTTAAAGG - Intergenic
1056646182 9:88413767-88413789 CATCAACAAATAATTGTTGATGG + Intronic
1057515235 9:95714932-95714954 CGGCCAAAAGCAGTTTTTGAAGG + Intergenic
1058274979 9:103028507-103028529 CAGCAAAAAGCAGTTCTAAAAGG + Intergenic
1059031824 9:110706316-110706338 CAGCAAATAAAAGGTTTTGAGGG - Intronic
1059499720 9:114741131-114741153 AAGCAAAAAACAGTAGATGTTGG + Intergenic
1060902976 9:127277559-127277581 AAGCAAAAAAGAGATGCTGAAGG - Intronic
1061116296 9:128614762-128614784 AAGGAAAAAAAAGTTGTTGGGGG + Intronic
1061462996 9:130755120-130755142 CTTCAATAAATAGTTGTTGAAGG + Intronic
1186345440 X:8687126-8687148 CAGCAAAAGCCATTTGTTAAAGG + Intronic
1187861068 X:23683597-23683619 CAGAAAAAGTCAGTTGCTGAAGG + Intronic
1188067343 X:25678508-25678530 CAGCCAAATCCAATTGTTGATGG - Intergenic
1188073401 X:25745708-25745730 CAGCAAATGACAGTTGTGGCTGG - Intergenic
1188413876 X:29908165-29908187 CAGCAATAAATAATTGATGAAGG - Intronic
1189974993 X:46451929-46451951 CAGCAAAAAAAAGTTTTTTGTGG + Intronic
1191094679 X:56661717-56661739 CAGCACAGAACAGTTGTTCTAGG - Intergenic
1191970100 X:66804381-66804403 CAGGAAACAACAGATGCTGAAGG + Intergenic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193567555 X:83096964-83096986 CAGGAAACAACAGGTGTTGGAGG + Intergenic
1194997100 X:100603027-100603049 CATCAAAAAACAGTAGATGTTGG - Intergenic
1195566813 X:106348292-106348314 CAACAAAAAACAGTTTATTATGG + Intergenic
1195709748 X:107764634-107764656 CTGGAAAAAAAAGTTGCTGATGG - Intronic
1196039349 X:111185049-111185071 CAGGAAACAACAGATGTTGGAGG - Intronic
1196247370 X:113415594-113415616 CAGCAATATCCAGGTGTTGAGGG + Intergenic
1196663158 X:118289575-118289597 CAGCTCAAAAAAGATGTTGAAGG - Intergenic
1196821067 X:119701186-119701208 GAGCAAACAACAGTTGTTTGGGG - Intergenic
1197655686 X:129113819-129113841 CAGCAAAAAAGAATCATTGACGG - Intergenic
1198880691 X:141277843-141277865 CATCACTAAACACTTGTTGAAGG - Intergenic
1200372946 X:155746801-155746823 AAGCAGTAAATAGTTGTTGAAGG + Intergenic
1200389200 X:155926658-155926680 ATGCAAAGAACAGTTCTTGAAGG - Intronic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic
1201421593 Y:13805584-13805606 CAGCAAAAGCCATTTGTTAAAGG - Intergenic
1202107966 Y:21390151-21390173 CAGCAACAAACCATGGTTGATGG - Intergenic