ID: 956617337

View in Genome Browser
Species Human (GRCh38)
Location 3:71185582-71185604
Sequence CTGGGTAGACAGATAGTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956617333_956617337 17 Left 956617333 3:71185542-71185564 CCACATCTAATCTCTGGAAATCG 0: 1
1: 0
2: 0
3: 9
4: 95
Right 956617337 3:71185582-71185604 CTGGGTAGACAGATAGTCCCAGG 0: 1
1: 0
2: 0
3: 10
4: 122
956617332_956617337 18 Left 956617332 3:71185541-71185563 CCCACATCTAATCTCTGGAAATC 0: 1
1: 0
2: 0
3: 20
4: 198
Right 956617337 3:71185582-71185604 CTGGGTAGACAGATAGTCCCAGG 0: 1
1: 0
2: 0
3: 10
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956617337 Original CRISPR CTGGGTAGACAGATAGTCCC AGG Intronic
900004048 1:32547-32569 CTGGGTAGACTTCTAGACCCAGG - Intergenic
900023776 1:203067-203089 CTGGGTAGACTTCTAGACCCAGG - Intergenic
900373671 1:2343762-2343784 CTGGGGAGGCAGCCAGTCCCCGG - Intronic
901958995 1:12809908-12809930 CTGGTTAGCCTGATAGGCCCTGG + Intergenic
904460712 1:30678146-30678168 ATGGGTAGAGAGAAAATCCCGGG - Intergenic
905616304 1:39402567-39402589 CTGGCTAGAAAGATAGCACCAGG + Intronic
906100555 1:43257702-43257724 CTGGGCACACAGATGTTCCCAGG - Intronic
914795316 1:150915320-150915342 CTGGGTGGCCAGATAATCCTTGG + Intergenic
918119137 1:181522297-181522319 CAGAGTAGAGACATAGTCCCTGG + Intronic
923838041 1:237636325-237636347 CTGGGTAGACACTTAGTGCATGG + Intronic
1065204064 10:23341733-23341755 CTGGGTAGAAAGATGGTGCCTGG - Intronic
1065754238 10:28916414-28916436 CTGTGTAGACAGAATTTCCCAGG + Intergenic
1072270171 10:93768606-93768628 CTGGGATGAGAGATAATCCCAGG + Intronic
1076501913 10:130943855-130943877 CTGGGTACTCAGATGGTCCTGGG + Intergenic
1076678035 10:132158104-132158126 CTGAGTAGACAGATGCTGCCGGG - Intronic
1080762165 11:35262166-35262188 CTGGGCAGACAGTCTGTCCCTGG - Intronic
1081717522 11:45260948-45260970 CTGAGTGGACAGAGTGTCCCTGG - Intronic
1084137557 11:67197476-67197498 CTGGATAGAAAGTTAGTCACTGG - Intronic
1087511328 11:99098887-99098909 CTGTCTAGACAGATGGTCTCTGG - Intronic
1087701979 11:101445055-101445077 CTGGGCAGCCACAAAGTCCCAGG + Intergenic
1091377473 12:34599-34621 CTGGGTAGACTTCTAGACCCAGG - Intergenic
1095734064 12:45537033-45537055 CTGGGTACACAGATAGTGCTCGG - Intergenic
1096289608 12:50330632-50330654 GTGGGTACCCAGATATTCCCAGG - Exonic
1096752634 12:53771758-53771780 CTGGGTAAACAGAAACTCCGTGG - Intergenic
1096999660 12:55865583-55865605 CTTGGTAGACTGATAGACCCAGG + Intergenic
1101911054 12:108860179-108860201 CTAGGTAGACAGACAGTCATAGG + Intronic
1107640651 13:42439916-42439938 GTGGGTACACAGACAGTCCAGGG + Intergenic
1111300942 13:86349555-86349577 CTGGGTAGTCAGAAAGCCCCAGG + Intergenic
1117967401 14:61220089-61220111 CTGGGAAGGCAGACAGTCCCAGG + Intronic
1119921420 14:78449945-78449967 TTGGGTAGACAGATAGCCAATGG - Intronic
1119943687 14:78668979-78669001 CTAGGTAGACAGATAGATCTAGG - Intronic
1121245869 14:92460491-92460513 CTGGAATGACAGATCGTCCCAGG - Intronic
1122694307 14:103545391-103545413 CCGGGGAGACAGATGGCCCCGGG + Intergenic
1122774013 14:104109261-104109283 CTGGGTGGACAGGGAGGCCCCGG - Exonic
1129295869 15:74599828-74599850 TTGGCAAGACAGAGAGTCCCTGG + Intronic
1129895537 15:79102946-79102968 CTGGAAAGAAAGATACTCCCTGG - Intergenic
1131031893 15:89193457-89193479 CTGTGTAGCCTGATAGTCCTCGG + Intronic
1132449455 15:101958394-101958416 CTGGGTAGACTTCTAGACCCAGG + Intergenic
1132558737 16:584035-584057 CTGGGTTGCCAGGGAGTCCCAGG - Exonic
1140777406 16:78262735-78262757 CTGTGATGACAGATAGCCCCTGG + Intronic
1141365801 16:83441738-83441760 CTGGGAAGAGAGAGAGTACCTGG + Intronic
1144163008 17:12580306-12580328 CTGTGTAGACAGTTACACCCCGG + Intergenic
1148106733 17:45122864-45122886 CTGGGTAAACGGAGAGTCCATGG + Intronic
1150421368 17:65039011-65039033 TTGGGCATACAGACAGTCCCTGG - Intronic
1151885095 17:76918737-76918759 CTGGGGAGACAGAACGTCCCAGG + Intronic
1157208834 18:45723614-45723636 CTGGGAAGACAGACATTCCAGGG + Intergenic
1160635800 19:74156-74178 CTGGGTAGACTTCTAGACCCAGG - Intergenic
1161114050 19:2487165-2487187 CTGGGTAGGCAGGAAGTACCAGG - Intergenic
1162271648 19:9621031-9621053 CAGGGAGGACTGATAGTCCCTGG + Intronic
1164770020 19:30801457-30801479 CTTGGTAGAGAGATGGCCCCTGG + Intergenic
1166478630 19:43151201-43151223 CTGTGGAGACAGGTAGACCCAGG + Intronic
927107635 2:19841620-19841642 CTGGGGAGACAGATAGTGTAAGG + Intergenic
927190219 2:20512256-20512278 CTGGGTAGACAGCTTGCTCCTGG - Intergenic
927519293 2:23689441-23689463 CTGGGCAGACGGACAGTCCATGG - Intronic
928508302 2:31977275-31977297 CTGTGTAGACAGACAGTCAATGG + Intronic
930850157 2:55951735-55951757 CTGGGTAGACATGAAATCCCGGG - Intergenic
931169279 2:59785621-59785643 CTGGGTAGAACAATATTCCCAGG - Intergenic
931829653 2:66037655-66037677 CTGGGGAGACAGGAAGTGCCTGG + Intergenic
936053255 2:109241627-109241649 GCGGGGAGACAGAGAGTCCCAGG - Intronic
936565676 2:113580894-113580916 CTGGGTAGACTTCTAGACCCAGG + Intergenic
938191120 2:129281615-129281637 CCTGGTACACAGTTAGTCCCCGG - Intergenic
939820025 2:146946221-146946243 CTGAGTAGACAGATAGTATCTGG + Intergenic
945254299 2:207791054-207791076 CTGGTTTGAGAGATAGTACCAGG - Intergenic
945324203 2:208463828-208463850 CTGGGAAGCCAGATCATCCCTGG - Intronic
946716880 2:222562154-222562176 CTGGAGAGGCAGATAGTCCTGGG - Intergenic
948003710 2:234590211-234590233 GTGGGCAGACAGATAGTTCATGG + Intergenic
1169404840 20:5314756-5314778 CTGGGCAGACAAAGAGGCCCTGG - Intergenic
1171255356 20:23685920-23685942 CTGGGAGGACAGAATGTCCCTGG - Exonic
1171271837 20:23824046-23824068 CTGGGAGGACAGAATGTCCCTGG - Exonic
1171461194 20:25298924-25298946 CTGGGGAGGCAGAGACTCCCAGG - Intronic
1172135407 20:32683365-32683387 CTGGGGAGACAGACAGTAGCTGG - Intergenic
1173516437 20:43667951-43667973 CGGGGGAGAGAGAGAGTCCCTGG + Intronic
1176969813 21:15252576-15252598 CTGAGCAGAAAGATACTCCCAGG - Intergenic
1178849906 21:36204506-36204528 CTGGGTACACAGCAAGACCCTGG - Intronic
1183069710 22:35387611-35387633 CTGGCTAGGCTGAGAGTCCCTGG - Intronic
949461639 3:4301186-4301208 CTGAGCAGACAGACAGTCCTGGG + Intronic
949509655 3:4757148-4757170 CTGGGTAGGCAGAGAGTGCCTGG - Intronic
951225824 3:20120095-20120117 CCGGGTAGCCCAATAGTCCCAGG - Intronic
952785286 3:37148374-37148396 CTGGCTTGCCAGATAATCCCTGG - Intronic
952842850 3:37662821-37662843 CTGTGTAGACAGTTGGTCCATGG + Intronic
953580907 3:44155539-44155561 CTTGGTAGACAGTTGGTCCTTGG - Intergenic
956617337 3:71185582-71185604 CTGGGTAGACAGATAGTCCCAGG + Intronic
956848699 3:73207900-73207922 CTGAGGAAAGAGATAGTCCCAGG - Intergenic
957040177 3:75330298-75330320 CGGTCTAGACAGATAGGCCCTGG + Intergenic
959350510 3:105256204-105256226 CTGGTTAGACCAATGGTCCCAGG - Intergenic
959989433 3:112614805-112614827 TTGGGGAGTCAGATTGTCCCAGG + Intronic
965376885 3:167935978-167936000 CTTGGGAGAAAGAGAGTCCCTGG + Intergenic
968440274 4:620277-620299 CTTGGAAGACAGATTGGCCCTGG + Intergenic
969255043 4:5995743-5995765 TTGGGTGGACAGATAGAACCTGG + Intergenic
969510528 4:7614966-7614988 CTGGCTCGAGAGCTAGTCCCTGG - Intronic
973948163 4:55982004-55982026 ATGAATATACAGATAGTCCCTGG - Intronic
978204111 4:106059089-106059111 CTTTGTAGACAGATAGCCCTGGG + Intronic
986444404 5:7808625-7808647 CTGGACAGACAGATACACCCAGG - Intronic
987592218 5:19944821-19944843 CTGGAAAGACAAATAGTACCAGG + Intronic
995893177 5:116980380-116980402 CTGGGTAAACAACTAGTACCAGG - Intergenic
997352556 5:133241439-133241461 CTGGGTATACACAGAGGCCCAGG + Intronic
998559787 5:143160607-143160629 CTGAGTAGCTGGATAGTCCCAGG + Intronic
999305990 5:150519950-150519972 CTGGGTGGACAGAAGGTCCAGGG + Intronic
1001756309 5:174173010-174173032 CAGGGTAGAAAGAGAGTCACAGG + Intronic
1005094964 6:22104452-22104474 CTGGGCAGACAGTGAGTCCTGGG - Intergenic
1007325143 6:41053780-41053802 CTGGGTAGAAGCTTAGTCCCAGG + Intronic
1007633716 6:43285974-43285996 CTGAGTAGACCGATGTTCCCTGG - Exonic
1008067054 6:47061245-47061267 CAGGGTAGAAACATAGTCTCTGG - Intergenic
1008260576 6:49361423-49361445 CTGGGTAAAGTGATAGACCCAGG - Intergenic
1008710572 6:54221234-54221256 CTGGGCACAAAGATAATCCCAGG + Intronic
1013446147 6:110229711-110229733 CTGGGAAGACTGGGAGTCCCAGG - Intronic
1015440320 6:133240889-133240911 CTGGGTAGCGAGAGAGTTCCAGG + Intronic
1015832678 6:137387110-137387132 CCAGGTGGACTGATAGTCCCAGG + Intergenic
1016059614 6:139616229-139616251 CTGGGTAGACATATAGTAGTGGG + Intergenic
1018409471 6:163528501-163528523 TTGGTAAGACTGATAGTCCCAGG + Intronic
1019605069 7:1906076-1906098 CTTGGTAAACAGCTAGGCCCCGG - Intronic
1022276366 7:28859171-28859193 CTGTGAAGACAAATAGCCCCTGG + Intergenic
1028434466 7:90785960-90785982 CTGGGTAGCCAGGTAGAGCCAGG - Intronic
1028977875 7:96933976-96933998 CTGAGCAGACAGAGAGTTCCAGG - Intergenic
1032779445 7:135151953-135151975 CTAGGAAGACAAATAGTGCCAGG - Intronic
1038057474 8:23874381-23874403 CCAGGTAGCCAGATAGTCCATGG - Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1046647269 8:116799877-116799899 TTTGGAAGACAGATCGTCCCTGG - Intronic
1048349450 8:133604177-133604199 CTGGGTGAACAGACAGTCCCAGG - Intergenic
1048968176 8:139628938-139628960 CTGGGTGGACATCTCGTCCCTGG + Intronic
1049175645 8:141190853-141190875 CTGGGTCCACGGAGAGTCCCAGG - Intronic
1049886742 9:32329-32351 CTGGGTAGACTTCTAGACCCAGG - Intergenic
1050301597 9:4264327-4264349 CTGGGGAGAGAGATGGTCGCTGG - Intronic
1055942429 9:81663252-81663274 CTGGGTACCCAAATAGTTCCAGG - Intronic
1057942054 9:99293798-99293820 CTGGGAGGAAAGATGGTCCCGGG - Intergenic
1058634573 9:107024023-107024045 TTGTGTAGACAGATGGTCCATGG - Intergenic
1059062752 9:111050821-111050843 CTGGGGAGACAGAAAGACCCTGG + Intergenic
1062732826 9:138119216-138119238 CTGGGTAGAAAAGTAGTCCAGGG - Intronic
1185745485 X:2569408-2569430 CTGGGTAGACTGAGAGTCGGTGG - Intergenic
1186901680 X:14064179-14064201 TACGGTAGACAGATAGTCCAAGG - Intergenic
1189102159 X:38201917-38201939 CTGGGTACAGAGAGAGTTCCAGG + Intronic
1193151930 X:78134516-78134538 CTGGGTAGACTGCTGGTTCCAGG - Intronic
1195926675 X:110032905-110032927 TTTGGTAGACAGATAGTTGCCGG + Intronic