ID: 956619425

View in Genome Browser
Species Human (GRCh38)
Location 3:71206041-71206063
Sequence CTTATTAAACAAATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 18033
Summary {0: 1, 1: 0, 2: 82, 3: 1824, 4: 16126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956619425_956619428 21 Left 956619425 3:71206041-71206063 CCCAGCTCCATTTGTTTAATAAG 0: 1
1: 0
2: 82
3: 1824
4: 16126
Right 956619428 3:71206085-71206107 TTATCTCAAGTTTAACTTTCAGG 0: 1
1: 0
2: 0
3: 32
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956619425 Original CRISPR CTTATTAAACAAATGGAGCT GGG (reversed) Intronic
Too many off-targets to display for this crispr