ID: 956616105

View in Genome Browser
Species Human (GRCh38)
Location 3:71174360-71174382
Sequence GTGGCTATTTAGAGGCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956616105_956616109 -7 Left 956616105 3:71174360-71174382 CCCAGCTGCCTCTAAATAGCCAC 0: 1
1: 0
2: 1
3: 11
4: 125
Right 956616109 3:71174376-71174398 TAGCCACTGCACTCCAGCCTGGG 0: 571
1: 10489
2: 175158
3: 257853
4: 193506
956616105_956616111 1 Left 956616105 3:71174360-71174382 CCCAGCTGCCTCTAAATAGCCAC 0: 1
1: 0
2: 1
3: 11
4: 125
Right 956616111 3:71174384-71174406 GCACTCCAGCCTGGGCAACACGG 0: 2407
1: 4469
2: 6286
3: 8462
4: 41765
956616105_956616108 -8 Left 956616105 3:71174360-71174382 CCCAGCTGCCTCTAAATAGCCAC 0: 1
1: 0
2: 1
3: 11
4: 125
Right 956616108 3:71174375-71174397 ATAGCCACTGCACTCCAGCCTGG 0: 455
1: 1748
2: 17173
3: 194844
4: 274037

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956616105 Original CRISPR GTGGCTATTTAGAGGCAGCT GGG (reversed) Intronic
900691130 1:3981308-3981330 GAGTCTTGTTAGAGGCAGCTGGG - Intergenic
901699672 1:11038533-11038555 GTGGGTTTTTAGGGGCAGCTGGG - Intronic
901950207 1:12739156-12739178 GTGGCAACATAGATGCAGCTGGG + Intergenic
905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG + Intronic
906247391 1:44286361-44286383 GTGCCTAGTTTGAGGCACCTAGG + Intronic
908434384 1:64091046-64091068 GTAGATGGTTAGAGGCAGCTAGG + Intronic
908466476 1:64401394-64401416 GTTGCTTTCTAGAGGCAGCAGGG - Intergenic
913064002 1:115232875-115232897 GTGGCATTTTAGATGGAGCTGGG + Intergenic
917380297 1:174398815-174398837 GTCACTATTAAGAGGCAGTTGGG - Intronic
920928752 1:210367379-210367401 ATGGCTATCTAGAGGCACGTAGG - Intronic
921590997 1:217002908-217002930 TTGGAAATTTAGAAGCAGCTTGG - Intronic
921953202 1:220955342-220955364 GTGTCTGTTTTGTGGCAGCTGGG + Intergenic
924213660 1:241796146-241796168 GTGTGTATTTTGAAGCAGCTGGG + Intronic
924722620 1:246637598-246637620 GTGGGTTTCTAGAGCCAGCTTGG + Intronic
1063590460 10:7390728-7390750 GTGTCTAGTTAGAGGCAAATGGG - Intronic
1063848336 10:10157039-10157061 GTGGCTATTTCCTGGCAGTTGGG - Intergenic
1063898412 10:10706287-10706309 GTGTCTACTTAGTGCCAGCTAGG - Intergenic
1067430322 10:46238629-46238651 GTGAATATTTTGGGGCAGCTTGG - Intergenic
1068395480 10:56456481-56456503 GTGGCGATTCAGAGGCTACTGGG - Intergenic
1071129885 10:82378405-82378427 GTGGCAATGCAGAAGCAGCTGGG + Intronic
1071528437 10:86371915-86371937 GAGGCTCTTCAGAGGAAGCTCGG + Intergenic
1075602148 10:123777602-123777624 GTGACAATTTGCAGGCAGCTAGG - Intronic
1079078999 11:17401065-17401087 GAGGCTGTTTACAGGAAGCTGGG + Intronic
1080967586 11:37231505-37231527 GTGTCTATTTAGGGCCATCTGGG - Intergenic
1081111501 11:39139459-39139481 TTTGCTATTTAGAGTCAGTTAGG - Intergenic
1086549455 11:88039232-88039254 GTGGCAATTTAGAGACTGCTTGG + Intergenic
1089869863 11:121662799-121662821 GGGGCTATTTTGATTCAGCTAGG + Intergenic
1089951610 11:122533435-122533457 AAGGCTTTTTAGAAGCAGCTTGG + Intergenic
1091836527 12:3590005-3590027 TTGACTATTTAGAGGTAGCTGGG + Intronic
1092853333 12:12650284-12650306 GTGGTCATTTAAAGGAAGCTGGG - Intergenic
1092988992 12:13876601-13876623 GTGGCTATTTGGTGGCTGGTAGG - Intronic
1095083194 12:38031005-38031027 GTGGCTATTTTGCGGTACCTGGG + Intergenic
1096789169 12:54034481-54034503 GAGGCTCTTTAGAGGCAGCGGGG + Exonic
1101738942 12:107484762-107484784 GTGGGTATTGAGAAGCAGTTGGG + Intronic
1103913621 12:124364923-124364945 GGGGGTATTTGGAGGCAGCCTGG + Intronic
1106027991 13:25973384-25973406 CTGCCTGTTTAGAGGCAGCCTGG - Intronic
1110926515 13:81160998-81161020 GTGGCAATGTGGATGCAGCTGGG + Intergenic
1111182777 13:84690387-84690409 GTGGCTATATAGAAGCACTTTGG - Intergenic
1112255968 13:97831503-97831525 GTGGAGACTTAGAGGGAGCTAGG - Intergenic
1113028995 13:105973328-105973350 TTGGCTCTTTACAGGCAGATAGG - Intergenic
1113669702 13:112167403-112167425 GTGGCTTTTGAGAGGCAGAGGGG + Intergenic
1115742696 14:36404670-36404692 GAGGCTCTTTGGAGGCAGATTGG - Intergenic
1116004906 14:39282193-39282215 GTTGCTTTTCATAGGCAGCTAGG + Intronic
1118942390 14:70349615-70349637 CTGGGTTTTTAGAGCCAGCTTGG - Intronic
1121089435 14:91170952-91170974 GTTGCTGATCAGAGGCAGCTGGG - Intronic
1122353716 14:101111580-101111602 GTTGCTATTTAAAGGCATCTTGG - Intergenic
1125780275 15:42259593-42259615 GAGGCTATTAAGAGGCTGATTGG + Intronic
1130134078 15:81167335-81167357 GTGGCTACCTTGAGGCAACTTGG - Intronic
1137071049 16:35905113-35905135 GTGGGTTTCTAGAGCCAGCTTGG + Intergenic
1139368313 16:66447589-66447611 GTTGGCATTGAGAGGCAGCTTGG + Intronic
1140979734 16:80095896-80095918 GAGGCAATTTAGAGGGAGCTAGG + Intergenic
1143805970 17:9427080-9427102 GTTGCTATCTAGAGGCTTCTGGG + Intronic
1144497471 17:15757597-15757619 GTGGCTCCTTAGAGGAATCTGGG + Intergenic
1144629264 17:16862081-16862103 GTGGCTCCTTAGAGGAATCTGGG + Intergenic
1144652162 17:17014034-17014056 GTGGCTCCTTAGAGGAATCTGGG - Intergenic
1145099574 17:20063062-20063084 ATGGCTCTTGAGAGGCAGTTGGG - Intronic
1145160835 17:20572647-20572669 GTGGCTCCTTAGAGGAATCTGGG + Intergenic
1148227688 17:45910383-45910405 GTGGCTAATTTGAGGCCGGTAGG + Intronic
1150719650 17:67603419-67603441 GTGGCTATCTAAAGACAGGTTGG - Intronic
1151658472 17:75506687-75506709 GTGGCTGTTCAGAAGCAGCTGGG + Exonic
1152210885 17:79002572-79002594 GTGGCTGATTAAAGCCAGCTAGG + Intronic
1153613076 18:6907679-6907701 GTGGCTATAAAGAGGCAACAGGG + Intronic
1157329096 18:46690203-46690225 GTGCCTATTTGTAGGCAGCAGGG + Intronic
1164913721 19:32032865-32032887 GTGGCTATAAAGAGGAATCTAGG - Intergenic
929054277 2:37862694-37862716 GTGGCTGCTTAGTGGGAGCTGGG + Intergenic
929564075 2:42974024-42974046 GTGGCTACAGAGAGGCTGCTAGG + Intergenic
931276471 2:60747934-60747956 GAGACTATTTAGAGCCAGCGTGG + Intergenic
931311040 2:61080766-61080788 GTTGTTATTTAGAGACAGATTGG + Intronic
933806593 2:86002824-86002846 GTGGATATTGAGAGTCACCTTGG + Intergenic
935297038 2:101658755-101658777 TTGGCTGTTTAGAGGAAACTTGG - Intergenic
936874409 2:117171583-117171605 ATAGCCATTTAGAAGCAGCTAGG - Intergenic
940057261 2:149526112-149526134 ATGGCTGATTAGAAGCAGCTGGG - Intergenic
942542674 2:177031079-177031101 GCGGCTAGTTAGATGCAGCCTGG - Intergenic
943459176 2:188148896-188148918 GTAGCTATCCAGAGGTAGCTTGG + Intergenic
946291059 2:218745884-218745906 GTGCCTATGTCGGGGCAGCTGGG + Intronic
949010794 2:241677272-241677294 GTGGCCAGTGAGAGGCATCTGGG - Intronic
1173678937 20:44862437-44862459 GGGGCAATTGAGATGCAGCTTGG - Intergenic
1174492591 20:50911808-50911830 GTGCCTGTTCAGAGGTAGCTGGG - Intronic
1178581808 21:33844646-33844668 CTGGATATTGAGAGGCATCTTGG - Intronic
1182891000 22:33818796-33818818 GTGGCTTTTTCGAGGCAAATTGG + Intronic
949370799 3:3332792-3332814 GCTGCTATGTAGAGGCAGGTAGG + Intergenic
950569339 3:13790560-13790582 GTGGCTCTACAGAGCCAGCTGGG + Intergenic
950692971 3:14675560-14675582 GTGACTATATAGATGCAGCCTGG - Intronic
952008739 3:28875006-28875028 GTGGATATTTATGGGCACCTGGG + Intergenic
954986119 3:54793681-54793703 GTGGCTTTGTAGAGAAAGCTGGG + Intronic
956616105 3:71174360-71174382 GTGGCTATTTAGAGGCAGCTGGG - Intronic
958222000 3:90700222-90700244 GTGGCTATTTAGAGGGGTTTTGG - Intergenic
961714597 3:128849799-128849821 GTGGCCATGTGGGGGCAGCTAGG + Intergenic
962609625 3:137063514-137063536 CTGGCTATTTACAGCCAGCAAGG + Intergenic
964097192 3:152946037-152946059 GTGGCTCTGTATTGGCAGCTAGG - Intergenic
966905958 3:184525905-184525927 GTGGGTATTCACAGGGAGCTGGG + Intronic
970723160 4:19011135-19011157 GTGGCTATTTAAAGGCATCCTGG + Intergenic
970794263 4:19892699-19892721 GTGGGTTTCTAGAGCCAGCTTGG - Intergenic
972785539 4:42323381-42323403 GTGGCCATTAAGATACAGCTTGG - Intergenic
973052524 4:45612448-45612470 GTGGGTTTCTAGAGCCAGCTTGG - Intergenic
973291897 4:48479192-48479214 GTGGCTATTCATAGGCATGTAGG - Intergenic
975534545 4:75435662-75435684 GAGCTTATTTTGAGGCAGCTGGG - Intergenic
975666291 4:76738544-76738566 GTGATTAATTAGAGGCAGATAGG + Intronic
976299612 4:83505741-83505763 GTGGGTGTCTAGAGCCAGCTTGG + Intronic
979863866 4:125728504-125728526 TTGTCTATTTATAGGTAGCTTGG + Intergenic
980778081 4:137462263-137462285 GGGGCTTTTCAAAGGCAGCTTGG - Intergenic
983058923 4:163132591-163132613 GTGACTATAAAGAGGCAACTGGG + Intronic
985877224 5:2609422-2609444 GTGGGAATTTAGAGCAAGCTAGG + Intergenic
986974644 5:13381293-13381315 ATGGCTGACTAGAGGCAGCTAGG + Intergenic
1007558624 6:42787009-42787031 CTGGCTATTTAGAGGAAGAGAGG + Intronic
1007760875 6:44133129-44133151 GTGTGTTTTTAAAGGCAGCTTGG + Intronic
1011254745 6:85408740-85408762 GTGGCTACTCTGAGGGAGCTGGG + Intergenic
1011806341 6:91076912-91076934 GTGGCTGGTTTGAAGCAGCTGGG + Intergenic
1013399561 6:109779241-109779263 GAAGCTATTTAGATACAGCTTGG + Intronic
1013892813 6:115045397-115045419 GTGACTATTTAGAGCTAGATGGG - Intergenic
1017015919 6:150099406-150099428 GTGGGTTTCTAGAGCCAGCTTGG - Intergenic
1019349389 7:546784-546806 GTGGCTATAAAAAGGCAGCTGGG - Intergenic
1021688489 7:23210597-23210619 TTGGCTTTTTAGAAGCTGCTTGG - Intergenic
1022605044 7:31804811-31804833 GTGGCTATTAAGTGACAGGTGGG + Intronic
1023785761 7:43706056-43706078 ATGGCTATCTAGAGGCAGCTAGG - Intronic
1026296907 7:69060723-69060745 GTGACTATTTACAGGGAGGTGGG - Intergenic
1026534395 7:71228175-71228197 GGGGCTGTTTAGAGACAGCTGGG - Intronic
1031846161 7:126807690-126807712 ATGGGTCTTTAGAGGCAACTGGG - Intronic
1034383013 7:150715596-150715618 GGGGCTATTGTGAGGCAGGTGGG - Intergenic
1034439785 7:151080793-151080815 GCGGCTATCTAGGGGCTGCTGGG - Exonic
1035855044 8:2965389-2965411 GTAGGAATTTAGAGGCAGGTTGG - Intronic
1039638783 8:39195229-39195251 GTGGCCAATTAGACGCAGCCAGG - Intronic
1039907306 8:41796516-41796538 GAGGCTCTGTAGAGGAAGCTTGG - Intronic
1042277215 8:67018473-67018495 GTGGCTATTCACAGGCATGTAGG + Intronic
1050081697 9:1922240-1922262 GGGGCTGTTCACAGGCAGCTGGG + Intergenic
1055824231 9:80304676-80304698 GTGGCTATTTATTCCCAGCTAGG + Intergenic
1059413837 9:114151125-114151147 GTGGGTCTTCAGAAGCAGCTTGG + Intergenic
1060000151 9:119951296-119951318 GTTGGTATTTAGAGACAGCTAGG - Intergenic
1061013969 9:127971429-127971451 GCTGCAATTGAGAGGCAGCTGGG - Intronic
1061469833 9:130815713-130815735 GTGTTTATTTAGAAGGAGCTGGG - Intronic
1061518959 9:131106154-131106176 GTGGGTATCAGGAGGCAGCTCGG - Intronic
1062104136 9:134743580-134743602 GTGGCAATTTGGAGAAAGCTTGG - Intronic
1187954664 X:24505345-24505367 GTGGTTTATTGGAGGCAGCTTGG + Intronic
1191151429 X:57223966-57223988 GTGAGTTTTTAGAGCCAGCTTGG - Intergenic
1193128402 X:77893998-77894020 GTGGCTATCTCTAGGCAGTTGGG - Intronic
1195104986 X:101594609-101594631 ATGGCCAATTAGAAGCAGCTAGG - Intergenic
1197489439 X:127100150-127100172 ATGGCCACTTAGAAGCAGCTGGG + Intergenic
1198843442 X:140883314-140883336 GTGTCTATTTAGAATCAGATTGG + Intergenic