ID: 956615940

View in Genome Browser
Species Human (GRCh38)
Location 3:71172726-71172748
Sequence CAGTGAATCCAGAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 1, 2: 5, 3: 38, 4: 447}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956615940_956615945 1 Left 956615940 3:71172726-71172748 CCCTCTTCCTTCTGGATTCACTG 0: 1
1: 1
2: 5
3: 38
4: 447
Right 956615945 3:71172750-71172772 TGGTATTTTTACTTGTTGCTGGG 0: 1
1: 0
2: 0
3: 27
4: 311
956615940_956615944 0 Left 956615940 3:71172726-71172748 CCCTCTTCCTTCTGGATTCACTG 0: 1
1: 1
2: 5
3: 38
4: 447
Right 956615944 3:71172749-71172771 TTGGTATTTTTACTTGTTGCTGG 0: 1
1: 0
2: 2
3: 26
4: 761
956615940_956615946 21 Left 956615940 3:71172726-71172748 CCCTCTTCCTTCTGGATTCACTG 0: 1
1: 1
2: 5
3: 38
4: 447
Right 956615946 3:71172770-71172792 GGGAAATTTCGTTAGCTGCCTGG 0: 1
1: 0
2: 0
3: 2
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956615940 Original CRISPR CAGTGAATCCAGAAGGAAGA GGG (reversed) Intronic
905005507 1:34706475-34706497 CAGTGAATCCAGAGGCAAGAAGG + Intergenic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905456351 1:38090706-38090728 CAGTGAACACAGAAGGGTGAAGG + Intergenic
905899831 1:41574166-41574188 CTCTGAAGCAAGAAGGAAGAGGG + Intronic
907219890 1:52898685-52898707 CACTGAATCCAGAACAAAGCTGG - Intronic
907879807 1:58537347-58537369 CAGTGATTCCACAAGGTACAAGG + Intronic
907931170 1:59002250-59002272 CATTGAACCCAGGAGGCAGAGGG - Intergenic
908498836 1:64722675-64722697 CAGTGGAGCGAGCAGGAAGATGG + Intergenic
909597368 1:77421745-77421767 GAGTGAAGCGAGAAGTAAGAGGG - Intronic
909625753 1:77713967-77713989 TAGTGAAACCAGAAGGGATAGGG - Intronic
910465273 1:87492596-87492618 CATGGAAGCCAGAAGGAGGATGG + Intergenic
910505255 1:87943195-87943217 CAGTGAAACCTAAAGGATGAGGG + Intergenic
911466599 1:98262207-98262229 GAGTGAATTTAGAAGGACGATGG + Intergenic
911490255 1:98556181-98556203 CAGGGAATGGAAAAGGAAGAGGG + Intergenic
911721088 1:101192003-101192025 CATTGAATCATGATGGAAGAAGG + Intergenic
913088514 1:115460204-115460226 CAGAGATGCCAGAAGGAAGTGGG - Intergenic
913691176 1:121281332-121281354 AAGAGAATGAAGAAGGAAGAAGG - Intronic
914360099 1:146927668-146927690 CATGGAAGCCAGAAGGAGGATGG + Intergenic
914493648 1:148172228-148172250 CATGGAAGCCAGAAGGAGGATGG - Intergenic
915057894 1:153152656-153152678 CAGGGATGCCAGAAGGAACAGGG + Intergenic
915963166 1:160283806-160283828 TAGGTAATCCAGAAGGAAGTAGG - Intronic
916895892 1:169161625-169161647 CTGTGAGGCCAGAAGCAAGATGG - Intronic
918000624 1:180491468-180491490 TAGGGAATCCAGCAGGAAAAGGG - Intronic
918922947 1:190738551-190738573 AAGAGATTCAAGAAGGAAGAGGG - Intergenic
919539118 1:198827483-198827505 TGGTGAAGCCAGAAGGGAGATGG + Intergenic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920180026 1:204126953-204126975 CAGAGAATCCAGAGGGCACAGGG - Exonic
920478500 1:206299808-206299830 AAGAGAATGAAGAAGGAAGAAGG - Intronic
920569887 1:207008610-207008632 CTCTGTATCCAGAAGGAAGCTGG + Intronic
923359705 1:233198896-233198918 TAATGAATCGAGAAGGATGAGGG + Intronic
923760562 1:236839341-236839363 CAGTCAACCCAGTAGGAAAATGG + Intronic
924637141 1:245798919-245798941 CAGTGAGTCCAGTTGGAAGCAGG - Intronic
924638304 1:245809450-245809472 CAGTGAGTTCAAAAGGAGGAAGG + Intronic
1065208003 10:23375306-23375328 CTGGGAAGCCAGAAGCAAGATGG + Intergenic
1065597437 10:27328548-27328570 CATTTAATCCAGATGGGAGATGG - Intergenic
1065759803 10:28971627-28971649 CAGTAAATCCATAAGATAGATGG + Intergenic
1065788996 10:29242552-29242574 CAGTGAATACAAGAGGAAGCGGG + Intergenic
1066017663 10:31264210-31264232 CAGTCAATCCACAAGGAAGAGGG - Intergenic
1067958334 10:50818865-50818887 CAGTGGATCCAGATGGCAAAGGG - Intronic
1068653525 10:59550383-59550405 CTGTGAAGCTAGAAGCAAGACGG + Intergenic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1069860326 10:71467146-71467168 CAGAGACCCCAGAGGGAAGAGGG + Intronic
1070435994 10:76394095-76394117 CAGTGCAGCCAGAATGAACAAGG + Intronic
1070923382 10:80203082-80203104 GGGTGAATCCAGGAGGAAGGAGG + Intronic
1071815455 10:89227823-89227845 TGGTGGAGCCAGAAGGAAGAGGG + Intronic
1071847380 10:89535112-89535134 CATAAAATCCAGAAGAAAGATGG + Intronic
1072179522 10:92967845-92967867 CAGTAATTCCAGAAGGCAGCTGG - Intronic
1074855441 10:117469708-117469730 CAGTGAAGCCAGGAGGGAGCAGG - Intergenic
1075705226 10:124496641-124496663 CAGGGGACCCAGAAGGCAGACGG - Intronic
1076378685 10:130010454-130010476 CAGTGATTCCAAAAGGGAGGAGG + Intergenic
1076511249 10:131015227-131015249 CAGTCAATCCAGAAGTCAAATGG - Intergenic
1077083800 11:737411-737433 CAGTGAGACCAGAGGGAACACGG - Intergenic
1077497918 11:2895526-2895548 TAGGGAATCCAGAAAGAAGCAGG - Intronic
1077829200 11:5846124-5846146 CTATGAATACAGAAGGAAAAGGG - Intronic
1079094789 11:17503204-17503226 CAGTGAATGCACAGGCAAGAAGG + Intronic
1079547244 11:21647464-21647486 CAGTGAATCCTGAGGGGAGGTGG - Intergenic
1079659501 11:23021006-23021028 CAGACAACCCAGAAGGAAGAAGG - Intergenic
1080172992 11:29328390-29328412 GCCTGAATCCAGAAGGAAGAAGG - Intergenic
1080186521 11:29493846-29493868 CAAAGAAGACAGAAGGAAGAGGG - Intergenic
1080217971 11:29867340-29867362 CAGTGAATCCAAAAGGTCTATGG + Intergenic
1080904772 11:36531874-36531896 CATTAAAGTCAGAAGGAAGAAGG - Intronic
1081491586 11:43573475-43573497 CATTGAATCCACCAGGAAGCCGG + Intronic
1083320493 11:61842961-61842983 CAGTGCAGCCAACAGGAAGAAGG - Intronic
1084195430 11:67521832-67521854 CAGTGTTTCCAGGAGGAAGTGGG - Intronic
1084406464 11:68976803-68976825 GAGGGAACCCAGAAGGCAGAGGG + Intergenic
1084551456 11:69845566-69845588 CAGTCCATGCAGAGGGAAGAAGG + Intergenic
1084937368 11:72594317-72594339 CAGAGGGTGCAGAAGGAAGATGG - Intronic
1085262905 11:75218507-75218529 GAGTGAATGCAGAAGGAGAAAGG + Intergenic
1085385386 11:76154704-76154726 CACTGAACCCAGAAGTCAGAGGG - Intergenic
1085621637 11:78042125-78042147 CTGTGACACCAGAAGCAAGATGG - Intronic
1086987396 11:93265556-93265578 AAGAGAATTCAGAAGGAAAATGG + Intergenic
1087963730 11:104386153-104386175 CAGTGATTTCAGAAGAAAAAGGG - Intergenic
1089583524 11:119496047-119496069 CAGAGACTCCAGGAGGAGGAGGG - Intergenic
1089637246 11:119822969-119822991 GAGTGTTTCCAGAAGGAAGGGGG + Intergenic
1090609080 11:128454027-128454049 AAGGGAAACCATAAGGAAGAAGG - Intergenic
1092279549 12:7089205-7089227 CAGGGGATCCAGGAGGAAGTTGG + Intronic
1092891424 12:12972735-12972757 CAGAGAATAAAAAAGGAAGAAGG - Intergenic
1092981612 12:13800089-13800111 CAGTGATTCCAGGAGGAAAATGG - Intronic
1093323297 12:17740890-17740912 CAATGAATCTAGAAGCAACAAGG - Intergenic
1093568895 12:20643034-20643056 AAGTGTATCAAGACGGAAGAGGG + Intronic
1094214266 12:27923748-27923770 AAGTGTATTCACAAGGAAGATGG + Intergenic
1094771252 12:33662762-33662784 CAGTGAATCCAGAGGGAAGCAGG + Intergenic
1095552956 12:43466076-43466098 CAGAGAAACCTGAAGGAAGGTGG + Intronic
1095839867 12:46681500-46681522 TAATTAATGCAGAAGGAAGATGG - Intergenic
1096280958 12:50253137-50253159 CAGTAAATATAGAAAGAAGAGGG + Intronic
1097068773 12:56339636-56339658 CAGTGAATGGAGTAGGAAGAGGG + Intronic
1097625425 12:61994294-61994316 CAGTGTATCAAGAGAGAAGAAGG - Intronic
1098112509 12:67138202-67138224 CCGTGAATCTAAACGGAAGATGG + Intergenic
1098246072 12:68519326-68519348 CAGTGAGGCCTGAAGGAGGAAGG - Intergenic
1100188889 12:92168853-92168875 CCATGAATTCATAAGGAAGAGGG - Intergenic
1101276788 12:103211012-103211034 CAATCAATCCAGATGGAAAAAGG - Intergenic
1102438918 12:112946703-112946725 CAGGGGACTCAGAAGGAAGAAGG - Intronic
1102840348 12:116113694-116113716 CAGTGAGTGGAGGAGGAAGAGGG + Intronic
1102899321 12:116624097-116624119 AAGAGAATGAAGAAGGAAGAAGG + Intergenic
1103871235 12:124093761-124093783 CAGGGAAGGCAGCAGGAAGAGGG + Intronic
1104074819 12:125379675-125379697 CAGTTAATCCAGAAAGTAGATGG + Intronic
1104772910 12:131375446-131375468 CACTGTGCCCAGAAGGAAGATGG - Intergenic
1105897500 13:24728627-24728649 CAGTAAATCTAGAAGAAAAATGG + Intergenic
1106355833 13:28982169-28982191 CAGTGAAGACAGATGGAAAAAGG + Intronic
1106367412 13:29095402-29095424 CTGTCAACCCAGAATGAAGAGGG - Intronic
1108240014 13:48454509-48454531 CTGGGAATACAGAAGTAAGATGG + Intronic
1108315830 13:49236257-49236279 CTGTGAACCTAGAAGCAAGACGG + Intergenic
1109135499 13:58644835-58644857 GAGTGACACCAGAAGCAAGAAGG + Intergenic
1109156837 13:58921861-58921883 CAGTAAAGCCAGCAGGAAAAGGG - Intergenic
1109164277 13:59014196-59014218 CAGTTTATCCAGAAGACAGAGGG - Intergenic
1109720148 13:66265553-66265575 CAGTGACTCCTGATGGAAGAAGG + Intergenic
1110382010 13:74863424-74863446 AAGTGAATCCAGAAAGAAATAGG + Intergenic
1110713105 13:78671587-78671609 CTGGGAATCCAGGAGGTAGAAGG + Intergenic
1112908133 13:104449022-104449044 CAGTGAAACAAGAAGGCAGGTGG - Intergenic
1113525345 13:110970405-110970427 AAGAGAATTCAGAAGGAAAATGG + Intergenic
1113684339 13:112271792-112271814 CAGTTAAGCGAGAAGGAAGGTGG - Intergenic
1113890373 13:113732254-113732276 CAGGGAAGTCAGAAGGGAGAGGG - Intronic
1114145949 14:19978773-19978795 AAGAGAATTCAGAAGGAAAATGG + Intergenic
1115055731 14:29124172-29124194 CAGTAAATGCACAAGGAAAAAGG + Intergenic
1115856392 14:37633735-37633757 CATTGACACCAGAGGGAAGAGGG - Intronic
1116268230 14:42724520-42724542 GAGAGAAGCCAGTAGGAAGAAGG - Intergenic
1116277894 14:42860215-42860237 CAGAGGATGCAGAGGGAAGAGGG + Intergenic
1117256440 14:53982891-53982913 CAGTGAATGGAGAAAGATGAAGG + Intergenic
1119191156 14:72682924-72682946 CAGTGCATCCAAAAGAAAAAAGG + Intronic
1119421658 14:74511008-74511030 CAGTCACTCCAGAATGAATATGG + Intronic
1119957398 14:78813852-78813874 AAGTGAAGCCAAAAGGAAGAAGG - Intronic
1120129990 14:80795322-80795344 CAGATAACACAGAAGGAAGAGGG - Intronic
1122172150 14:99885751-99885773 CAGTGAAAGGAGGAGGAAGAGGG + Intronic
1122382641 14:101320415-101320437 AAGAGAATTCAGAAGGAAAATGG + Intergenic
1123830982 15:24136879-24136901 CAGGGTATGCAGAAGGAACATGG + Intergenic
1123836064 15:24194254-24194276 CAGGGTATGCAGAAGGAACATGG + Intergenic
1124829374 15:33133138-33133160 CAGTTAACTCACAAGGAAGAGGG + Intronic
1125925389 15:43558883-43558905 CAGTGTTTCCAGAGGGTAGATGG + Exonic
1126196394 15:45936601-45936623 CACTGAATACTGAAGAAAGAAGG + Intergenic
1129107987 15:73322415-73322437 CAGTTAAACCTGAAGGAAGAAGG + Exonic
1129139264 15:73582405-73582427 CAGTCAAGACAGAAGCAAGAAGG + Intronic
1129935549 15:79446345-79446367 AAGTGAATCCAGAGGAAATAAGG - Intronic
1130143382 15:81252126-81252148 AATTGATTCCAGAAGGATGAAGG + Intronic
1131079471 15:89522785-89522807 AACTGAAGCCAGAAGGAAAAAGG + Intergenic
1131298194 15:91170945-91170967 GAGTGAGTCCACAATGAAGAGGG - Intronic
1131668289 15:94593156-94593178 CCTTGAATCCAGATGGATGATGG + Intergenic
1132976535 16:2713893-2713915 CAGCAGACCCAGAAGGAAGAGGG - Intronic
1133342933 16:5049039-5049061 AATGGAAACCAGAAGGAAGAAGG + Intronic
1133655733 16:7862079-7862101 AAGTGCAGCCGGAAGGAAGAGGG - Intergenic
1133741572 16:8655692-8655714 CACTGAATCTGGAAGGAAGTGGG + Intergenic
1133981684 16:10637385-10637407 CAGTGAATAAAGAAGGAAGAAGG + Intronic
1135614796 16:23901927-23901949 CAGTGAAACCATAACGAACAAGG - Intronic
1135888452 16:26335237-26335259 AATTGAATCCAGAAGGAAGGAGG - Intergenic
1136097293 16:27966226-27966248 GAATCCATCCAGAAGGAAGATGG - Intronic
1136098405 16:27975241-27975263 CAGGGAATCAAGAGGGCAGAAGG - Intronic
1136183374 16:28570253-28570275 CAGTGTGTCCAGAAGGTAGGAGG + Intronic
1138216666 16:55210714-55210736 AGGTGAATACAGAAGGAATAAGG + Intergenic
1138643508 16:58405392-58405414 CAGTCAACCCAGAAGGGAAATGG + Exonic
1138756565 16:59493597-59493619 AATTGAAACCAGAGGGAAGAGGG - Intergenic
1139085073 16:63574604-63574626 AAGTGACTCATGAAGGAAGAGGG + Intergenic
1140024951 16:71278951-71278973 CAGTTAATACAGAAGGAACCTGG + Intergenic
1141711109 16:85699396-85699418 CTGAGAAGCCAGAAGGAAGGGGG + Intronic
1142165886 16:88587704-88587726 CTGTGAAGCCAGAAGGAAAGGGG + Intronic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1143885912 17:10064678-10064700 GAGCCAATGCAGAAGGAAGAGGG + Intronic
1144665348 17:17098587-17098609 GAGGGAATCCAGGAGAAAGAAGG + Intronic
1145006622 17:19342191-19342213 CAGTAAGGCCAGAAGGCAGAGGG + Intronic
1145250534 17:21294662-21294684 CAGTGACTCCACAAGGGAGTAGG - Intronic
1145289462 17:21531776-21531798 CAGTGCATCCAGAAAGAGGAAGG + Exonic
1146112174 17:30099927-30099949 GAGTGAATACAGAAAAAAGAGGG - Intronic
1146596416 17:34173000-34173022 CTGTGAGGCTAGAAGGAAGATGG + Intronic
1146638163 17:34521164-34521186 CAGTGAGTCTAGAAGGTAGGTGG - Intergenic
1147162059 17:38574088-38574110 CAGGGAATCCAGTGGGAACAGGG - Intronic
1148985151 17:51614302-51614324 CTAATAATCCAGAAGGAAGAAGG + Intergenic
1149114081 17:53070629-53070651 CAGAGACTGCAGAAGGAAAATGG - Intergenic
1150207442 17:63419771-63419793 CAGAGAGGCCAGAAGGAAGATGG + Intronic
1150600281 17:66645360-66645382 CTGTGAATCAAGAAAGGAGAGGG - Intronic
1150884392 17:69068731-69068753 AACTGAATCCAGAAAGAAGTAGG + Intergenic
1151126210 17:71847449-71847471 CAATGACTCCATAAAGAAGATGG - Intergenic
1151459840 17:74248083-74248105 CAGTGGCTCCTGAAGGAGGACGG + Intronic
1151651273 17:75471326-75471348 CTCTGAATCCAGGAGGGAGAGGG - Intronic
1151996437 17:77612216-77612238 CAGTGTTTCCAGAAGGAGGGCGG + Intergenic
1152330549 17:79670181-79670203 CAGTGAATGCAGAGGGAAGTGGG - Intergenic
1152844186 17:82589537-82589559 CAGTGAATACAGAACGAATCAGG - Intronic
1152889542 17:82872752-82872774 CAGTGAAACCAGAATGACGGTGG - Intronic
1153160641 18:2200956-2200978 GAGTTAATACAGAAGGGAGAAGG + Intergenic
1153896356 18:9565566-9565588 CAGTGAACACACAAAGAAGAAGG + Intronic
1154145211 18:11861266-11861288 CAGGGACCCTAGAAGGAAGAAGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156580599 18:38370452-38370474 CAGTGAATCTGGAAGGCAGGAGG + Intergenic
1158167380 18:54555641-54555663 CAGTCATTCCAAAAGGAAGGAGG + Intergenic
1158588827 18:58762853-58762875 CAGGGAATACAGGAGGAAAATGG - Intergenic
1158857244 18:61554873-61554895 AAGGAAACCCAGAAGGAAGAGGG + Exonic
1159594944 18:70373913-70373935 CAGTGAATCAGGAAGAAGGAAGG - Intergenic
1161157175 19:2738575-2738597 CAGAGAAGCAAGAAAGAAGAAGG - Intronic
1163765265 19:19160295-19160317 CTGGGAAACCAAAAGGAAGAAGG + Intronic
1164479155 19:28598185-28598207 CAGTGATTCCAAAAGGCAGGAGG + Intergenic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1164644181 19:29845709-29845731 GGGTGAAACGAGAAGGAAGAAGG - Intergenic
1165429450 19:35764185-35764207 CAGTGACTCCAGTGGGAAGTGGG + Intronic
1165800098 19:38544015-38544037 CAGCCAATCCAGAAAGAGGATGG - Intronic
1166114165 19:40642543-40642565 CTGTAAATAAAGAAGGAAGAGGG + Intergenic
1167214240 19:48153881-48153903 CAGAGAAGCCAAGAGGAAGAAGG - Exonic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
1168471524 19:56644046-56644068 CAGTGAATGGAGGAGGAAGAAGG - Intronic
1168559096 19:57368530-57368552 CAGGGGACCCTGAAGGAAGAGGG - Exonic
925189521 2:1871494-1871516 CAGTGAAGCCGGAGGGCAGAGGG + Intronic
925387234 2:3470424-3470446 CAGAGAGTCCAGCAGGAACAGGG - Intronic
925445174 2:3920916-3920938 CAGTGAACCCTGAAAGAAAAGGG - Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
926007532 2:9384308-9384330 CTGTGAGGCCAGAAGCAAGATGG + Intronic
926056985 2:9779411-9779433 CAGAGTCTCCGGAAGGAAGATGG + Intergenic
926068926 2:9868676-9868698 AAGTGGATCCAGAAAGAAGGAGG + Intronic
926134357 2:10326164-10326186 GAATCAACCCAGAAGGAAGAGGG + Intronic
926421136 2:12700691-12700713 CAGTGACCCCACAAGAAAGATGG + Intergenic
926507145 2:13731261-13731283 CAGTGACTCCAAAAGGGAGAAGG - Intergenic
926688802 2:15718563-15718585 CAGTGAATCTGGCAGGATGAAGG - Intronic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
927919530 2:26961328-26961350 CATTCAATCCAGAGGGAAAAGGG + Intergenic
927946577 2:27138332-27138354 CCTTGAATCCAGAAGGAACTGGG + Exonic
927950485 2:27165048-27165070 CAGTAAATCCAAAAGGGAGGAGG + Intergenic
928040002 2:27865491-27865513 CAGTTAATCCAAAAGAAAGCAGG - Intronic
928203568 2:29267684-29267706 CAGTGAATCTAGGAGTAAAAAGG - Intronic
928578345 2:32679342-32679364 CAGAGAATTCAGAGGGAATATGG + Intronic
928800584 2:35085879-35085901 AAATGAATCTTGAAGGAAGAGGG - Intergenic
929240646 2:39649998-39650020 AAGAGACTCCAGAAGGAATATGG - Intergenic
929281372 2:40083877-40083899 CAGTGAATGCAGTACTAAGAGGG - Intergenic
930000740 2:46859983-46860005 CAGTGACCCCAGAAGGAGGAAGG + Intergenic
930512820 2:52367067-52367089 CACTGAATCCAGATGAAAGGAGG + Intergenic
930911845 2:56638316-56638338 CATTGAGACCAGGAGGAAGAAGG + Intergenic
931441111 2:62291259-62291281 CTGTGAGGCCAGAAGCAAGATGG - Intergenic
931901317 2:66791540-66791562 CACTGAATGCAGAGGGAAGTTGG + Intergenic
933315222 2:80706815-80706837 CGGGGGAGCCAGAAGGAAGATGG - Intergenic
933628861 2:84633713-84633735 AAGGGAAGCCAGCAGGAAGAAGG - Intronic
933861225 2:86470495-86470517 CAGTAAATCTAGAAGTAAAAAGG + Intronic
934534096 2:95118605-95118627 CAGGGATTCCAGAGGGAAGGGGG - Intronic
934744986 2:96753451-96753473 CAGTGCATTCAGCAGGTAGAGGG + Intergenic
935089872 2:99884885-99884907 CAGTGAATCCCCCAGGTAGAGGG - Intronic
935439354 2:103074146-103074168 CAGTGAAAGCAGAACTAAGAGGG + Intergenic
935708585 2:105877555-105877577 CTGTGTCTCCAGATGGAAGAGGG - Intronic
936460720 2:112712245-112712267 CAGGGATGCCAGAAGGAAGGGGG - Intergenic
937589589 2:123597172-123597194 CAGTTATTCCAAAAGGAAAAGGG - Intergenic
937912203 2:127081167-127081189 CACCGAACCCAGAAGGAGGAAGG + Intronic
938084134 2:128387134-128387156 CAATGAACCCATAAGAAAGAGGG + Intergenic
938828523 2:135031210-135031232 AAGTGAATACAGGAGGATGATGG + Intronic
939257785 2:139766696-139766718 CAGTGCAGGCAGAAGGAAGTGGG + Intergenic
940352648 2:152706375-152706397 AAGAGAATTCAGAAGGAAAACGG + Intronic
940435189 2:153644668-153644690 CAGTGAATCAAGAAGTAGGGTGG - Intergenic
942032585 2:171977761-171977783 AAAGGAATACAGAAGGAAGAAGG - Intronic
942320687 2:174733063-174733085 CATGGAACCCAGAGGGAAGACGG - Intergenic
942712113 2:178848268-178848290 CAGTGAATGCAGAAGCACAATGG + Intronic
943231163 2:185254372-185254394 CATTGAATACAGCAGGAACAGGG - Intergenic
943854243 2:192768149-192768171 TATTGAACCCTGAAGGAAGAAGG + Intergenic
944083065 2:195811855-195811877 CTGTGAGGCCAGAAGCAAGATGG - Intronic
944537434 2:200725086-200725108 CAGAGGGTCCAGCAGGAAGAGGG + Intergenic
945068484 2:205967457-205967479 CAATGGATCCTGAAGGAAAAAGG + Intergenic
945134068 2:206607101-206607123 CCTTGAATCCAGGAGAAAGAAGG - Intronic
945400973 2:209382437-209382459 CAGGGATTGCAGAAGGTAGAGGG + Intergenic
945426162 2:209705860-209705882 CAGAAAATCCAGAATGTAGATGG + Intronic
946444851 2:219729450-219729472 AAGTGAATCCGGAAGAAATAGGG + Intergenic
946472356 2:219974018-219974040 GAGTAAATACAGAAGGAAAATGG - Intergenic
947404858 2:229764593-229764615 CTGCTAAGCCAGAAGGAAGACGG + Intronic
947470027 2:230392868-230392890 CAGTGAATATTTAAGGAAGAGGG - Intronic
947499388 2:230660866-230660888 CAGAGAATCAGGAAGGAAGCTGG - Intergenic
947996838 2:234534996-234535018 GAGTGAAACCAGAAGGGAGAGGG - Intergenic
948044695 2:234934760-234934782 CAGAGAGTCCAGAATGGAGACGG - Intergenic
1168822939 20:788176-788198 AAGAGAATTCAGAAGGAAAATGG - Intergenic
1169398821 20:5261936-5261958 CAGTTAATCCACAAGGAAGTGGG - Intergenic
1169801866 20:9518795-9518817 CTGTGCATCCAGAAGGCAGAGGG + Intronic
1169816909 20:9666600-9666622 CATTGTAGCCAGAAGTAAGAAGG - Intronic
1169938977 20:10916598-10916620 TGGTGAATGCAGAAGGAAGAAGG - Intergenic
1170779499 20:19411513-19411535 AAGTGCATCCAGCAGCAAGAAGG + Intronic
1170792179 20:19517369-19517391 CAGTGAGTCCAGAGGGGAGATGG - Intronic
1170803096 20:19606679-19606701 CTGAGAATGCAGAGGGAAGAAGG + Intronic
1170827797 20:19811175-19811197 GAGTGATTCCAGAAGGATGGAGG + Intergenic
1171110161 20:22473348-22473370 GGGTGAATTCAGAAGGGAGATGG - Intergenic
1171174704 20:23042913-23042935 AAGTGACTCCAGAAGGTAGGAGG + Intergenic
1171289010 20:23969493-23969515 CATTGAGGCCAGAGGGAAGATGG + Intergenic
1172606318 20:36216681-36216703 CTGTGAATCCAGCTTGAAGAAGG + Intronic
1173228644 20:41177116-41177138 CAGTGGTACCAGAAGGTAGATGG + Intronic
1173435965 20:43032535-43032557 TAATTAATCCAGAAGGGAGAAGG + Intronic
1174199050 20:48794356-48794378 CAGAGAGTCCTGAAGGAAGCTGG + Intronic
1174638543 20:52023020-52023042 CAAAGAAAGCAGAAGGAAGAAGG - Intergenic
1174756823 20:53167158-53167180 CAATGAATCCAGAATAAAGTGGG + Intronic
1174910214 20:54600103-54600125 CATTCCTTCCAGAAGGAAGATGG + Intronic
1175621993 20:60455103-60455125 CAGTGAAACCAGAGGACAGATGG + Intergenic
1176216269 20:63949418-63949440 CTGTCAGTCAAGAAGGAAGACGG + Intronic
1176293372 21:5058129-5058151 CAGAAAACCCAGAAGGGAGATGG + Intergenic
1176597421 21:8759678-8759700 CACTGATTCCACAAGGGAGATGG + Intergenic
1178053463 21:28772782-28772804 TAGTGAATACAGAAGCAATATGG - Intergenic
1179132685 21:38652672-38652694 CAATGATTCCATAAGAAAGAAGG + Intronic
1179297901 21:40079629-40079651 CAGGAACTCCAGAAGGAAGGAGG - Intronic
1179425593 21:41275752-41275774 CAGTGAATCTAGAAGGCATCTGG - Exonic
1179537237 21:42060488-42060510 CACTGAAGCCTGAAGGGAGAAGG - Intergenic
1179863888 21:44205519-44205541 CAGAAAACCCAGAAGGGAGATGG - Intergenic
1181439671 22:22929209-22929231 CACTGAATCCAGGGGCAAGAAGG + Intergenic
1181483449 22:23215870-23215892 CAGTTAATCCAGGAGTTAGATGG + Intronic
1183172967 22:36201566-36201588 CAGTGAACAAAGCAGGAAGAAGG - Intronic
1183180309 22:36255412-36255434 CAGTGAACAAAGCAGGAAGAAGG + Intronic
1183652062 22:39162224-39162246 CTGTGAATCAAGTGGGAAGATGG + Intergenic
949858076 3:8480393-8480415 CAGTGAAGCCACAAGGCAGAGGG - Intergenic
950407637 3:12814631-12814653 CTGGGACTCCAGAAGGGAGAAGG - Intronic
950562592 3:13743385-13743407 CAGGGACTCCAAAAGGAGGAGGG - Intergenic
950743975 3:15072433-15072455 CAATGAACCAAAAAGGAAGAAGG + Exonic
952168354 3:30776722-30776744 CAGTCTAACTAGAAGGAAGAGGG - Intronic
952557432 3:34548825-34548847 CAGTAAATTCAGTAGCAAGAGGG - Intergenic
952719639 3:36519025-36519047 CTGGGATTCCAGAAGGAAGAGGG + Intronic
952846433 3:37691410-37691432 CAGTGAAGACAGTGGGAAGATGG + Intronic
953981056 3:47413142-47413164 GAGTGGATCCAGAAGGCTGAGGG - Exonic
954792569 3:53144076-53144098 CACTGAAGCCAGAGAGAAGAGGG - Intergenic
954904150 3:54045406-54045428 CAGTGATTCCTCAAGGAACATGG - Intergenic
956011233 3:64833777-64833799 CAGTGAATTCAGAAAGGGGAAGG + Intergenic
956615940 3:71172726-71172748 CAGTGAATCCAGAAGGAAGAGGG - Intronic
956866790 3:73376997-73377019 CATTGAATGCATAATGAAGAAGG - Intergenic
958107929 3:89102323-89102345 CAGAGTATCCAAAAGGCAGAAGG - Intergenic
958430419 3:94033551-94033573 TAGTAAATGCAGAAGGAATATGG + Intronic
958728299 3:97932838-97932860 CAGTGGATCTGGAAAGAAGATGG - Intronic
958962358 3:100522409-100522431 CTGTGAATTCAGAAGGAGGATGG - Intronic
959589294 3:108059896-108059918 TAGTGAAGACAGCAGGAAGAAGG - Intronic
960573415 3:119206797-119206819 CCCTGGAGCCAGAAGGAAGAGGG - Intergenic
960972669 3:123150706-123150728 CAGTGTCTGGAGAAGGAAGAGGG - Intronic
962422656 3:135241808-135241830 GAGTGAATTCTCAAGGAAGAAGG - Intronic
962777432 3:138675626-138675648 CAGGGAAGCCAGAAGAAAGTGGG + Intronic
964641717 3:158915704-158915726 CAGTGAACCCAAAACGAAGCTGG + Intergenic
965878687 3:173361027-173361049 CAGTGAATCTAGAACAAAGCAGG + Intergenic
965910788 3:173772788-173772810 CAGTGAATACAGAAAAAGGATGG - Intronic
967236701 3:187391937-187391959 CAATGATTCCAGAAAGCAGAAGG - Intergenic
968000510 3:195202572-195202594 CAGTGAAAGCTGAAGAAAGATGG - Intronic
968223972 3:196961025-196961047 CAGTCAAAGCAGCAGGAAGATGG - Intronic
968453047 4:684062-684084 CACTGATCCCAGAAGGCAGAGGG + Intronic
968491686 4:893598-893620 CAGTGACGTCAGAAGCAAGAAGG + Intronic
970564790 4:17321330-17321352 CAGTGAATCCCGGTGAAAGAAGG - Intergenic
971020961 4:22534888-22534910 AAGTAATTCCAAAAGGAAGATGG - Intergenic
971178205 4:24302125-24302147 AAATGAACCAAGAAGGAAGATGG - Intergenic
971642913 4:29158377-29158399 CTGTGAAGCTAGAAGCAAGATGG + Intergenic
972349721 4:38225531-38225553 CAGGGGACCCAGAAGGCAGAAGG - Intergenic
973074039 4:45900587-45900609 CTGTGAGTCTAGAAGCAAGATGG + Intergenic
973333104 4:48929840-48929862 TCTTGAATCCAGAAAGAAGAAGG + Intergenic
975314594 4:72937166-72937188 CATTGAATCCAAAAAGATGAGGG - Intergenic
975581630 4:75912004-75912026 CTGTGAGGCTAGAAGGAAGATGG + Intergenic
976895430 4:90104304-90104326 CAGTCAAACGAGAAGGAACATGG + Intergenic
977297050 4:95222218-95222240 CAGAGAACCCAGAATGAATATGG - Intronic
977474685 4:97490589-97490611 CAGTGAAACCAGGAGGTACAGGG - Intronic
977708158 4:100094249-100094271 CAGTAAAACCAGAAGGCTGAAGG - Intergenic
977756949 4:100682782-100682804 CAGGGGAGCCAGAAGGGAGATGG - Intronic
978352881 4:107838892-107838914 CAGTGGCTACAGAAGGCAGATGG - Intronic
978735523 4:112079978-112080000 AAGTGAATACATAAGAAAGAAGG - Intergenic
980740015 4:136938323-136938345 CTGGGAATCAAGAGGGAAGAAGG + Intergenic
980762735 4:137256941-137256963 CAGTATATCAGGAAGGAAGATGG + Intergenic
981235678 4:142412669-142412691 CAGAGAATACAGAAGAAAGATGG - Intronic
981521145 4:145663643-145663665 CAGTGAATGGAGAAGGGAGTGGG + Intergenic
982035845 4:151344939-151344961 GAGAAAATCAAGAAGGAAGAAGG - Intergenic
983620052 4:169751525-169751547 CCGTGAATAGAGAAGGAAGATGG - Intronic
986044320 5:4022800-4022822 CAGGGAGTCCAGCAGGGAGAAGG - Intergenic
987036446 5:14023693-14023715 CAGTGAAGCCAGCAGGACCAAGG + Intergenic
987533299 5:19149676-19149698 CGGGGAATCCAAAAGGAGGAAGG + Intergenic
987716945 5:21584481-21584503 GCGTGAATCCAGAAGGGTGAGGG - Intergenic
988950173 5:36248263-36248285 CAGTGATTCTAGAAGAAATATGG - Intergenic
989112745 5:37922969-37922991 CTGAGAACTCAGAAGGAAGAAGG - Intergenic
989234842 5:39134880-39134902 CAGACAACCCAGAAGGAAAATGG - Exonic
989502696 5:42187732-42187754 TAGTGAATACAACAGGAAGAAGG + Intergenic
990325466 5:54671062-54671084 GTGTGAATCCAGGAGGAACATGG + Intergenic
990552280 5:56894942-56894964 CATGGAATCCTGAAGGAAAATGG + Exonic
992152087 5:73914824-73914846 CAGTGAGTCCAGGAGGTGGATGG - Intronic
992408527 5:76482521-76482543 TAGTACATACAGAAGGAAGAGGG + Intronic
993371386 5:87096919-87096941 CACTGAATCCTGAGAGAAGATGG - Intergenic
995365374 5:111353958-111353980 CAGTGAATCCAAAGGAAATAAGG + Intronic
995530846 5:113090640-113090662 CAGTCTACCCAGAAGGACGATGG + Intronic
995654846 5:114414083-114414105 CAGAAAATCCAGCAGGAAGTAGG - Intronic
996646713 5:125826395-125826417 AAGTGGATCCAGAAGGAGAATGG - Intergenic
997632541 5:135379721-135379743 CACTGAAAGGAGAAGGAAGAAGG - Intronic
999117248 5:149174671-149174693 CAGTGTATCCTGAAGGAAAGAGG - Intronic
1000012889 5:157249275-157249297 CAGAAAATCGAGAAGGAAGCTGG - Intronic
1000111792 5:158115117-158115139 CTTTGAATCCAGGAGGAAGGTGG + Intergenic
1000451524 5:161394808-161394830 CAGAAAATAGAGAAGGAAGATGG + Intronic
1001137200 5:169112480-169112502 CAGAGCCTCCAGATGGAAGAAGG - Intronic
1001461820 5:171922521-171922543 AAGGCAATTCAGAAGGAAGAAGG + Intronic
1002002555 5:176206272-176206294 TGGTGAAAGCAGAAGGAAGAGGG + Intergenic
1002224045 5:177705340-177705362 TGGTGAAACCAGAAGGAAGAGGG - Intergenic
1002319377 5:178365897-178365919 CAGTGAACACAGCAGGAAGGGGG + Intronic
1003429399 6:6025197-6025219 CATTGAAACCTGAAGGAAAAAGG + Intergenic
1003454480 6:6269027-6269049 AAGTAAAGGCAGAAGGAAGAAGG + Intronic
1003540267 6:7012515-7012537 CAGTGAGTCCTGAAGGAAGGAGG + Intergenic
1005445438 6:25917793-25917815 CAGTGAATCCAGTAATTAGAGGG - Intronic
1006674403 6:35751875-35751897 CAGTGTATTCAGCAGCAAGAAGG - Intergenic
1007124805 6:39417006-39417028 CAGTGAATCTAGGAGGCAGGAGG - Intronic
1007403061 6:41615586-41615608 CAGCTAATCCAGAGGGAGGAGGG + Intergenic
1008103412 6:47416897-47416919 CTGTGAAGCCAAAAGCAAGATGG + Intergenic
1009321924 6:62302008-62302030 CAGTGCATCCAGTAGGGAAAAGG + Intergenic
1009352876 6:62704630-62704652 CAGTGAAGGCAGTAGCAAGATGG - Intergenic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1010722004 6:79293446-79293468 TAGTGATTCCAAAAGGAGGAGGG - Intergenic
1011133501 6:84075286-84075308 CTGTGTATCCAGAAGGAAAGAGG + Intronic
1011290119 6:85768243-85768265 TAGTGAATTAAGAAGGAAAATGG + Intergenic
1012175534 6:96077570-96077592 CAATCAATCCAGATGGAAAAAGG - Intronic
1012206184 6:96463194-96463216 CACTGAAACCAGAAGTAAGCTGG + Intergenic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1012553080 6:100482016-100482038 CAGGGACTCCAGAGGGAAGCGGG + Intergenic
1013067505 6:106698092-106698114 CTGTGAGTCTAGAAGCAAGATGG + Intergenic
1013189855 6:107792989-107793011 TATTGAATCCAAAAGGAGGAAGG + Intronic
1013680709 6:112522411-112522433 CTGTGAGGCTAGAAGGAAGATGG - Intergenic
1013908815 6:115249938-115249960 CAGTGAATGCAGTACTAAGAGGG + Intergenic
1013930002 6:115519081-115519103 CAGTTAAGGCAGTAGGAAGAGGG + Intergenic
1014465710 6:121754307-121754329 CAGAGAATTCAGCAGGGAGATGG - Intergenic
1015555768 6:134459842-134459864 CAGTGAGTGCAGAAGGAAGCGGG - Intergenic
1015966237 6:138697281-138697303 AAGTGACTGCAGATGGAAGAGGG - Intergenic
1017646075 6:156541029-156541051 GAGGGAATTCAGAGGGAAGAGGG + Intergenic
1018141452 6:160841526-160841548 CAGTGAACCCAGAAAAACGACGG - Intergenic
1018142576 6:160853931-160853953 CAGTGAACCCAGAGAAAAGATGG - Intergenic
1019293126 7:260061-260083 CAGTGAATTCAGAGGCAGGACGG + Exonic
1019521359 7:1461832-1461854 CAGTGAGGCCAGAAGGCAGCGGG - Intergenic
1021889616 7:25174615-25174637 AAGTGAATCCAGAAACAAAATGG + Intronic
1022535351 7:31095252-31095274 ACGTGAATCCAGGAGGAAGGAGG + Intronic
1022646227 7:32230684-32230706 CAGTGACTCAAGCAGGAAAAGGG - Intronic
1023974148 7:45015451-45015473 CAGTGAATCCAGGAAGGGGAAGG - Intronic
1024407168 7:48995102-48995124 CTTTGAAGCCAGAAGCAAGAGGG + Intergenic
1024860775 7:53837296-53837318 CAGTGAAAACAGCAGTAAGAGGG + Intergenic
1026556366 7:71412107-71412129 TAGAGAATGTAGAAGGAAGAAGG - Intronic
1027034692 7:74916559-74916581 CAGTGAATCCTCAGGAAAGAAGG + Intergenic
1027499523 7:78931338-78931360 CAGTTATTCCAGGAGGAAGAGGG - Intronic
1027634179 7:80648890-80648912 CAGTGAAGATGGAAGGAAGAAGG + Intronic
1027689820 7:81330386-81330408 CAAGGGATCCAGAAGGAAAAAGG - Intergenic
1027730547 7:81866820-81866842 CATTCATTCCAGAATGAAGAGGG + Intergenic
1030488409 7:110200831-110200853 CAGTGAATGCAGTACTAAGAGGG - Intergenic
1030527108 7:110667537-110667559 CAGTGAAAGCAGGAGGCAGAAGG + Intronic
1030645689 7:112058873-112058895 AAGTGAAGGCAGAAAGAAGAAGG + Intronic
1030922252 7:115406106-115406128 CAATGAAACCAAAAGGAAAATGG - Intergenic
1031082975 7:117276240-117276262 CAGTTCATCCAGCAGGAGGAAGG + Intergenic
1032794660 7:135268190-135268212 CAGTGGACCCAGGAGGAAGGAGG - Intergenic
1033074949 7:138240118-138240140 CTGTGCGGCCAGAAGGAAGATGG + Intergenic
1033097691 7:138445164-138445186 AAGAGAATTCAGAAGGAAAATGG - Intergenic
1033166303 7:139041369-139041391 CAGTGAACACTGAAGGAAAAGGG + Intergenic
1035032161 7:155868442-155868464 CTGTTTAGCCAGAAGGAAGAGGG + Intergenic
1035117130 7:156533839-156533861 CAGTGAAGGCAGAAGGAAGAGGG + Intergenic
1036104572 8:5826003-5826025 AAGAGAATTCAGAAGGAAAATGG - Intergenic
1037115385 8:15219678-15219700 AAGTGAATACAGAAGGAAACAGG + Intronic
1038092757 8:24272359-24272381 CAGTGTAGTCAGAAGGAAGGTGG - Intergenic
1038280180 8:26156905-26156927 CTGTGCAGCCAGAAGCAAGATGG + Intergenic
1038408058 8:27336916-27336938 GCTTGAATCCAGAAGGCAGAGGG - Intronic
1039305199 8:36254595-36254617 CCGTGAGGCCAGAAGCAAGATGG - Intergenic
1039313236 8:36343035-36343057 AAGTCAGTCCAGAAGGAAAAGGG - Intergenic
1039893399 8:41699369-41699391 CAGGGATTCCAGAGGGAGGAAGG - Intronic
1040608716 8:48961332-48961354 AAGTGATTCCAGAAAGCAGAAGG + Intergenic
1040621780 8:49099998-49100020 AGGAGAATTCAGAAGGAAGATGG + Intergenic
1040875076 8:52142245-52142267 CAGAGAATCCAGGTGGAAGCTGG + Intronic
1040884079 8:52240464-52240486 CTGTTAAACCAGAAGAAAGAAGG - Intronic
1041360944 8:57053440-57053462 AAGAGAAACCAGAATGAAGAAGG - Intergenic
1042018967 8:64349384-64349406 CTGTAAATCCTGAATGAAGAAGG + Intergenic
1042286770 8:67121765-67121787 CAGTGAAACCATAAGGTACAGGG + Intronic
1042880244 8:73479928-73479950 CAGGGAAACCAGTAGGAAGACGG - Intronic
1043183564 8:77116656-77116678 TAGTGAATTTAGAAGGAACAGGG - Intergenic
1043572816 8:81624452-81624474 CAGTGAAACTAAAAGCAAGAAGG + Intergenic
1043947049 8:86265083-86265105 CTGTGAAGCTAGAAGCAAGATGG + Intronic
1044129602 8:88505546-88505568 CAGGGAATCCAGATGACAGATGG + Intergenic
1045649353 8:104327969-104327991 CTGTGAAGCTAGAAGCAAGATGG + Intergenic
1046250460 8:111624234-111624256 TGGGGAAGCCAGAAGGAAGATGG + Intergenic
1047948934 8:129911799-129911821 CAGGAGATCCAGAAGTAAGAAGG - Intronic
1048349237 8:133602611-133602633 CAGTGATAGCAGAAAGAAGAGGG + Intergenic
1048493666 8:134917625-134917647 TAGTGAATCCAGAGGGAAGGAGG - Intergenic
1048852811 8:138660451-138660473 CAGGAAATCCAGGAGAAAGAGGG - Exonic
1049950013 9:634741-634763 CTGTGAGGCCAGAAGCAAGATGG + Intronic
1050348185 9:4714489-4714511 CAGTGAATTTAGAAGCAGGAGGG - Intronic
1050721581 9:8597541-8597563 CAGTGAAAATAAAAGGAAGAAGG + Intronic
1051235971 9:14999543-14999565 CTGTGAATAGAGAAGGAAGATGG + Intergenic
1052729170 9:32265119-32265141 CTGTGAAGCTAGAAGCAAGATGG + Intergenic
1052857905 9:33418399-33418421 CAGAGAGTACAGCAGGAAGAGGG + Intergenic
1055379702 9:75692782-75692804 CAGGGAATACAGAAAGAAGATGG - Intergenic
1057370198 9:94464535-94464557 TAGAGTATCCAGAAGGAAGAAGG + Intergenic
1057957183 9:99419952-99419974 AAGTGATTCAAGAAGGAACAAGG - Intergenic
1058816797 9:108691822-108691844 CAGTGTAGCCACAAGGAAGCAGG + Intergenic
1059562625 9:115349939-115349961 AAGTGAATAGAGAAGGAAAAAGG + Intronic
1060542848 9:124442567-124442589 CATTCAAGGCAGAAGGAAGAGGG + Intergenic
1061578532 9:131522758-131522780 CAGTGCATCCAGGTGGGAGATGG + Intronic
1062525460 9:136976436-136976458 CACAGAATCCAGGAAGAAGACGG + Intergenic
1185839609 X:3376369-3376391 CAGTGATTCCAAAAGGGAGGAGG - Intergenic
1186490822 X:9970602-9970624 CAGAGATTCCTGTAGGAAGAAGG - Intergenic
1187122558 X:16423375-16423397 TACTGAACCCAGAAGCAAGAAGG + Intergenic
1188080246 X:25829784-25829806 AAGTGGATTCAAAAGGAAGACGG - Intergenic
1189083941 X:38000776-38000798 TAGCGAAGCCAGAAGGGAGATGG + Intronic
1189087072 X:38036566-38036588 CAGTTAATGCAGATGGAACAAGG - Intronic
1189368125 X:40405626-40405648 CAGTGAATCCAGAAGGAAAAAGG - Intergenic
1190124930 X:47695874-47695896 AAGTGAAATCAGAAGGCAGAAGG - Intergenic
1190762445 X:53447854-53447876 AAGGGAATGCAGGAGGAAGAGGG - Intergenic
1190782802 X:53614669-53614691 CCATCAATCCAGAAGGCAGATGG - Exonic
1191738831 X:64416386-64416408 CAGAGCATTCAGAAGGAACATGG - Intergenic
1192597197 X:72423463-72423485 GACTGAATCTAGAAGGAAGTTGG - Intronic
1194148731 X:90296987-90297009 CAGTAATTCCAAAAGGGAGAAGG + Intergenic
1194262230 X:91710520-91710542 CAGTAATTCCAAAAGGAAGAAGG + Intergenic
1194892294 X:99394957-99394979 CAGTGAAAGCAGCAGTAAGAGGG - Intergenic
1194897576 X:99464059-99464081 CAGTTAACCCAGAAGGAATGTGG - Intergenic
1195295357 X:103471189-103471211 GAGTGAATACACAAGGAAAATGG + Intergenic
1197290372 X:124649037-124649059 GAGGGACTCCAGGAGGAAGATGG + Intronic
1197576780 X:128222737-128222759 GATTTAATCCTGAAGGAAGAAGG + Intergenic
1197734826 X:129843176-129843198 CAGGGAAACGAGAAGGTAGAAGG + Intronic
1198144195 X:133838700-133838722 CAGTTAAGCCAGGAGCAAGAAGG - Intronic
1200132466 X:153858374-153858396 AAGTGATTCCAGAAAGAAGCCGG + Intergenic
1200384904 X:155880818-155880840 CAGGGAATAGAGATGGAAGAGGG + Intergenic
1200495102 Y:3873719-3873741 CAGTAATTCCAAAAGGGAGAAGG + Intergenic
1200581526 Y:4955353-4955375 CAGTAATTCCAAAAGGAAGAAGG + Intergenic
1200895659 Y:8373578-8373600 AAGTGAATACAGAAGAAAGTTGG - Intergenic
1201236206 Y:11914495-11914517 CAGTGATTCCAAAAGGGAGGAGG + Intergenic
1201955535 Y:19618415-19618437 CAGTGAAACCAGATGGCAGCTGG + Intergenic