ID: 956624844

View in Genome Browser
Species Human (GRCh38)
Location 3:71256999-71257021
Sequence ATTCCCTTTGGCCAACTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 120}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956624844_956624847 17 Left 956624844 3:71256999-71257021 CCTTTAAGTTGGCCAAAGGGAAT 0: 1
1: 0
2: 0
3: 7
4: 120
Right 956624847 3:71257039-71257061 AAAGAACTCAAGCAGTATGATGG 0: 1
1: 0
2: 0
3: 22
4: 228
956624844_956624848 18 Left 956624844 3:71256999-71257021 CCTTTAAGTTGGCCAAAGGGAAT 0: 1
1: 0
2: 0
3: 7
4: 120
Right 956624848 3:71257040-71257062 AAGAACTCAAGCAGTATGATGGG 0: 1
1: 0
2: 3
3: 12
4: 273
956624844_956624849 22 Left 956624844 3:71256999-71257021 CCTTTAAGTTGGCCAAAGGGAAT 0: 1
1: 0
2: 0
3: 7
4: 120
Right 956624849 3:71257044-71257066 ACTCAAGCAGTATGATGGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956624844 Original CRISPR ATTCCCTTTGGCCAACTTAA AGG (reversed) Intronic