ID: 956621608

View in Genome Browser
Species Human (GRCh38)
Location 3:71226596-71226618
Sequence AATGAGATGCAGAAGGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 375}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956621608 Original CRISPR AATGAGATGCAGAAGGGGGT AGG (reversed) Intronic
901991103 1:13114552-13114574 AATGAGCTGCTCATGGGGGTGGG + Intergenic
902590341 1:17469508-17469530 ACTAACATGAAGAAGGGGGTGGG + Intergenic
904917139 1:33978225-33978247 AATGAGATGCTCAATGTGGTGGG - Intronic
905448259 1:38041493-38041515 AGTGAGATGCGGAAGGAGATGGG + Intergenic
906182416 1:43833699-43833721 AATGAGAGGCAGAAAGGGGAAGG + Intronic
907270440 1:53287967-53287989 AAAGAGATAGAGACGGGGGTGGG + Intronic
907509489 1:54947580-54947602 ATTGAGATGCAGAGAGGGGAAGG + Intergenic
907669477 1:56462178-56462200 AATGAAATGCAGAAGTGGCTGGG - Intergenic
907826473 1:58021896-58021918 GTTCAGAAGCAGAAGGGGGTTGG + Intronic
908673574 1:66576093-66576115 AATAAGATGCAGATGGGACTTGG + Intronic
908810877 1:67981199-67981221 AATGGGAGGCAGGTGGGGGTGGG + Intergenic
908819184 1:68065932-68065954 GAGGAGATGAAGATGGGGGTGGG - Intergenic
909195067 1:72609493-72609515 AAAGAGATGCAGAAGGGAAGAGG + Intergenic
910623421 1:89281098-89281120 AGTGAGGTGCAGAAGAGGTTAGG - Intergenic
911239536 1:95449806-95449828 AAAGAGGTGCTGAAGAGGGTAGG - Intergenic
911300825 1:96171559-96171581 ACTCAAATGGAGAAGGGGGTAGG - Intergenic
911365978 1:96937669-96937691 AAGGAGATGTTTAAGGGGGTAGG + Intergenic
911459296 1:98169364-98169386 ATTTAGATGAAGAAGGTGGTGGG - Intergenic
911820315 1:102411265-102411287 AAGGAGAAGGAGAAGGGGGGTGG + Intergenic
912459805 1:109823031-109823053 AAGGACATGCAGAATGTGGTGGG + Intergenic
912950765 1:114118757-114118779 GAGGAGAGGCAGATGGGGGTGGG - Intronic
914817107 1:151071138-151071160 AAGGAGGTGAAGAAGGGGGTGGG + Intronic
915032766 1:152897739-152897761 AATGAGATGAAGAAGGGCACGGG + Intergenic
915107981 1:153546137-153546159 AAGGAGATGCAGGGGGTGGTGGG + Intronic
915271434 1:154756452-154756474 ACTGAGCCGCAGAAGGGGGCAGG - Intronic
916279198 1:163030114-163030136 AATGAGATGAGGAAGCGGGTTGG - Intergenic
919713516 1:200751855-200751877 AATTAGATGGAGAATAGGGTTGG + Intronic
919893645 1:201994395-201994417 CATGAGATGCCCAAGAGGGTCGG - Intronic
921734505 1:218612007-218612029 GAGGAGAAGGAGAAGGGGGTAGG - Intergenic
922482969 1:225951786-225951808 AATGAAATGCCAAAGGGGGAAGG - Intergenic
922625029 1:227031426-227031448 AATGAGAAGAATAAGTGGGTGGG - Exonic
922813907 1:228435565-228435587 ATTGAGGGGCAGGAGGGGGTCGG - Intergenic
923070547 1:230560601-230560623 CATGCTCTGCAGAAGGGGGTAGG - Intergenic
923236031 1:232033995-232034017 AAAAAAATGCAGAATGGGGTGGG - Intronic
924261101 1:242232692-242232714 AATGAGATGGGCAAGGTGGTGGG + Intronic
924516341 1:244769123-244769145 AAGGAGATACTGAAGAGGGTAGG - Intergenic
924658572 1:245995646-245995668 TCTGGGATGCAGTAGGGGGTGGG + Intronic
1062791844 10:311669-311691 AATGGGATGGAGAAGAGGGAGGG + Intronic
1063687750 10:8254767-8254789 GATGAAATGCAGAAGGGGAGAGG + Intergenic
1063813279 10:9739615-9739637 ACTGAGATGCAGAAGTGATTAGG - Intergenic
1063966104 10:11347148-11347170 AATGACATGAAATAGGGGGTTGG - Intergenic
1064724814 10:18268066-18268088 ACTCAGATGCAGAGGGAGGTGGG - Intronic
1064754920 10:18565025-18565047 AATGAAATGGAGAATGGAGTGGG - Intronic
1065845347 10:29738481-29738503 CATGAGATGGAGTAGGGGATAGG - Intergenic
1066380127 10:34893963-34893985 AATGAAATCCAGAAGGGGCCAGG - Intergenic
1066402220 10:35087596-35087618 ACTGAGATGAAGAAGAGGTTGGG - Intronic
1066658780 10:37720096-37720118 TCTGAGATGCAGAGGGGGCTGGG - Intergenic
1067690294 10:48497463-48497485 AAGGAGATGCAGAAGGCAGAGGG + Intronic
1068933261 10:62612679-62612701 AAGGAGATGCAGAAGCAGGGGGG + Intronic
1070504212 10:77098875-77098897 AATAAGATGCAGAGGGGTGAGGG - Intronic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072525895 10:96271313-96271335 AAGGAGATGAAGAAGGGTATTGG + Intronic
1072668219 10:97409953-97409975 ATTTAGCTGCAGAAGGGGCTGGG + Intronic
1072873060 10:99141176-99141198 AATGAGAGGGAGAATTGGGTAGG - Intronic
1073872297 10:107879544-107879566 AAAGAGGTGCTGAAGAGGGTAGG + Intergenic
1075275443 10:121088971-121088993 ATTGAGATGCAGAGGGTGGATGG + Intergenic
1075982966 10:126756906-126756928 AATGAGATGTGGAAAGCGGTGGG - Intergenic
1077736970 11:4801467-4801489 AATGAGAGAGAGAAGGGGGAGGG + Intronic
1077849272 11:6058682-6058704 AATGAGATGGAGAAAATGGTGGG - Intergenic
1078091263 11:8266088-8266110 AATGGGCTGCAGAAGCAGGTAGG + Intronic
1078386659 11:10898827-10898849 AATGAGATAGGGAGGGGGGTGGG + Intergenic
1078566723 11:12421127-12421149 CATGAGATGGACAAGGTGGTGGG + Intronic
1078693216 11:13602803-13602825 AATTAGATGAAGGAGGAGGTTGG - Intergenic
1078996545 11:16706603-16706625 AATGAGAAGCAGAGAGGGGTTGG + Intronic
1079138945 11:17794965-17794987 CAGCAGATGCAGAAGGGGGCAGG - Intronic
1079254219 11:18812652-18812674 AATGAGATGGAGAAGTCTGTTGG - Intergenic
1080088188 11:28312067-28312089 AATGTGATGAAGAAAAGGGTGGG - Intronic
1080355866 11:31444907-31444929 TAGGAGATGGAGAAGAGGGTTGG + Intronic
1080434393 11:32226237-32226259 AATGAGAGGAAGAGGAGGGTCGG - Intergenic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1080580632 11:33640423-33640445 AATGAGAGGCAGAAGAGGTGTGG - Intronic
1080790857 11:35521349-35521371 AATGAGAGGGAGAAGGTGGAAGG - Intronic
1082176455 11:49065900-49065922 AATCAAATGAAGGAGGGGGTGGG - Intergenic
1082885024 11:58072585-58072607 AATGAGCTTCAGACGGGTGTGGG + Intronic
1084863743 11:72039621-72039643 TATCAGGTGGAGAAGGGGGTGGG - Intronic
1086716599 11:90069996-90070018 AATCAAATGAAGGAGGGGGTGGG - Intergenic
1089493726 11:118898481-118898503 ACTGCGCTGCCGAAGGGGGTGGG + Exonic
1089707424 11:120289767-120289789 AATGAGATGAAGAAGGCTCTCGG - Intronic
1089725092 11:120470228-120470250 AATGAGTTGAAGAAGGGTGGTGG + Intronic
1090097456 11:123756929-123756951 TGTGAGATGCAGAGGGAGGTGGG + Intergenic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090578103 11:128130837-128130859 AATGAAAAGCAGAAGGAGTTGGG - Intergenic
1092087730 12:5777615-5777637 AAGGAGAGGAAGATGGGGGTGGG - Intronic
1093202990 12:16212072-16212094 AATGAAATGCTGAAGGATGTAGG + Intronic
1095201976 12:39395375-39395397 AATGCGGTGAAGAAGCGGGTGGG - Intronic
1096478033 12:51920665-51920687 AGAGAGATGCAGAGGGAGGTGGG - Intronic
1098205081 12:68100465-68100487 AATCAGAGGCAGGAGAGGGTAGG + Intergenic
1098817352 12:75184018-75184040 AATAGGATGGAGAAGTGGGTGGG - Intronic
1098957730 12:76704880-76704902 AATGAGTAAGAGAAGGGGGTGGG - Intergenic
1099188117 12:79537906-79537928 AATGAGACACAGAAGGAAGTGGG + Intergenic
1100118962 12:91345584-91345606 AATAATATGCAGAAGGCAGTAGG - Intergenic
1100520812 12:95373959-95373981 CATGAAGTCCAGAAGGGGGTTGG + Intergenic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1101252802 12:102951788-102951810 AATGAGAAGAAGGAGGGGGAAGG - Intronic
1101734211 12:107450793-107450815 ACTGAGAGGCAGGAGGGGGAGGG + Intronic
1101972855 12:109328597-109328619 CATGAAATGCAGAAGGGGAAAGG - Intergenic
1102065475 12:109971564-109971586 TTTGGGAGGCAGAAGGGGGTGGG - Intronic
1102651491 12:114445608-114445630 AATGAGATTCGGAGGCGGGTGGG - Intergenic
1102822962 12:115923841-115923863 GAGGAGAAGGAGAAGGGGGTGGG - Intergenic
1103461168 12:121106370-121106392 AAAGAGATGCTGAAGAGGGCAGG + Intergenic
1104085155 12:125467435-125467457 AAGGAGAAGAAGAAGAGGGTGGG - Intronic
1106107249 13:26743248-26743270 AGAGAGATGGAGAAGGGGGCTGG + Intergenic
1107235403 13:38162559-38162581 AACGAGTTGCAGAAGGGTGATGG - Intergenic
1107604072 13:42040961-42040983 AAGGAGAAGCGGGAGGGGGTGGG - Intronic
1108068715 13:46605543-46605565 AATGAGGTGGAGGAAGGGGTAGG - Intronic
1108340467 13:49494702-49494724 AATGAATTGCAGAAGAGTGTGGG - Exonic
1108419890 13:50237939-50237961 AATGAGATGTAGAAAGGGGATGG + Intronic
1108903519 13:55442743-55442765 AATGAGAAACAGATTGGGGTGGG + Intergenic
1109382001 13:61575033-61575055 AATGAGATGGGGGAGTGGGTAGG - Intergenic
1110094257 13:71496547-71496569 ATTGAGACTCAGAAGGGTGTGGG + Intronic
1111735193 13:92129059-92129081 AATGTGTTGAACAAGGGGGTTGG - Intronic
1113356191 13:109582694-109582716 AAGGAGATGCAGAAGGTGTTTGG + Intergenic
1113967829 13:114164392-114164414 AAGGAGAGGCAGATGGGGGAAGG + Intergenic
1114657675 14:24325813-24325835 AAGGAGATGGAGAAAGAGGTGGG - Exonic
1115975275 14:38990317-38990339 AATGGGATTAAGAAGGTGGTTGG + Intergenic
1117572126 14:57058020-57058042 ACTCAGATGCAGTTGGGGGTTGG - Intergenic
1119294414 14:73521374-73521396 AGTGAGATGACGAAGGAGGTGGG - Intronic
1119547924 14:75486637-75486659 ACTGGGATGCAGAGTGGGGTTGG + Intergenic
1120618102 14:86732524-86732546 AGAGACATGGAGAAGGGGGTGGG - Intergenic
1120953685 14:90063259-90063281 AATGGGATGGAGGCGGGGGTAGG + Intronic
1121734010 14:96205472-96205494 AATCAGAAGCAGGCGGGGGTGGG + Intronic
1122191081 14:100044194-100044216 ATTGTGAAGCAAAAGGGGGTTGG + Intronic
1122307743 14:100776433-100776455 AATGAGAAGCAGGAGGGAGAGGG + Intergenic
1122354610 14:101115306-101115328 AACGAGATGCAGAAGGAGACGGG - Intergenic
1124943308 15:34238784-34238806 AATGTGAAGCTGAAGGGGGTAGG + Intronic
1125171530 15:36771116-36771138 AATGAGATACAGAATGGCCTGGG - Intronic
1125385629 15:39133510-39133532 AGTGAGAAGCAAGAGGGGGTTGG + Intergenic
1126369272 15:47928579-47928601 AATGAGATGCACTTGTGGGTGGG - Intergenic
1126750004 15:51866985-51867007 AATGAGTTGCAAAAAGGGATAGG + Intronic
1126778152 15:52117489-52117511 AAAAGGATGCAGCAGGGGGTGGG - Exonic
1128823910 15:70691931-70691953 AAGGAAATGCCAAAGGGGGTAGG + Intronic
1129711128 15:77820634-77820656 ACTGAGGTGCAGAGAGGGGTCGG - Intronic
1130008906 15:80131753-80131775 TATCAGATGCAGATGGTGGTGGG + Intronic
1131014142 15:89043472-89043494 AAGGAGAGGAAGAAGGGGGAGGG + Intergenic
1131592538 15:93765505-93765527 AATGTGACAAAGAAGGGGGTAGG - Intergenic
1132078039 15:98839345-98839367 AATGAGAGGCAGTAGAGAGTAGG - Intronic
1132293375 15:100718564-100718586 AATGAGATGAAGAAATGGGGCGG + Intergenic
1133242443 16:4423216-4423238 ACTGAGATGAACAAGGGTGTTGG - Intronic
1134200612 16:12195480-12195502 TATGAGATGCCTAAGGGGGTTGG + Intronic
1135556389 16:23440403-23440425 AATGAGATACAAAGGGAGGTTGG + Intronic
1135783039 16:25323160-25323182 AATGAGATAGAGAAGTGGGTGGG + Intergenic
1135948866 16:26893153-26893175 AATGACAAGCAGGAGGGGGCTGG - Intergenic
1136616591 16:31402050-31402072 CAGGAGCTGCAGGAGGGGGTTGG + Intronic
1137955589 16:52825685-52825707 AATGAGTTGCAGAGGGAGGCAGG - Intergenic
1138457443 16:57129456-57129478 ACTGAGATGAGGAACGGGGTGGG + Intronic
1139371864 16:66473944-66473966 TATGAGATGGAGCAGGGAGTGGG - Intronic
1140722217 16:77782271-77782293 GATGAGATCCAAGAGGGGGTAGG - Intergenic
1140732456 16:77869126-77869148 AATGAGTAGCAGAAGGGGGAAGG + Intronic
1140744800 16:77971989-77972011 AATCAGATGCAGACACGGGTGGG + Intronic
1140754688 16:78056701-78056723 AATGAGCTGCAGGAGGTGGGAGG - Intronic
1142027996 16:87824668-87824690 AGGGGGATGCAGAAGAGGGTGGG - Intergenic
1142480145 17:214003-214025 AATGAGATGGAGGAGCTGGTGGG + Intronic
1142521488 17:507883-507905 ACTGGGATGGAGAAGGGGCTTGG - Intergenic
1143385988 17:6530794-6530816 ATTTAGATGCTGGAGGGGGTTGG + Intronic
1143460645 17:7101386-7101408 AATGAATTACAGAAGGAGGTGGG + Exonic
1143880062 17:10023117-10023139 CATGAGATGCTGAAAGAGGTGGG + Intronic
1144754902 17:17673586-17673608 GAAGAGATGCAGATGGGGGGTGG - Intergenic
1146919220 17:36698735-36698757 AGTGAGATTCAGAGGGAGGTAGG + Intergenic
1148806472 17:50266544-50266566 GATGAGATGGAGCAGGGGGGAGG - Intergenic
1148925568 17:51081883-51081905 AATGGGAAGGAGAAGAGGGTAGG - Intronic
1150541374 17:66103712-66103734 AATGAGATGCCAAAGAAGGTAGG + Intronic
1150944250 17:69727205-69727227 AAAGAGAGAGAGAAGGGGGTGGG + Intergenic
1151389245 17:73774674-73774696 AATGAGATTCAGATGGGGCCAGG - Intergenic
1151942031 17:77298713-77298735 AATGAGATGCAGAAAGGCAGGGG - Intronic
1152066692 17:78115986-78116008 AGTGAGTTGCAGAAGGGGGTCGG - Intronic
1153415692 18:4843625-4843647 AATGATATGCATAAAGGGCTTGG + Intergenic
1153740064 18:8115379-8115401 GATGAGCTGCAAAAGTGGGTAGG + Intronic
1155402780 18:25457370-25457392 AATGACATGCAGAAGGAGCAGGG + Intergenic
1155449819 18:25951827-25951849 AAGGAGTAGCAGAAGTGGGTAGG - Intergenic
1155481039 18:26287919-26287941 AATGAGATGCAGAGTGGGAAGGG - Intronic
1155621666 18:27786596-27786618 AATGGGATCCAGAAGGGTGGAGG + Intergenic
1155961790 18:32001452-32001474 AGAGACATGGAGAAGGGGGTGGG - Intergenic
1156912506 18:42426977-42426999 AAAGAGAAACTGAAGGGGGTAGG - Intergenic
1158518162 18:58147946-58147968 AATGCAATGCAGAAGGGGCTGGG + Intronic
1158523044 18:58187818-58187840 AATGAAATGCACATGGGGGTGGG - Intronic
1159127329 18:64238777-64238799 CAGGAAATGGAGAAGGGGGTTGG - Intergenic
1159491502 18:69140749-69140771 CAAGAGAAGAAGAAGGGGGTGGG + Intergenic
1160250884 18:77202651-77202673 AATGAGATGCAGAAGCCAGCAGG - Intergenic
1160817105 19:1041258-1041280 AATGAGGTTCAGAAAGGGGCAGG + Exonic
1162134119 19:8544693-8544715 GCTGAGGTGCAGAAGTGGGTGGG + Intronic
1162134323 19:8545803-8545825 GATGAGATGGAGAAGGGGAGAGG - Intronic
1162248878 19:9425897-9425919 ACTGAGAGGCAGAAGGGGTAAGG + Intronic
1163782394 19:19257394-19257416 AGTGAGATGCAGAAGGTGTACGG + Exonic
1164604028 19:29583128-29583150 AATGGGATGAAGGAGGGGGCCGG - Intergenic
1164727418 19:30475686-30475708 AAGGACATGGAGAAGGGGCTGGG - Intronic
1164922742 19:32101799-32101821 ATGGAGACTCAGAAGGGGGTGGG - Intergenic
1165420660 19:35720598-35720620 GAGGAGATGTCGAAGGGGGTGGG - Exonic
1165794113 19:38508811-38508833 AATGAGATGGAGTTGGGGGTTGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166773818 19:45300414-45300436 GATGAGAGGCAAAAGGAGGTGGG - Intronic
1167482896 19:49744161-49744183 AAGGAGATGCGGAAGGAGATGGG - Intronic
1167622544 19:50567772-50567794 AATGGGAGGCAGAAGCCGGTGGG - Intronic
925517061 2:4694590-4694612 AATGATGTGCAGAATGGTGTTGG - Intergenic
926218093 2:10917651-10917673 TATGAGAATCAGAATGGGGTGGG - Intergenic
929153010 2:38764785-38764807 AATGAACTCCAGAAGGGGCTGGG - Intronic
929479263 2:42287913-42287935 CATAAGATGCAGAAGGGACTAGG + Intronic
930515264 2:52399755-52399777 AATTAGATCCAGAAGGAGGAAGG - Intergenic
930845555 2:55899826-55899848 AATGCAATGCAGAATGGGGTAGG + Intronic
931183475 2:59927054-59927076 AGTGAGAAGCAGGAGGGGGTAGG + Intergenic
932078432 2:68688835-68688857 AATAAAAAGCAAAAGGGGGTTGG - Intronic
932209827 2:69917703-69917725 AATGAGATGTTGAAGTGGCTTGG + Intronic
932429568 2:71666038-71666060 AATGAGAAGGAGGAGGGGGTGGG - Intronic
932814986 2:74854362-74854384 AAGGAGATGGAGAAAGGGCTTGG + Exonic
934977192 2:98811163-98811185 AAAGAGGTTCAGAAAGGGGTGGG + Intronic
935975418 2:108573761-108573783 AATGAGCTAGAGAAGGGTGTAGG + Intronic
937262344 2:120594682-120594704 GATGCGATTCAGAAGGCGGTGGG - Intergenic
937911507 2:127077885-127077907 AATGAGAAGGAAACGGGGGTAGG + Intronic
938099442 2:128488255-128488277 AATGAGTTGAAGGAGGAGGTGGG - Intergenic
938966124 2:136390139-136390161 AATGAGGTGCAGAATGGGTTGGG - Intergenic
939176249 2:138751031-138751053 AATGAGAAAGAGATGGGGGTGGG - Intronic
939588108 2:144030133-144030155 AATGATTTGAATAAGGGGGTTGG + Intronic
939608308 2:144279343-144279365 GAGGAGATGCAGTAGAGGGTGGG - Intronic
939700525 2:145385681-145385703 AATGAGATGCCCAAGAAGGTTGG + Intergenic
941712665 2:168730474-168730496 AATGAGAAATAGCAGGGGGTGGG + Intronic
941712752 2:168731615-168731637 AAGGAGAAGTAGCAGGGGGTGGG + Intronic
941795547 2:169595075-169595097 AATGAGCTGCATGAGGTGGTGGG - Intronic
941894316 2:170614029-170614051 AATAGAATGCAGAAGGGGATGGG - Intronic
942444712 2:176070464-176070486 AATGAGGTGGAGGTGGGGGTGGG - Intergenic
942455748 2:176137053-176137075 ACTGAGCTGCCCAAGGGGGTCGG - Intergenic
943370430 2:187009631-187009653 AATAAAATGAAGAAGGGGGAAGG - Intergenic
943649613 2:190442713-190442735 AAGGAGATGTAGAATGGGGTGGG + Intronic
944379036 2:199085486-199085508 AATTAGATGGAGAATAGGGTTGG + Intergenic
944504621 2:200397903-200397925 AAAGAGATGGGGAAGAGGGTAGG + Intronic
944586640 2:201178869-201178891 AATGGGAGGCAGAAGGGGGCAGG + Intergenic
945273838 2:207968512-207968534 AATGAGCTGAAGAATGGGATGGG - Intronic
945664430 2:212723072-212723094 AATGAGATGTAGAAAGAGATAGG + Intergenic
945694995 2:213091005-213091027 AAGGAGATGCAGAAGTGATTGGG + Intronic
946199661 2:218064449-218064471 ATTGAGATGGAGAGGTGGGTGGG - Intronic
947429389 2:230012378-230012400 AATGAGAAGCAGAGAGGGCTAGG - Exonic
947484879 2:230538808-230538830 AATGAGTTGAAGAAAGGGCTTGG - Intronic
947597360 2:231421523-231421545 AGGGAGATGTAGAAGGGGATGGG - Intergenic
948299374 2:236890524-236890546 GATGAGGTGCAGAAGGGGATGGG + Intergenic
948735729 2:240003769-240003791 GATGAGAAGCAGCAGGGGGTGGG + Intronic
948837807 2:240634714-240634736 CATGAGATTCGGAAGGGGCTAGG + Intergenic
1169541089 20:6600496-6600518 AGAGAAAAGCAGAAGGGGGTAGG + Intergenic
1170647046 20:18206969-18206991 TATGAGATTCAAAAGGGGGCAGG - Intergenic
1170941046 20:20848231-20848253 AAAGAGATGCAGGAGCGAGTAGG + Intergenic
1172152967 20:32803577-32803599 AGTGACATGCCGAAGGGGGAGGG + Intronic
1172949824 20:38715779-38715801 GGTGAGATGCAGGAGGGGGAGGG - Intergenic
1173311821 20:41903537-41903559 CATGAGATGCAGAAGCAGATTGG - Intergenic
1173577187 20:44120076-44120098 AATGAGAGGCAGGATGGCGTAGG - Intronic
1173651813 20:44671175-44671197 AGAGATATGGAGAAGGGGGTGGG - Intergenic
1174143639 20:48434954-48434976 CATGAGATGCAGAGGGGAGCAGG - Intergenic
1177673819 21:24270691-24270713 AAAGAGATGCAGAAGCAGATGGG - Intergenic
1178384524 21:32138435-32138457 ATGGGGATCCAGAAGGGGGTTGG - Intergenic
1179286703 21:39983816-39983838 GATGTGGTGCAGAAGGGGGAAGG - Intergenic
1180971960 22:19820496-19820518 ACTGAGGGGCAGAATGGGGTGGG - Intronic
1181500669 22:23313951-23313973 AAAGAGCTGCAGAAGGCGGTGGG - Exonic
1182985424 22:34711806-34711828 AATGAGATTAGGAAGGTGGTAGG + Intergenic
1183965087 22:41436759-41436781 ACTAAGATGAAGAAGGGGGGCGG - Exonic
1184928888 22:47665032-47665054 AAGAAGATGCAGAAGAGTGTAGG - Intergenic
1185009433 22:48304996-48305018 ACGGAGATGCAGCAGGGGGTGGG + Intergenic
950203810 3:11062762-11062784 AATGAGATGGAGAAGGCAGAGGG + Intergenic
950655259 3:14432520-14432542 AAGGAGATGGAAAAGGGGCTTGG + Intronic
951634093 3:24754102-24754124 AATGAAATATAAAAGGGGGTGGG - Intergenic
951829915 3:26915024-26915046 AATGTGATGGAGAAGGTGGCAGG + Intergenic
951942808 3:28099468-28099490 AATGAGAGTCAGAAGGCAGTGGG - Intergenic
952125630 3:30297278-30297300 AGTGAGAGGCAGTAGGAGGTAGG - Intergenic
952945424 3:38475550-38475572 AGGGAGTTGCAGAAAGGGGTTGG + Intronic
953510598 3:43534513-43534535 AAAGAGAGAGAGAAGGGGGTTGG + Intronic
953574689 3:44103577-44103599 AATGGGAGGGAGAGGGGGGTAGG + Intergenic
954123151 3:48512308-48512330 AAGGAGGTGCAGAAGAGGCTAGG - Intergenic
955621622 3:60870478-60870500 AAAGAGATGCAGGAGGTGGAAGG + Intronic
955760564 3:62276593-62276615 AAAGACATGGAGAAAGGGGTTGG + Intronic
956420494 3:69081738-69081760 CATGTGATGCAGAAGGAGGCTGG - Intergenic
956621608 3:71226596-71226618 AATGAGATGCAGAAGGGGGTAGG - Intronic
956833966 3:73080551-73080573 AATGAGAAGTAGAAGGTGGAGGG - Intergenic
959623976 3:108428757-108428779 AATGAGAGGCTGGAGGAGGTAGG - Exonic
959809110 3:110594418-110594440 CATGAGATTTAGCAGGGGGTAGG + Intergenic
961522091 3:127472798-127472820 AATGAGATGCAGGGCAGGGTGGG - Intergenic
961688131 3:128649772-128649794 AATGAGAAGCAGCAGGGGGAAGG + Intronic
961904175 3:130245382-130245404 ACTGAGAACCAGAAGGTGGTAGG + Intergenic
962299813 3:134229328-134229350 AAGGAGAGACAGAAGGGGTTGGG - Intronic
962603086 3:137010139-137010161 AATCAGCTGCAGAAGGGAGGAGG + Exonic
963520282 3:146354747-146354769 AGAGACATGGAGAAGGGGGTGGG - Intergenic
966842370 3:184100112-184100134 GATGAGATGAAGAATGGGGAGGG - Intronic
970485346 4:16519627-16519649 TAGGTGATGCAGAAGGGTGTAGG + Intronic
971012346 4:22452244-22452266 AATCACATGCATGAGGGGGTAGG + Intronic
971216505 4:24666742-24666764 AAGGAGATGCACAAGGTAGTAGG - Intergenic
973019860 4:45189104-45189126 AATGAGAAGCAGAGTGTGGTTGG - Intergenic
973892242 4:55378730-55378752 AAGGAGAGGTACAAGGGGGTTGG - Intergenic
975160944 4:71122744-71122766 AAGGAGATGCCGAGGGGGGATGG - Intergenic
975361608 4:73477253-73477275 AATGTGATGCAGGTGGGGGGTGG + Intergenic
977527960 4:98166985-98167007 AAAGAGGTACTGAAGGGGGTAGG - Intergenic
977701477 4:100027931-100027953 AATGAGTAGCAGAAGAAGGTAGG - Intergenic
980734809 4:136870761-136870783 ATTGAGATGCGGAAAGGGGAGGG + Intergenic
982088185 4:151857613-151857635 AATGAGATGGAGGAGGGAGATGG - Intergenic
985313586 4:188630936-188630958 AATGAGATGCAGAAGGGCACTGG + Intergenic
985993751 5:3584819-3584841 AATGAAAGGAAGAAGGGGGGAGG + Intergenic
986572729 5:9181860-9181882 AGTGAGATGGGGCAGGGGGTTGG - Intronic
987081206 5:14427190-14427212 GAGGAGCTGCAGAAAGGGGTGGG - Intronic
989456363 5:41648767-41648789 AATGGGATGCAGAAGGCAGAAGG - Intergenic
990996432 5:61736655-61736677 AATGAGATCCAGAAGGGTCTGGG + Intronic
991506802 5:67333448-67333470 TATGAAATGCAGAAGGGAGGAGG - Intergenic
992229539 5:74650510-74650532 ATTGGGCTGGAGAAGGGGGTTGG + Intronic
993069413 5:83140747-83140769 ATTGAGAAACAGAAAGGGGTGGG - Intronic
993426136 5:87766205-87766227 AATGAGAGCCAGAAAGGGGTGGG + Intergenic
993508255 5:88737952-88737974 AAGGAGAGACAAAAGGGGGTTGG + Intronic
994661823 5:102662980-102663002 ACTGAGATGCAAAAAGGGATGGG - Intergenic
996058840 5:119010484-119010506 CATGTAATGCAGAAGGGGGGAGG - Intergenic
996437237 5:123448266-123448288 AATGAGTAGCAGAAGAGGTTTGG + Intergenic
997527171 5:134560829-134560851 ATTGAGACGCAGGAGGGGCTGGG + Exonic
997750137 5:136336474-136336496 AATGAGAAGCAGAAAGGGCTAGG + Intronic
998046523 5:138991342-138991364 AGTGAAATGCAGTAGGGGCTGGG + Intronic
999109543 5:149106499-149106521 AAGGAAATGTACAAGGGGGTAGG - Intergenic
1000518601 5:162271794-162271816 AATGGCATGAAGAAGGGGTTTGG + Intergenic
1000677007 5:164133156-164133178 CATGAGATTCAGGAGGGGCTGGG + Intergenic
1001299518 5:170523813-170523835 ACTGAGAGGCAGACTGGGGTAGG - Intronic
1001791089 5:174458576-174458598 AAGGAGATGGGGAAGGAGGTGGG - Intergenic
1001791098 5:174458600-174458622 AAGGAGATGGGGAAGGAGGTGGG - Intergenic
1001791107 5:174458624-174458646 AAGGAGATGGGGAAGGAGGTGGG - Intergenic
1003093759 6:3126149-3126171 ACTGAAATGCAGAAGGGGTATGG - Intronic
1003812993 6:9805229-9805251 AGGGAGATGGAGAAGGGGGAGGG - Intronic
1004226532 6:13789811-13789833 AAAGAGATGGAGAAGAGGGAGGG + Exonic
1004462714 6:15853428-15853450 AAGGAGAAGCAGAAGGGGAAGGG - Intergenic
1004681104 6:17895546-17895568 ATTGAGATGCAGCCAGGGGTAGG - Intronic
1004861496 6:19807857-19807879 GATGAAATGCAGAAGAGGCTTGG + Intergenic
1007322231 6:41035653-41035675 AATTACATGCAGTAAGGGGTGGG + Intronic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1007942884 6:45798732-45798754 AAAGAGACACAGAAGTGGGTCGG - Intergenic
1010398366 6:75418993-75419015 AATGGGAGGCTGCAGGGGGTGGG - Intronic
1011305601 6:85922977-85922999 AAGGAGATGAAGAAGGGGGCGGG - Intergenic
1011629526 6:89310727-89310749 GATGAGAAGCGGGAGGGGGTGGG + Intronic
1011736312 6:90313896-90313918 AAGAATATGCAGAAGGGGATGGG - Intergenic
1013225270 6:108116087-108116109 ACTGGTATGCAGAAAGGGGTGGG + Intronic
1013554097 6:111238711-111238733 AATGAGATGAGGAAGGGTGGTGG + Intergenic
1014157848 6:118132845-118132867 ACTGAAATGCAGAAGGGGCGGGG + Intronic
1015655016 6:135508143-135508165 ATTAAGATGCAGAAGAGGGCGGG - Intergenic
1016088326 6:139943586-139943608 CATCAGAATCAGAAGGGGGTGGG + Intergenic
1018429584 6:163712941-163712963 AAAGAGATGAGGAAGGGGGTCGG - Intergenic
1018861109 6:167711455-167711477 AATGACATGCGGGAGGCGGTGGG + Intergenic
1019724730 7:2595273-2595295 ACTGAGAGGCAGGAGGGGCTTGG + Intronic
1019792360 7:3024336-3024358 AATGGGATTCAGAAGTGGGGAGG + Intronic
1021680196 7:23122345-23122367 AAGGAGAGGGAGAAAGGGGTGGG - Intronic
1022060239 7:26785996-26786018 AATGAGATGCAGACATGAGTTGG + Intronic
1022290386 7:28996837-28996859 AATGTGATGCTGAAGTGTGTGGG - Intronic
1022703009 7:32778868-32778890 AATGAGAGGCAGCAAGGGGCAGG - Intergenic
1024384870 7:48739445-48739467 CATGAGATTTAGAAGGGGCTAGG + Intergenic
1024491458 7:49990303-49990325 AATGGGGTGCCCAAGGGGGTGGG - Intronic
1026333832 7:69376978-69377000 AAAGAGATGCAGAAAGATGTAGG - Intergenic
1026578574 7:71595123-71595145 AAGGAGATGAGGAAGAGGGTTGG + Intronic
1027332029 7:77107248-77107270 AATGAGAAGGAGAAGGGGAAGGG - Intergenic
1028988923 7:97028624-97028646 AGAGAGCCGCAGAAGGGGGTGGG + Intergenic
1029537709 7:101165807-101165829 AATGAAATGCTGAAGCGGGCAGG + Intergenic
1029637466 7:101794510-101794532 AATGAAAAGCAGAAGCAGGTTGG + Intergenic
1029783746 7:102764077-102764099 AATGAGAAGGAGAAGGGGAAGGG + Intronic
1030767742 7:113432467-113432489 AGAGAGATGCAGAAGGTGGAGGG - Intergenic
1030807544 7:113936387-113936409 AAGGAGATGGAGAAGGAAGTTGG - Intronic
1031296451 7:120010069-120010091 AGAGACATGGAGAAGGGGGTGGG - Intergenic
1031346506 7:120673547-120673569 AATGATATGGAGAAGGAGGATGG - Intronic
1032803312 7:135333783-135333805 AAGGAGATGAAGAAGGGCCTTGG - Intergenic
1033205180 7:139414131-139414153 AATGAGGTGAAGAAGGGGGGTGG - Intronic
1033807872 7:144975313-144975335 CATGAGAAGCAGGATGGGGTGGG + Intergenic
1034274509 7:149818127-149818149 AAGGACAGGCAGAAGGTGGTGGG + Intergenic
1034359725 7:150483855-150483877 AATGTAATGTAGAAGGGGGTAGG - Intergenic
1036981841 8:13478248-13478270 AGTGAGAGAGAGAAGGGGGTAGG + Intronic
1037754682 8:21703249-21703271 AAGGAGAAAAAGAAGGGGGTGGG + Intronic
1038605090 8:28993559-28993581 AGTGGAATGAAGAAGGGGGTAGG + Intronic
1038814754 8:30890478-30890500 AAGGAGATTGAGAAGGGAGTGGG - Intronic
1039301418 8:36213198-36213220 AATGAGATGCCGAAAGTGGAAGG - Intergenic
1040530951 8:48265884-48265906 AAGAATATGCAGAAGGGGCTGGG - Intergenic
1040614474 8:49020465-49020487 ATTGGGATGGAGAAGGGCGTGGG - Intergenic
1041734599 8:61096380-61096402 AATCATATGGAGAAGAGGGTAGG - Intronic
1042124514 8:65524684-65524706 AATGAGATGCAGAAGACTATAGG - Intergenic
1042161958 8:65905460-65905482 CATGAGATTCAGCAGGGGGCAGG + Intergenic
1042401505 8:68353953-68353975 CCTCAGATGCAGAAGGGGATTGG - Intronic
1043859905 8:85304058-85304080 AATGAGGTGGAAAAGGGGGTTGG - Intergenic
1045064492 8:98433616-98433638 ATTGAGGTGAAGAAGTGGGTAGG - Intronic
1046301585 8:112299801-112299823 AATGAAATGCAAAAGGATGTTGG - Intronic
1047349681 8:124061817-124061839 GATGAGATGAAGAAGGGGCCTGG - Intronic
1048276118 8:133067299-133067321 AAGGAGAAGCAGATGGGGGTGGG - Intronic
1048443026 8:134473928-134473950 AAAGAGATGCAGAATGGAGGAGG + Intergenic
1048572942 8:135669952-135669974 AATGTGAGGCAGAAGAGGGAGGG - Intergenic
1049350591 8:142162443-142162465 AAAGAGATGAAGATGGGGGATGG + Intergenic
1052119363 9:24691996-24692018 AATGAGCTGCAGATAGGGGCTGG - Intergenic
1052939952 9:34125626-34125648 ACTGAGAGGGAGAAGGGGGCTGG - Intronic
1054845936 9:69798352-69798374 AAAGAGAGGCAGAAGTGAGTTGG - Intergenic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055415748 9:76081068-76081090 AATGATAGGCAAAAGGGGTTGGG + Intronic
1055695539 9:78879877-78879899 AATTAGTTGCAGAAAGGGTTTGG - Intergenic
1055874803 9:80929016-80929038 AATGATATGCAGAAGTGTATGGG + Intergenic
1056833659 9:89936428-89936450 CATGAGAGAAAGAAGGGGGTGGG + Intergenic
1057339814 9:94190056-94190078 AATGAGAAGCAGGAGGGGAGTGG - Intergenic
1057836673 9:98451071-98451093 ACTGAGACTCAGAAAGGGGTGGG - Intronic
1058067581 9:100566429-100566451 ACTGAGATGAAGAAGGTGGCAGG - Intronic
1058089122 9:100784072-100784094 AATGACATGCAAAAGTGGGGTGG - Intergenic
1058504681 9:105655979-105656001 AATGTGTTGGAGAAGGAGGTTGG + Intergenic
1059153043 9:111966398-111966420 AAAGATATGAAGAAAGGGGTGGG + Intergenic
1059350461 9:113660643-113660665 GATGAGATGGAAAAGGAGGTAGG + Intergenic
1059749581 9:117235280-117235302 AATGACATGCAATAGGGGCTTGG - Intronic
1060128975 9:121076701-121076723 AATGGGAGGCAGAGGTGGGTGGG + Intronic
1061534476 9:131239099-131239121 AGTTAGATGCGGAAGGGGGCAGG - Intergenic
1061751871 9:132784148-132784170 AAAGAGAAAGAGAAGGGGGTAGG + Intronic
1186474600 X:9847531-9847553 AATCAGAGGGAAAAGGGGGTTGG + Intronic
1186532850 X:10314687-10314709 AATGAGAGGCAGGAGAGGGAAGG + Intergenic
1186860626 X:13669029-13669051 AATGAGATACAAATAGGGGTAGG + Intronic
1187103931 X:16221342-16221364 AGAGACATGGAGAAGGGGGTTGG + Intergenic
1188089189 X:25941295-25941317 GATGAAATGCAGAAGGTGGATGG + Intergenic
1188848432 X:35102795-35102817 AGTGAGATGAAGAAGGAGCTAGG - Intergenic
1190114326 X:47616300-47616322 TCTGAGATGCAGAAGGGGAAGGG + Intronic
1190287569 X:48971325-48971347 AATGGGATTAAGAGGGGGGTGGG + Exonic
1190726195 X:53192508-53192530 AGGGAGAGGGAGAAGGGGGTAGG + Exonic
1194797398 X:98228604-98228626 AATTAGCTGCAGATGGGAGTGGG - Intergenic
1195206045 X:102601124-102601146 AATCAGCAGCAGCAGGGGGTGGG - Exonic
1196255713 X:113515849-113515871 AATGAGCTACAGTAGGGAGTTGG - Intergenic
1196488226 X:116238918-116238940 AATGAGATAGAGAAGGGGAAAGG - Intergenic
1198105031 X:133453961-133453983 TTGGAGATGCAGAAGAGGGTAGG - Intergenic
1199819186 X:151427651-151427673 AATGAGAAGCAGTGGGGGCTGGG + Intergenic
1200985843 Y:9303263-9303285 AATGACTGGCAGCAGGGGGTGGG + Intergenic
1202124733 Y:21557632-21557654 AATGACTGGCAGCAGGGGGTGGG - Intergenic
1202154275 Y:21871748-21871770 AATGACTGGCAGCAGGGGGTGGG + Intergenic
1202195251 Y:22294442-22294464 AATGACTGGCAGCAGGGGGTGGG + Intergenic