ID: 956621466

View in Genome Browser
Species Human (GRCh38)
Location 3:71225239-71225261
Sequence CTGTGGCTATCCAGGCAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 525
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 494}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956621466 Original CRISPR CTGTGGCTATCCAGGCAAAG GGG (reversed) Intronic
900892092 1:5456818-5456840 CCCTGTCTCTCCAGGCAAAGGGG + Intergenic
901224449 1:7604953-7604975 CTGCTGATATCCAGGCAAACAGG - Intronic
902141491 1:14360741-14360763 CTGGTGATAGCCAGGCAAAGAGG - Intergenic
906571702 1:46847015-46847037 CTGTTGATAGCCAGGCAAACAGG + Intergenic
906605466 1:47166772-47166794 CTGCTGATATCCAGGCAAACAGG + Intergenic
906739860 1:48172522-48172544 CTGGTGATATCCAGGCAAACAGG - Intergenic
907005560 1:50910156-50910178 CTGTTGATACCCAGGCAAACAGG - Intronic
907659107 1:56375506-56375528 CTGGGGCTATCCAGGACAAAAGG + Intergenic
907780814 1:57564154-57564176 CTGCTGATACCCAGGCAAAGAGG + Intronic
907816156 1:57920099-57920121 ATGTGGCTATTAAGGCAGAGAGG + Intronic
907876114 1:58489810-58489832 CTGCTGATATCCAGGCAAACAGG + Intronic
907926451 1:58958989-58959011 CTGCTGATATCCAGGCAAACAGG + Intergenic
908183953 1:61633868-61633890 CTGTTTCCTTCCAGGCAAAGGGG - Intergenic
908189073 1:61682610-61682632 CTGAGGCCAGCCAGGCACAGTGG + Intronic
908417060 1:63923438-63923460 CAGTAGGTACCCAGGCAAAGAGG + Intronic
908798340 1:67853529-67853551 CTGTTACTATCCAGTGAAAGAGG - Intergenic
909446629 1:75755476-75755498 CTGGTGATACCCAGGCAAAGAGG + Intronic
909457027 1:75861567-75861589 CTGGTGATATCCAGGCAAACAGG - Intronic
910046439 1:82923306-82923328 TTGTGGATATCCAGGCATGGGGG + Intergenic
910281803 1:85509181-85509203 CTGGTGATACCCAGGCAAAGAGG + Intronic
910383670 1:86658282-86658304 CTGGTGATACCCAGGCAAAGAGG + Intergenic
910551995 1:88486046-88486068 CTGTGTCCACCCAGGCAATGTGG + Intergenic
911005259 1:93214206-93214228 CTGAGGGTAGCCAGGCACAGTGG - Intronic
911495353 1:98624528-98624550 CTGTTGATACCCAGGCAAACAGG - Intergenic
912270933 1:108208746-108208768 CTGGGGATACCCAGGCAAACAGG - Intergenic
914458146 1:147855683-147855705 CTGGTGATAGCCAGGCAAAGAGG + Intergenic
914920051 1:151840202-151840224 CTGTGTTTATCCAGGAAAAGAGG - Exonic
915763307 1:158336938-158336960 CTGCTGATATCCAGGCAAACAGG + Intergenic
916256317 1:162791084-162791106 CTGAGGTTATCAAGGCAATGGGG + Intronic
917109366 1:171529401-171529423 CTGTGGGTATGCAGGAAAGGTGG - Intronic
917266708 1:173228296-173228318 CTGGTGATACCCAGGCAAAGAGG + Intergenic
917915323 1:179695189-179695211 CTGGTGATATCCAGGCAAAAAGG + Intergenic
918233062 1:182553189-182553211 ATGAGGCTAGCCAGGCACAGTGG - Intronic
918517963 1:185383871-185383893 CTGTTGATACCCAGGCAAACAGG - Intergenic
919516990 1:198538018-198538040 CTGTGGCTTCTGAGGCAAAGAGG + Intronic
919841865 1:201615106-201615128 TGGTGGCTTCCCAGGCAAAGTGG - Intergenic
919905181 1:202073585-202073607 CTGTGGTTACCTGGGCAAAGGGG + Intergenic
920523603 1:206648556-206648578 CTGTGACTACCCAGGCAGATGGG + Exonic
922197396 1:223371814-223371836 CTGCGGATAGCCAGGCAAACAGG - Intergenic
922253328 1:223870430-223870452 CTGGTGATATCCAGGCAAACAGG - Intergenic
922666633 1:227474738-227474760 CTGGTGATATCCAGGCAAACAGG + Intergenic
924825201 1:247531560-247531582 CTGTGGCTCTGCAGGCAAGCTGG - Exonic
1063320011 10:5044027-5044049 TGGTGGCTCTCCAGGCAAAAGGG + Intronic
1063877515 10:10495548-10495570 CTGTGGCTGTTCAGGTAGAGAGG - Intergenic
1064914478 10:20441477-20441499 CTGCTGATATCCAGGCAAACAGG - Intergenic
1066722779 10:38356737-38356759 CTGAGGTTATCAAGGCAATGGGG + Intergenic
1066993394 10:42539014-42539036 CTGGTGATACCCAGGCAAAGAGG - Intergenic
1068085998 10:52374531-52374553 CTGGTGATATCCAGGCAAACAGG - Intergenic
1068357015 10:55922809-55922831 CTGGTGATACCCAGGCAAAGAGG - Intergenic
1068747003 10:60544035-60544057 CTGTAGCAAGCCAGGCAGAGAGG - Intronic
1069227115 10:65958666-65958688 CTGGTGATATCCAGGCAAACTGG - Intronic
1069256264 10:66335503-66335525 CTGCTGATACCCAGGCAAAGAGG - Intronic
1069734491 10:70644783-70644805 CTGGTGATATCCAGGCAAACAGG - Intergenic
1070313221 10:75288614-75288636 CTGGGGCTCTGCAGGCCAAGTGG - Intergenic
1070474098 10:76815276-76815298 CTGTTGATACCCAGGCAAACAGG - Intergenic
1070910417 10:80113025-80113047 CAGTGGCTGGCCAGGCACAGTGG - Intergenic
1070980395 10:80641094-80641116 CTGGTGATACCCAGGCAAAGAGG - Intronic
1071388509 10:85146210-85146232 CTGTGGAAAGCCAGGCAGAGTGG + Intergenic
1071589873 10:86862584-86862606 CTTCAGCAATCCAGGCAAAGGGG + Intronic
1072373768 10:94793633-94793655 CTGGTGATATCCAGGCAAACAGG - Intronic
1072516163 10:96185610-96185632 CTGGTGATACCCAGGCAAAGAGG - Intronic
1074000575 10:109368090-109368112 CTGTTGATACCCAGGCAAACAGG + Intergenic
1074109263 10:110410909-110410931 CTGTGTCTGTCCTAGCAAAGAGG + Intergenic
1074943084 10:118254023-118254045 CTGTGGCTTCCCATGCCAAGGGG + Intergenic
1077698778 11:4420252-4420274 CTATGGCCATCCAGACAAATGGG + Intergenic
1077946507 11:6905441-6905463 CTGCTGATATCCAGGCAAACAGG + Intergenic
1078681499 11:13480805-13480827 CTGGTGCTACCCAGGCAAACAGG + Intergenic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1079799699 11:24853921-24853943 CTGGTGATATCCAGGCAAAAAGG - Intronic
1079867995 11:25759135-25759157 CTGGTGATATCCAGGCAAATAGG + Intergenic
1080882401 11:36334567-36334589 GAGTGGTTAACCAGGCAAAGAGG - Intronic
1081377581 11:42377672-42377694 CTGGGGATACCCAGGCAAACAGG + Intergenic
1081992576 11:47345760-47345782 GTGTGGCTCTCCAGGCTTAGCGG + Intronic
1082155374 11:48803699-48803721 CTGCTGATACCCAGGCAAAGAGG - Intergenic
1082253340 11:50005814-50005836 CTGAGGATACCCAGGCAAACAGG + Intergenic
1082744567 11:56948133-56948155 CTGCTGATACCCAGGCAAAGAGG - Intergenic
1083280095 11:61621515-61621537 CTGTAACAATCCAGGCACAGTGG + Intergenic
1083840588 11:65302047-65302069 CTGCAGCTGCCCAGGCAAAGGGG + Intronic
1084083034 11:66841665-66841687 CTGTTTCTAGCCAGGCAAGGTGG + Intronic
1085240056 11:75045687-75045709 CTGTGACTGGCCAGGCACAGTGG - Intergenic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1086422011 11:86645889-86645911 CTGGTGATATCCAGGCAAACAGG + Intronic
1087072854 11:94099286-94099308 CTGCTGATATCCAGGCAAACAGG - Intronic
1087249068 11:95875873-95875895 CTGCTGATACCCAGGCAAAGAGG - Intronic
1087305858 11:96487973-96487995 CTGGTGATAACCAGGCAAAGAGG + Intronic
1087364746 11:97203952-97203974 CTATGTCTTTCCAGGCAAGGTGG - Intergenic
1088034528 11:105296037-105296059 CTGGGGATACCCAGGGAAAGGGG - Intergenic
1088755870 11:112884771-112884793 TGGTGGGTCTCCAGGCAAAGGGG - Intergenic
1089816131 11:121177448-121177470 CTGCTGGTACCCAGGCAAAGAGG - Intronic
1092314030 12:7391055-7391077 CTGTTGATACCCAGGCAAACAGG + Intronic
1093756499 12:22858929-22858951 CTGTAGCTAACCAGGGAAGGAGG + Intergenic
1093900363 12:24624920-24624942 CTGGTGGTATCCAGGCAAACAGG - Intergenic
1094387503 12:29910754-29910776 CTGCTGATACCCAGGCAAAGAGG + Intergenic
1094757950 12:33493409-33493431 CTGGTGATATCCAGGCAAACAGG + Intergenic
1094810632 12:34134188-34134210 CTGCTGATATCCAGGCAAACAGG + Intergenic
1094858465 12:34431854-34431876 CTGCGGATATCCAGGCAAACAGG + Intergenic
1094861271 12:34469320-34469342 CTGTTGATACCCAGGCAAACAGG - Intergenic
1095151094 12:38797417-38797439 CTGCGGATACCCAGGCAAACAGG + Intronic
1095165623 12:38968735-38968757 CTGCTGATACCCAGGCAAAGAGG - Intergenic
1095186691 12:39208566-39208588 CTGGTGATATCCAGGCAAAAAGG + Intergenic
1095430152 12:42125431-42125453 CTGTGACTATTCAGGGAATGGGG + Intronic
1095662639 12:44755548-44755570 CTGTGGCTATACAGGTAAAGTGG - Intronic
1095917921 12:47498399-47498421 CTGGTGATACCCAGGCAAAGAGG + Intergenic
1096630058 12:52920752-52920774 CTGTGCCCAGCCAGGCACAGTGG + Intronic
1098053032 12:66473669-66473691 CTGGTGATATCCAGGCAAAGAGG + Intronic
1098638430 12:72812845-72812867 CTGGGGATACCCAGGCAAACAGG - Intergenic
1099008597 12:77264264-77264286 CTGTTGGTACCCAGGCAAACAGG - Intergenic
1099025542 12:77460122-77460144 CTGGGGATACCCAGGCAAACAGG + Intergenic
1099365091 12:81758747-81758769 CTGCGGCTGTTCTGGCAAAGGGG - Intronic
1099720616 12:86357189-86357211 CTGGTGCTACCCAGGCAAACAGG + Intronic
1099943861 12:89222296-89222318 CTGGTGATATCCAGGCAAATAGG - Intergenic
1100759854 12:97795415-97795437 CTGTGGGTTTCCAGGCTAATTGG - Intergenic
1100989820 12:100239752-100239774 CTGTGGTCAGCCAGGCACAGTGG + Intronic
1101903640 12:108809692-108809714 CTGTGTCTGTCCAGGCCATGTGG - Exonic
1102440280 12:112958618-112958640 CTGGTGATATCCAGGCAAACAGG - Intronic
1103700330 12:122845862-122845884 CTGTGTCTTTCCTCGCAAAGAGG + Intronic
1104086356 12:125477952-125477974 CTGTTGGTACCCAGGCAAACAGG + Intronic
1104269714 12:127272207-127272229 CTATGGCTCTCAGGGCAAAGAGG + Intergenic
1104472605 12:129042818-129042840 CTGCTGATATCCAGGCAAACAGG - Intergenic
1105598285 13:21861026-21861048 CTGCTGCTACCCAGGCAAACAGG - Intergenic
1105737285 13:23284910-23284932 CTGGTGATATCCAGGCAAACAGG - Intronic
1106426495 13:29635961-29635983 CTGGTGATACCCAGGCAAAGAGG - Intergenic
1107648259 13:42517124-42517146 CTGGTGATACCCAGGCAAAGAGG + Intergenic
1108471679 13:50773573-50773595 CTGGTGATATCCAGGCAAACAGG - Intronic
1108593575 13:51932053-51932075 CCGGGACTATCCAGGCAAACTGG - Intergenic
1109675031 13:65664088-65664110 CTGTGGCAGGCCAGGCACAGTGG - Intergenic
1109902713 13:68795178-68795200 CTGGTGATACCCAGGCAAAGAGG - Intergenic
1109910899 13:68908753-68908775 CTGTGGCTGTACAGGCAGTGTGG + Intergenic
1110020043 13:70458144-70458166 CTGGTGATACCCAGGCAAAGAGG + Intergenic
1110199631 13:72833550-72833572 CTGGTGATATCCAGGCAAACAGG - Intronic
1110510361 13:76343139-76343161 CTGGTGATACCCAGGCAAAGAGG + Intergenic
1110838888 13:80118481-80118503 TTGGGGCTATCCAGGCAGAAGGG + Intergenic
1111375073 13:87368007-87368029 CTGGTGATATCCAGGCAAACAGG - Intergenic
1112087550 13:96047337-96047359 CTGTAGATACCCAGGCAAACAGG + Intronic
1112818583 13:103303395-103303417 CTGTGGCTATCCGACCAAAGGGG + Intergenic
1113288634 13:108881156-108881178 CTGGTGATATCCAGGCAAACAGG + Intronic
1114964433 14:27939771-27939793 CTGCTGATACCCAGGCAAAGAGG + Intergenic
1115018045 14:28640931-28640953 CTGTTGATACCCAGGCAAACAGG - Intergenic
1115124291 14:29973177-29973199 CTGGTGATACCCAGGCAAAGAGG + Intronic
1115442625 14:33453762-33453784 CTGTGGGTCTCCAGGTAAGGAGG - Intronic
1116989639 14:51261923-51261945 CTATAGCTCTCCAGGGAAAGAGG - Intergenic
1117193794 14:53318894-53318916 CTGCTGATATCCAGGCAAACAGG + Intergenic
1117784843 14:59272289-59272311 CAGTGGCTGGCCAGGCACAGTGG + Intronic
1117930449 14:60836540-60836562 CTGGGGATACCCAGGCAAACAGG - Intronic
1118494147 14:66291510-66291532 CTCTGGCTATTAAGGGAAAGGGG + Intergenic
1119007026 14:70941404-70941426 CTGGTGATATCCAGGCAAACAGG - Intronic
1119188651 14:72663539-72663561 GCGTGGCTATCCAGGCAAAAGGG - Intronic
1119736411 14:76985558-76985580 CTGTGGGCATCCAGGCCATGTGG + Intergenic
1120064820 14:80028439-80028461 CTGCTGATATCCAGGCAAACAGG + Intergenic
1120090740 14:80330375-80330397 CTATGTCTTTCCAGGTAAAGTGG - Intronic
1120586044 14:86313089-86313111 CTGTTGATACCCAGGCAAACAGG + Intergenic
1122079105 14:99254561-99254583 CTTTGGCTGTCCAGGCTCAGAGG - Intronic
1202883256 14_KI270722v1_random:81658-81680 CTGCTGATATCCAGGCAAACAGG - Intergenic
1126653103 15:50946783-50946805 CTGTGGCAAGCCATGCAAATGGG + Intronic
1126838044 15:52687569-52687591 CTGAGGTTAGACAGGCAAAGTGG + Intronic
1126952106 15:53893155-53893177 CTGGTGATATCCAGGCAAACAGG - Intergenic
1127006088 15:54571703-54571725 CTGTGGCTCCTCAGGCAGAGTGG - Intronic
1127057222 15:55144033-55144055 CTGCTGATATCCAGGCAAACAGG + Intergenic
1127193795 15:56562250-56562272 CTGGGGATACCCAGGCAAACAGG + Intergenic
1127253789 15:57270867-57270889 CTGGTGATACCCAGGCAAAGAGG - Intronic
1127485436 15:59413815-59413837 CTGTGGCTTCCCAAGCAAATAGG - Intronic
1127632810 15:60842175-60842197 CTGTCAGTATCCAAGCAAAGTGG - Intronic
1128523843 15:68395014-68395036 CTGGTGATATCCAGGCAAACAGG + Intronic
1128782283 15:70368567-70368589 CTGTTGATACCCAGGCAAACAGG + Intergenic
1131395163 15:92080007-92080029 CTGCGGCTAGCCAGCCAGAGAGG + Intronic
1131490094 15:92855194-92855216 CTGTGGCTGGCCAGGCACGGTGG - Intergenic
1131689343 15:94809714-94809736 CTGTGGAGAGCCAGGCAGAGGGG + Intergenic
1132531737 16:454289-454311 CTGTCTCTAGCCAGGCACAGTGG + Intronic
1132581386 16:686246-686268 TTGTGACTGTCCAGGCAGAGAGG - Intronic
1133315518 16:4881280-4881302 CTGGGGCTCTCCAGGCAGTGGGG + Exonic
1134045271 16:11096391-11096413 CTGTGGTTATCCAGGGAAGTGGG - Intronic
1135024116 16:18986106-18986128 CGGTGGCTGGCCAGGCACAGTGG + Intronic
1136249760 16:28996687-28996709 CTGTGTCTGGCCAGGCACAGTGG - Intergenic
1136452070 16:30359143-30359165 CTGTGGCCCTCCAGGCCATGAGG - Intronic
1137074455 16:35944555-35944577 CCGCTGCTACCCAGGCAAAGAGG + Intergenic
1137239329 16:46641331-46641353 CTGGTGATATCCAGGCAAACAGG + Intergenic
1137324918 16:47424736-47424758 CTGTTGATACCCAGGCAAACAGG - Intronic
1137347968 16:47683037-47683059 CTGCTGATACCCAGGCAAAGAGG - Intronic
1137503489 16:49029551-49029573 CTGCTGATACCCAGGCAAAGAGG + Intergenic
1137894351 16:52195008-52195030 CGGTGGCTTTCCAGTAAAAGTGG - Intergenic
1140179028 16:72695652-72695674 CTGCTGATACCCAGGCAAAGAGG - Intergenic
1141110676 16:81268343-81268365 ATGAGGCTGTCCAGGCAAGGGGG + Intronic
1143034911 17:3989266-3989288 CTGTGGAGAGCCAGGCAAAGAGG - Intergenic
1143121109 17:4607490-4607512 CTTTGGCAATCCAGGCTCAGGGG - Exonic
1145731221 17:27188199-27188221 CTGTGGATACCCAGGCAAACAGG - Intergenic
1146580290 17:34031230-34031252 CTGTGGATACCCAGGCAAACAGG + Intronic
1147307482 17:39573874-39573896 CTGTGGCTGGCCAGGCAGGGCGG + Intergenic
1148222873 17:45876623-45876645 CTCTGGATATCCTGGCATAGGGG - Intergenic
1148385601 17:47232467-47232489 CTGTGGTTATGTTGGCAAAGAGG + Intergenic
1148952645 17:51327239-51327261 CTGGTGATATCCAGGCAAACAGG + Intergenic
1149093774 17:52816703-52816725 CTGGTGATATCCAGGCAAATAGG - Intergenic
1149329961 17:55570456-55570478 CTGTGGCTGACCAGGCACACTGG - Intergenic
1149365548 17:55939816-55939838 CTGGTGCTACCCAGGCAAACAGG + Intergenic
1149931984 17:60766495-60766517 CTGGTGGTACCCAGGCAAAGAGG - Intronic
1151737443 17:75953044-75953066 CTGTGGCTATGAATGCAAAAGGG + Intronic
1152750160 17:82058924-82058946 CTGTGGCCAGCCAGGCCAGGAGG + Intronic
1153119168 18:1700474-1700496 CTGGTGATATCCAGGCAAATAGG + Intergenic
1153725271 18:7947693-7947715 CAGAAGCTAACCAGGCAAAGGGG - Intronic
1153825102 18:8867896-8867918 CTCTGGCTAACCTTGCAAAGCGG - Intergenic
1156072507 18:33229744-33229766 ATGAGGCTTTCCAGGCAAATGGG + Intronic
1156116029 18:33787740-33787762 CTGCGGATACCCAGGCAAACAGG + Intergenic
1156233229 18:35175303-35175325 CTGTGGCTAGCTGGGCACAGTGG + Intergenic
1159578182 18:70205490-70205512 CGGGGGCTATCCTGACAAAGCGG + Intronic
1159592261 18:70348218-70348240 CTGTTGATACCCAGGCAAACAGG - Intronic
1159769559 18:72532975-72532997 CTGAGGCTATCCTAGCAAAATGG - Intergenic
1161169271 19:2804910-2804932 TTGTAGCTTTCCAGGCAGAGGGG + Intronic
1161483230 19:4521279-4521301 CTGTGGCTATAAAGTCAAGGTGG + Intergenic
1164495596 19:28757699-28757721 CTGGTGATATCCAGGCAAACAGG + Intergenic
1165801933 19:38557533-38557555 CTGTGGTGTCCCAGGCAAAGGGG + Intronic
1166635677 19:44449877-44449899 CTGTGTCTACCCAAGCAAAGAGG - Intergenic
1167457210 19:49602837-49602859 CTATGGCCAGCCAGGCACAGTGG - Intronic
1167799346 19:51730125-51730147 CTGTTTCTCTCCAGGGAAAGTGG - Intergenic
1202658668 1_KI270708v1_random:48802-48824 CTGCTGATATCCAGGCAAACAGG - Intergenic
927340628 2:21979800-21979822 CTTTGACTACCCAGGCAAAGGGG - Intergenic
928286317 2:29992991-29993013 CGGTGGGGATCCAGGAAAAGTGG + Intergenic
928388102 2:30886467-30886489 CTGTGTCCAGCCAGGCAGAGAGG - Intergenic
928778920 2:34796882-34796904 CTGTGCTCATCCAGGCAAAGTGG + Intergenic
928837778 2:35568328-35568350 CTGTTGATACCCAGGCAAACAGG - Intergenic
928852599 2:35767303-35767325 CTGCTGATACCCAGGCAAAGAGG + Intergenic
928881152 2:36097866-36097888 CTGCTGCTACCCAGGCAAACAGG + Intergenic
929718007 2:44333094-44333116 CTGTGGCTGTCCAGGCAGCAGGG - Intronic
930908842 2:56606119-56606141 CTGGTGATATCCAGGCAAACAGG - Intergenic
931004186 2:57828793-57828815 CTGGTGATATCCAGGCAAACAGG + Intergenic
931212002 2:60206632-60206654 CTGGTGATACCCAGGCAAAGAGG - Intergenic
932216482 2:69969528-69969550 CTGTGAGTATCCAGGGAGAGAGG - Intergenic
932456530 2:71852954-71852976 CTGTGCCCATCCAGGTAACGCGG + Intergenic
933308362 2:80630110-80630132 TTGGGGATAACCAGGCAAAGAGG - Intronic
937074974 2:119096558-119096580 CTGGTGATATCCAGGCAAATAGG + Intergenic
937417518 2:121728279-121728301 CTGTGGATAGCCAGGTAAAATGG - Exonic
937473399 2:122192659-122192681 CCTTGGCTATACAGGCAATGGGG - Intergenic
937526213 2:122772924-122772946 CTGGTGATATCCAGGCAAATAGG + Intergenic
937903779 2:127041775-127041797 CCGTGGCTGTCTAGGAAAAGAGG + Intergenic
938341150 2:130537526-130537548 CAGTTGCTATCCAGGGAAATGGG - Intergenic
938348680 2:130583183-130583205 CAGTTGCTATCCAGGGAAATGGG + Intronic
938442262 2:131346772-131346794 CTGCTGATATCCAGGCAAACAGG - Intronic
938445508 2:131374145-131374167 CTGCGGGTACCCAGGCAAACAGG + Intergenic
939470762 2:142616538-142616560 CTGGTGATAACCAGGCAAAGAGG + Intergenic
939874053 2:147556455-147556477 CTGTGGATCTCCAGGCACAGTGG - Intergenic
940475187 2:154153204-154153226 CTGCTGTTACCCAGGCAAAGAGG - Intronic
940816758 2:158305458-158305480 GTGTGGCAAGCCAGGCACAGTGG + Intronic
942056859 2:172192541-172192563 CTGCTGATATCCAGGCAAACAGG - Intergenic
942464478 2:176193038-176193060 CTGTGTTTATACAGGAAAAGAGG + Intergenic
942569835 2:177302692-177302714 CTTTGGATAGCCAGGCAGAGTGG + Intronic
942731566 2:179066445-179066467 CTGTGGATACCCAGGCAAACAGG - Intergenic
943074557 2:183178841-183178863 CTGTTGATACCCAGGCAAACAGG - Intergenic
943549398 2:189320033-189320055 CTGCTGATATCCAGGCAAACAGG + Intergenic
944033806 2:195268997-195269019 CTGGTGATATCCAGGCAAACAGG - Intergenic
944570101 2:201035875-201035897 CTGCTGATATCCAGGCAAACAGG - Intronic
945409276 2:209489127-209489149 CTGATGATACCCAGGCAAAGAGG + Intronic
945409890 2:209495524-209495546 CTGGTGATACCCAGGCAAAGAGG + Intronic
947311481 2:228808626-228808648 CTGTTGATACCCAGGCAAAGAGG - Intergenic
947698920 2:232216463-232216485 ATGTGGCTTTGCAGGGAAAGGGG - Intronic
948400340 2:237680202-237680224 CAGTGGCTGGCCAGGCACAGTGG + Intronic
1169471925 20:5893740-5893762 CAGTGACTAGCCAGGCACAGTGG - Intergenic
1169760241 20:9083752-9083774 CTGTGACCATACAGGCACAGAGG + Intronic
1170660452 20:18333784-18333806 CTGCTGATATCCAGGCAAACAGG + Intergenic
1171514694 20:25720010-25720032 CTAGTGATATCCAGGCAAAGAGG - Intergenic
1171957321 20:31471212-31471234 GGGTGGCTAGCCAGGCAGAGGGG + Intronic
1173306988 20:41860194-41860216 CTGTGGCCATGCAGGGTAAGGGG + Intergenic
1175179581 20:57136055-57136077 CTGTGGCCACCCAGGCAGCGTGG + Intergenic
1175265447 20:57700500-57700522 CTGTGGCCGTCCAGCCCAAGGGG + Intronic
1176480403 21:7281099-7281121 CTGCTGATATCCAGGCAAACAGG + Intergenic
1177022179 21:15875719-15875741 CTGTGGCTATCCAGGTTATGAGG + Intronic
1178559597 21:33626244-33626266 CACTGGCTAGCCAGGCACAGTGG - Intronic
1179168711 21:38956120-38956142 GTCTGGCTCTCCAGGCGAAGGGG - Intergenic
1179244014 21:39614676-39614698 CTGTAGCTGTCCAGGGACAGAGG - Intronic
1179708634 21:43196959-43196981 GTGTGGCCATCCAGGAATAGAGG - Intergenic
1180326134 22:11432321-11432343 CTGCTGATATCCAGGCAAACAGG - Intergenic
1182092014 22:27602425-27602447 TTGTGGCTTTCCAGGCAGAAAGG + Intergenic
1182162231 22:28134078-28134100 CTGCTGATATCCAGGCAAACAGG + Intronic
1183215187 22:36474830-36474852 CTCTGGCCACCCAGACAAAGTGG + Intronic
1184002408 22:41684865-41684887 CTGGGGCAGTCCAGGCACAGTGG + Intronic
951324373 3:21285038-21285060 CTGGTGATACCCAGGCAAAGAGG - Intergenic
951469028 3:23035707-23035729 CTGGTGATATCCAGGCAAACAGG - Intergenic
951474648 3:23092581-23092603 CTGCTGATATCCAGGCAAACAGG - Intergenic
952104260 3:30050982-30051004 CTGTTGATACCCAGGCAAACAGG + Intergenic
953315958 3:41926188-41926210 CTGGTGATATCCAGGCAAACAGG + Intronic
954353974 3:50069535-50069557 CTGTGGAGAGCCAGGCACAGTGG + Intronic
954369794 3:50164135-50164157 CTGTGGCCTTCCAGGTCAAGTGG + Intronic
954537113 3:51368906-51368928 CTGTTGATACCCAGGCAAACAGG + Intronic
955048916 3:55389576-55389598 CTGCTGATATCCAGGCAAACAGG + Intergenic
955099463 3:55832476-55832498 CTGCGGATACCCAGGCAAACAGG + Intronic
955427535 3:58807435-58807457 CTGCGGATACCCAGGCAAATAGG + Intronic
955438660 3:58931642-58931664 CTGCGGATACCCAGGCAAATAGG + Intronic
955657737 3:61263138-61263160 CTGGTGATACCCAGGCAAAGAGG - Intergenic
956268865 3:67428310-67428332 CTGGTGATATCCAGGCAAACAGG + Intronic
956382964 3:68685755-68685777 CTGGGGATACCCAGGCAAAAAGG - Intergenic
956621466 3:71225239-71225261 CTGTGGCTATCCAGGCAAAGGGG - Intronic
957930852 3:86876465-86876487 CTGGTGATACCCAGGCAAAGAGG - Intergenic
958624439 3:96606613-96606635 CTGCTGATACCCAGGCAAAGAGG - Intergenic
959823890 3:110769683-110769705 CTGGTGATATCCAGGCAAACAGG + Intergenic
960278262 3:115751710-115751732 CTGGTGATATCCAGGCAAACAGG + Intergenic
960448646 3:117778834-117778856 CTGTTGATACCCAGGCAAACAGG + Intergenic
960508164 3:118517581-118517603 CTGTTGATATCCAGGCAAACAGG + Intergenic
961457972 3:127033574-127033596 CTGGGGCTCACCAGGGAAAGGGG + Intronic
962181012 3:133206603-133206625 CTGGTGATACCCAGGCAAAGAGG - Intronic
962642271 3:137400125-137400147 CTGGTGATATCCAGGCAAACAGG - Intergenic
962699293 3:137980697-137980719 CTGCGGATACCCAGGCAAACAGG + Intergenic
962834076 3:139171748-139171770 CTGCTGATACCCAGGCAAAGAGG - Intronic
963340109 3:144023256-144023278 CTGTTGATACCCAGGCAAACAGG - Intronic
964744876 3:160003002-160003024 CAGTGGTCCTCCAGGCAAAGTGG + Intergenic
965099093 3:164273938-164273960 CTAGGGCTATCCTGGCATAGGGG - Intergenic
965762308 3:172092678-172092700 CTGTGGGTGTCCTGGAAAAGAGG + Intronic
966361222 3:179131982-179132004 CTGTGGATACCCAGGCAAACAGG - Intergenic
966673937 3:182564508-182564530 CTGTGTTTATCCAGGCCAGGTGG - Intergenic
967181401 3:186908839-186908861 CTGGTGATATCCAGGCAAACAGG - Intergenic
968388780 4:171119-171141 CTGCTGATACCCAGGCAAAGAGG - Intergenic
968958624 4:3731449-3731471 CACTGGCTCTCCAGTCAAAGTGG - Intergenic
972743180 4:41908809-41908831 CTGTTGATACCCAGGCAAACAGG - Intergenic
973013796 4:45110408-45110430 CTGGTGATATCCAGGCAAACAGG - Intergenic
973347146 4:49068710-49068732 CTGCTGATACCCAGGCAAAGAGG + Intergenic
973689312 4:53409268-53409290 CTGCTGGTATCCAGGCAAACAGG - Intronic
973806758 4:54534210-54534232 CTGCTGATATCCAGGCAAACAGG - Intergenic
974302157 4:60082126-60082148 CTGGGGATATCCAGACAAACAGG + Intergenic
974307003 4:60155678-60155700 CTGGTGATACCCAGGCAAAGAGG - Intergenic
974350369 4:60736500-60736522 CTGCTGATATCCAGGCAAACAGG - Intergenic
975187283 4:71418965-71418987 CTGCGGATACCCAGGCAAACAGG - Intronic
975800186 4:78053302-78053324 CTGTGGTTATCCTTGCAGAGGGG + Intergenic
975806448 4:78118103-78118125 CTGCTGATACCCAGGCAAAGAGG - Intronic
976143764 4:82020420-82020442 CTGCTGGTATCCAGGCAAACAGG + Intronic
976167701 4:82272610-82272632 CTGTTGATACCCAGGCAAACAGG + Intergenic
976293366 4:83444971-83444993 CTGTGGCAATCCAGGTAGAAAGG + Intronic
976532305 4:86168932-86168954 CTGCTGCTACCCAGGCAAACAGG + Intronic
976848837 4:89521452-89521474 CTGTGGCTATCCGAGGGAAGAGG + Intergenic
976977211 4:91180083-91180105 CTGGTGATACCCAGGCAAAGAGG - Intronic
978245134 4:106563365-106563387 CTGTTGATACCCAGGCAAACAGG - Intergenic
978278236 4:106978041-106978063 CTGGTGATATCCAGGCAAACAGG - Intronic
979027928 4:115600469-115600491 CTGTGGCTACTTAGGAAAAGTGG + Intergenic
979043771 4:115835086-115835108 CTGGTGATATCCAGGCAAACAGG + Intergenic
979215662 4:118161143-118161165 CTGTGGATACGCAGGCAAACAGG - Intronic
979299122 4:119067178-119067200 CTGCGGGTACCCAGGCAAACAGG - Intergenic
979445034 4:120802574-120802596 CTGCTGATACCCAGGCAAAGAGG + Intronic
979522903 4:121688849-121688871 CTGTGGCCAACTAGGAAAAGGGG + Intronic
979634774 4:122944909-122944931 CTGTTGATACCCAGGCAAACAGG - Intronic
979934137 4:126670575-126670597 CTGGGGATACCCAGGCAAACAGG + Intergenic
980158919 4:129136940-129136962 CTGAGGCAAACCAGGGAAAGGGG + Intergenic
980260517 4:130442174-130442196 CTGGTGATATCCAGGCAAACAGG - Intergenic
980400358 4:132276483-132276505 CTGGTGATACCCAGGCAAAGAGG + Intergenic
980542119 4:134208632-134208654 CTGCTGATATCCAGGCAAACAGG + Intergenic
980593935 4:134928354-134928376 CTGGGGATACCCAGGCAAATAGG - Intergenic
981100588 4:140825623-140825645 ATGTGGATACCCAGGCAAACAGG - Intergenic
981441873 4:144792448-144792470 CTGCTGATATCCAGGCAAACAGG + Intergenic
982479547 4:155892454-155892476 CTGCTGATATCCAGGCAAACAGG + Intronic
982733512 4:158980543-158980565 CTGGTGATATCCAGGCAAACAGG + Intronic
983044415 4:162969166-162969188 CTGGTGATATCCAGGCAAACAGG - Intergenic
983141521 4:164155201-164155223 CTGTGGGTATCCAGGCTTAAGGG + Intronic
983377568 4:166949613-166949635 CTGTGGATACCCAGGCAAACAGG - Intronic
984525958 4:180860037-180860059 CTGGTGATACCCAGGCAAAGAGG - Intergenic
985788345 5:1911611-1911633 CTGTGGCCAGCCTTGCAAAGTGG - Intergenic
987184053 5:15396984-15397006 CTGCGGATACCCAGGCAAACAGG + Intergenic
987656625 5:20815468-20815490 CTGGTGATATCCAGGCAAACAGG + Intergenic
988375330 5:30428626-30428648 CTGCGGATACCCAGGCAAACAGG - Intergenic
988766927 5:34388477-34388499 CTGGTGATATCCAGGCAAACAGG - Intergenic
988775069 5:34469929-34469951 CTGATGATATCCAGGCAAATAGG + Intergenic
989050523 5:37315653-37315675 CTGTGGCTGGCCAGGCGCAGTGG + Intronic
989345216 5:40422492-40422514 CTGGTGATATCCAGGCAAACAGG - Intergenic
989623065 5:43403378-43403400 CTGGTGATATCCAGGCAAACAGG + Intronic
989779051 5:45243108-45243130 CTGCGGATACCCAGGCAAACAGG - Intergenic
989942805 5:50174086-50174108 CTGCTGCTACCCAGGCAAACAGG - Intergenic
990084051 5:51952598-51952620 CTGCTGATATCCAGGCAAACAGG + Intergenic
990164251 5:52977212-52977234 CTGTTGATACCCAGGCAAACAGG - Intergenic
990721286 5:58699231-58699253 CTGATGCTACCCAGGCAAACAGG - Intronic
990837899 5:60042634-60042656 CTGGTGATACCCAGGCAAAGAGG + Intronic
991089212 5:62678078-62678100 CTGCTGATACCCAGGCAAAGAGG - Intergenic
993674052 5:90795836-90795858 CTGGTGATATCCAGGCAAACAGG + Intronic
993947933 5:94137746-94137768 CTGGTGATATCCAGGCAAAAAGG - Intergenic
994287906 5:97992167-97992189 CTGCTGATACCCAGGCAAAGAGG + Intergenic
994299970 5:98135705-98135727 CCGTGGATACCCAGGCAAACAGG + Intergenic
994316996 5:98343851-98343873 CTGCTGTTACCCAGGCAAAGAGG + Intergenic
995093829 5:108212615-108212637 CTGGTGATATCCAGGCAAACAGG - Intronic
995564158 5:113416073-113416095 CTGGTGATATCCAGGCAAACAGG - Intronic
995692725 5:114845270-114845292 CTGCTGATACCCAGGCAAAGAGG + Intergenic
996187111 5:120490926-120490948 CTGCTGATATCCAGGCAAACAGG - Intronic
996455788 5:123679831-123679853 CTGCTGATACCCAGGCAAAGAGG - Intergenic
996639926 5:125740144-125740166 CTGGTGATACCCAGGCAAAGAGG - Intergenic
996900341 5:128537207-128537229 CTTTGGATATTCTGGCAAAGGGG + Intronic
996910788 5:128655273-128655295 CTGGTGATATCCAGGCAAACAGG - Intronic
996964352 5:129290504-129290526 CTGCTGATATCCAGGCAAACAGG - Intergenic
997709214 5:135989796-135989818 CTCTGGCTGTCCAGGCACAGAGG + Intergenic
999485382 5:151989760-151989782 CTGCTGATATCCAGGCAAACAGG + Intergenic
1000069046 5:157721779-157721801 CTGGTGATATCCAGGCAAACAGG + Intergenic
1000150201 5:158492816-158492838 CAGTGGCTAACCAGGCAACAAGG - Intergenic
1000376038 5:160583372-160583394 CTGGTGATATCCAGGCAAACAGG - Intronic
1000595761 5:163212820-163212842 CTGGTGATATCCAGGCAAACAGG + Intergenic
1006065728 6:31461310-31461332 CTGTGGTTGGCCAAGCAAAGGGG + Intergenic
1006246034 6:32737050-32737072 CTGTGGCACTCCAGGCATATAGG - Intergenic
1008575364 6:52855852-52855874 CTGGTGATACCCAGGCAAAGAGG - Intronic
1008865512 6:56204818-56204840 CTGGTGATATCCAGGCAAACAGG + Intronic
1009060719 6:58394650-58394672 CTGTTGTTACCCAGGCAAACAGG + Intergenic
1009239098 6:61162828-61162850 CTGTTGATACCCAGGCAAACAGG - Intergenic
1009305806 6:62088503-62088525 CTGGTGATACCCAGGCAAAGAGG - Intronic
1009361308 6:62818063-62818085 CTGGTGATATCCAGGCAAACAGG - Intergenic
1009709524 6:67299946-67299968 CTGGTGATATCCAGGCAAACAGG - Intergenic
1010307575 6:74343061-74343083 CTGCTGATACCCAGGCAAAGAGG - Intergenic
1011306704 6:85935714-85935736 CTGCTGATACCCAGGCAAAGTGG - Intergenic
1011318604 6:86065094-86065116 CTGGTGATATCCAGGCAAACAGG - Intergenic
1011364879 6:86570434-86570456 CTGTGGATACCCAGGCAAACAGG + Intergenic
1011408191 6:87038463-87038485 CTGCTGATATCCAGGCAAACAGG - Intergenic
1012043503 6:94239522-94239544 CTGGTGATATCCAGGCAAACAGG + Intergenic
1012128055 6:95454978-95455000 CTGGTGATATCCAGGCAAACAGG + Intergenic
1012459806 6:99447913-99447935 CTGCTGATATCCAGGCAAACAGG + Intronic
1012709689 6:102582852-102582874 GTGTGGCCTTCCAGGCCAAGTGG + Intergenic
1012941078 6:105415845-105415867 CTGGTGCTACCCAGGCAAACAGG + Intergenic
1013200628 6:107891859-107891881 CTGGTGATACCCAGGCAAAGAGG - Intronic
1013448962 6:110259833-110259855 CTGTGGATACCCAGGCAAACAGG + Intronic
1013598139 6:111679567-111679589 CTGTGGTTATTCAGCCAAAAAGG - Intronic
1014345782 6:120267995-120268017 CTGTTGATACCCAGGCAAACAGG - Intergenic
1015802165 6:137070969-137070991 CTGGTGATAGCCAGGCAAAGAGG + Intergenic
1016296453 6:142577856-142577878 CTGCTGGTACCCAGGCAAAGAGG + Intergenic
1016334952 6:142994589-142994611 CTGGTGATACCCAGGCAAAGAGG + Intergenic
1016873606 6:148842623-148842645 CTGTGGTTATCCCAGCAAAGTGG + Intronic
1020645599 7:10811175-10811197 CTGCTGATATCCAGGCAAACAGG - Intergenic
1020693731 7:11390897-11390919 CTGGTGATATCCAGGCAAATAGG - Intronic
1020884445 7:13804246-13804268 CTGTTGATACCCAGGCAAACGGG + Intergenic
1021141106 7:17026560-17026582 CAGTTGCTATCCTGGCTAAGTGG + Intergenic
1021392758 7:20114498-20114520 CTCTGGCTAACTAGGCAATGTGG - Intergenic
1021502214 7:21344585-21344607 CTGGTGATACCCAGGCAAAGAGG - Intergenic
1022814725 7:33904028-33904050 CTAAGGGTCTCCAGGCAAAGTGG - Intergenic
1023771419 7:43560144-43560166 CTATGGCTAAACAGGCGAAGTGG - Intronic
1024000780 7:45188107-45188129 CTGGGGCAGTCCAGGCAACGTGG + Intergenic
1024604529 7:51013050-51013072 CAGTGGCTATCTAGGAAATGAGG - Intergenic
1025034146 7:55582468-55582490 CTGTTGATACCCAGGCAAACAGG - Intergenic
1025171746 7:56764555-56764577 CTGTGGCTATTTAGGAAAATGGG - Intergenic
1025687860 7:63733318-63733340 CTGTTGATACCCAGGCAAACAGG + Intergenic
1025700118 7:63810983-63811005 CTGTGGCTATTCAGGAAAATGGG + Intergenic
1027573743 7:79905728-79905750 CTGTGGCTCTCCTGGTAGAGGGG + Intergenic
1027792438 7:82650708-82650730 CTGCTGATACCCAGGCAAAGAGG + Intergenic
1027910621 7:84245655-84245677 CTGGTGCTACCCAGGCAAACAGG - Intronic
1028200453 7:87955407-87955429 CTGCTGATATCCAGGCAAACAGG - Intronic
1028652755 7:93169713-93169735 CTGGTGCTACCCAGGCAAACAGG - Intergenic
1028981140 7:96969234-96969256 CTGTGGTTTTCCAGACAATGGGG + Intergenic
1030202544 7:106919631-106919653 CTGGTGATATCCAGGCAAACAGG + Intergenic
1030534125 7:110744586-110744608 CTGGTGCTACCCAGGCAAACAGG + Intronic
1032451873 7:132038439-132038461 CTGTGGCTGGGCAGGAAAAGTGG - Intergenic
1033253924 7:139783125-139783147 CTGTGGCTTTAAGGGCAAAGGGG + Intronic
1033264718 7:139874805-139874827 ATGTGTCTAGCCAGGCACAGTGG + Intronic
1033547844 7:142418171-142418193 GTGTGGCTGTGCAGGAAAAGTGG + Intergenic
1033597685 7:142868549-142868571 CTGTGGCCATCCAGGCCCTGTGG + Exonic
1033680134 7:143585240-143585262 CTGGTGATACCCAGGCAAAGAGG + Intergenic
1033691701 7:143744202-143744224 CTGGTGATACCCAGGCAAAGAGG - Intergenic
1034379605 7:150679210-150679232 CTGCTGATACCCAGGCAAAGAGG + Intergenic
1037119313 8:15264311-15264333 CTGTGGCTGACCAAGCAAAAAGG + Intergenic
1038107596 8:24453923-24453945 CTGCGGATACCCAGGCAAACAGG - Intronic
1038211673 8:25523880-25523902 CTGGTGATACCCAGGCAAAGAGG + Intergenic
1038870526 8:31489085-31489107 CTGCTGATATCCAGGCAAACAGG - Intergenic
1040086603 8:43349711-43349733 CTGCTGATACCCAGGCAAAGAGG - Intergenic
1040109064 8:43558184-43558206 CTGTGGCTTTTCAGAAAAAGGGG + Intergenic
1040446883 8:47504905-47504927 CTGCTGATATCCAGGCAAACAGG - Intronic
1041123076 8:54607317-54607339 CTGCGGATACCCAGGCAAACAGG - Intergenic
1041295795 8:56356473-56356495 CTGTTGATACCCAGGCAAACAGG - Intergenic
1041574818 8:59381676-59381698 CTGGTGATATCCAGGCAAACAGG + Intergenic
1044719216 8:95129626-95129648 TTGTGACTATCCAGGTAGAGAGG + Intergenic
1044767585 8:95593348-95593370 CTGGTGATATCCAGGCAAACAGG - Intergenic
1045103503 8:98868365-98868387 GTGTTGCTATCCAGGGGAAGTGG - Intronic
1045173999 8:99700581-99700603 CTGTGCCTAGCCTAGCAAAGTGG + Intronic
1045185080 8:99829900-99829922 CTGGTGATATCCAGGCAAACAGG - Intronic
1045201822 8:99990951-99990973 CTGGTGATACCCAGGCAAAGAGG + Intronic
1046524897 8:115371185-115371207 CTGGTGATATCCAGGCAAACAGG + Intergenic
1046880971 8:119307603-119307625 CTGGTGATATCCAGGCAAACAGG + Intergenic
1046947378 8:119987332-119987354 CTGGTGATACCCAGGCAAAGAGG - Intronic
1048879321 8:138859739-138859761 CTGAGGATCTGCAGGCAAAGGGG + Intronic
1049808162 8:144550745-144550767 CAGGGGCTAGCCAGGCAGAGTGG + Intronic
1050604086 9:7282991-7283013 TTGTCGATACCCAGGCAAAGAGG - Intergenic
1050852149 9:10301104-10301126 CTGGTGATACCCAGGCAAAGAGG + Intronic
1051057550 9:13005415-13005437 CTGAAGGTTTCCAGGCAAAGTGG + Intergenic
1051223540 9:14875948-14875970 CTGTGGATACCCAGGCAAACAGG - Intronic
1051611544 9:18967047-18967069 CTGTTGATACCCAGGCAAACAGG - Intronic
1051674491 9:19546004-19546026 CTGGTGATATCCAGGCAAACAGG - Intronic
1051879327 9:21824375-21824397 CTGCTGATATCCAGGCAAACAGG - Intronic
1052134177 9:24889618-24889640 CTGGAGATATCCAGGCAAACAGG + Intergenic
1052145640 9:25045248-25045270 CTGCTGATATCCAGGCAAACAGG - Intergenic
1052149943 9:25102854-25102876 CTGCTGATACCCAGGCAAAGAGG + Intergenic
1052793603 9:32901992-32902014 CTGCGGCTTTCCAGGCATGGGGG - Intergenic
1053298392 9:36931258-36931280 CTGAGGCTGAGCAGGCAAAGGGG + Intronic
1054257185 9:62827634-62827656 CTGTTGATACCCAGGCAAACAGG - Intergenic
1054334130 9:63788091-63788113 CTGTTGATACCCAGGCAAACAGG + Intergenic
1056190568 9:84180506-84180528 ATGAGGCTCTCCAGGCACAGAGG + Intergenic
1056302540 9:85257450-85257472 CTGTTGATATTCAGGCAAACAGG - Intergenic
1056552471 9:87663511-87663533 CTGGGGATATCCAGTGAAAGAGG - Intronic
1056700959 9:88907790-88907812 CTGTTGATAGCCAGGCAAACAGG + Intergenic
1057324639 9:94050487-94050509 CTGCTGATATCCAGGCAAACAGG - Intronic
1059073591 9:111166169-111166191 CTATGGCTACCCAGGCAATCAGG - Intergenic
1062101593 9:134731395-134731417 CTGTGGCTATCCGGTCAACTGGG - Intronic
1062297704 9:135841688-135841710 CTGGTGATATCCAGGCAAACAGG + Intronic
1185806298 X:3060149-3060171 CTGGTGATATCCAGGCAAACAGG + Intronic
1186176845 X:6933354-6933376 CTGCGGATACCCAGGCAAACAGG + Intergenic
1186773218 X:12838658-12838680 CTGGGGATACCCAGGCAAACAGG - Intergenic
1186993014 X:15089266-15089288 CTGCTGATACCCAGGCAAAGAGG + Intergenic
1189033816 X:37476089-37476111 CTGTGGCTGACCAGTCAAAGTGG - Intronic
1189189721 X:39089645-39089667 CTGGTGATACCCAGGCAAAGAGG + Intergenic
1189392878 X:40591777-40591799 CACTGGCTATTCAGGCAATGTGG + Intronic
1190774609 X:53542671-53542693 CTGTAGCTATCCAGGACAAAAGG + Intronic
1191032584 X:55990773-55990795 CTGCTGATACCCAGGCAAAGAGG - Intergenic
1191628158 X:63291204-63291226 CTGCTGATATCCAGGCAAACAGG - Intergenic
1191990239 X:67027035-67027057 CTGCTGATACCCAGGCAAAGAGG + Intergenic
1192205598 X:69093948-69093970 CTGTGGTGAGCAAGGCAAAGAGG + Intergenic
1192243284 X:69351611-69351633 CTGCGGATACCCAGGCAAACAGG + Intergenic
1192612989 X:72586266-72586288 CTGGTGATAACCAGGCAAAGAGG + Intronic
1192662893 X:73060524-73060546 CTGCTGCTACCCAGGCAAACAGG + Intergenic
1192674672 X:73183216-73183238 CTGGTGATATCCAGGCAAACAGG + Intergenic
1192741105 X:73893354-73893376 CTGGTGATATCCAGGCAAACAGG + Intergenic
1192755078 X:74039210-74039232 CTGCTGATATCCAGGCAAACAGG - Intergenic
1192825991 X:74696543-74696565 CTGGTGCTACCCAGGCAAACAGG + Intergenic
1192854924 X:74999279-74999301 CTGTGGATACCCAGGCAAACAGG - Intergenic
1192910731 X:75601769-75601791 CTGAGGATATCCAGGCAAACAGG - Intergenic
1193075273 X:77348327-77348349 CTGGTGATACCCAGGCAAAGAGG + Intergenic
1193079446 X:77391045-77391067 CTGGTGATAGCCAGGCAAAGAGG + Intergenic
1193394569 X:80968442-80968464 CTGGTGATATCCAGGCAAACAGG + Intergenic
1193399681 X:81027693-81027715 CTGCTGGTATCCAGGCAAACAGG + Intergenic
1193630511 X:83881106-83881128 CTGTTGCTATTCAAGGAAAGTGG + Intronic
1193684115 X:84556398-84556420 CTGTTGATACCCAGGCAAATGGG + Intergenic
1193805018 X:85984940-85984962 CTGTGACTTTCCAGGCAACCTGG + Intronic
1194330116 X:92572594-92572616 CTGTGGCTGGCCAGGCGCAGTGG + Intronic
1195434600 X:104828430-104828452 CTGGTGATATCCAGGCAAACAGG - Intronic
1195844154 X:109208594-109208616 CTGGTGATATCCAGGCAAATAGG - Intergenic
1196019204 X:110972399-110972421 CTGGAGATACCCAGGCAAAGAGG + Intronic
1197098249 X:122621149-122621171 CTGTTGATACCCAGGCAAAGAGG - Intergenic
1197191181 X:123649154-123649176 CTGGAGCTACCCAGGCAAACAGG + Intronic
1199344240 X:146719898-146719920 CTGTTGATACCCAGGCAAAGAGG + Intergenic
1199411898 X:147534010-147534032 CTGAGGCTATCCACGCACATGGG - Intergenic
1199914589 X:152325563-152325585 CTGGTGATACCCAGGCAAAGAGG + Intronic
1199996372 X:153029101-153029123 CTGGGGCTATGCAGGGAAACTGG - Intergenic
1200112069 X:153745417-153745439 CTGTGGCCATCCATGCATAAAGG - Intergenic
1200638822 Y:5691776-5691798 CTGTGGCTGGCCAGGCGCAGTGG + Intronic
1201913661 Y:19158877-19158899 CTGGTGATATCCAGGCAAACAGG + Intergenic