ID: 956628639

View in Genome Browser
Species Human (GRCh38)
Location 3:71292012-71292034
Sequence TACCCAAGACTTTTAAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 388}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956628639_956628643 23 Left 956628639 3:71292012-71292034 CCATTTTTTAAAAGTCTTGGGTA 0: 1
1: 0
2: 3
3: 43
4: 388
Right 956628643 3:71292058-71292080 AACCCACAAACTGGTTCCAACGG 0: 1
1: 0
2: 0
3: 6
4: 105
956628639_956628641 14 Left 956628639 3:71292012-71292034 CCATTTTTTAAAAGTCTTGGGTA 0: 1
1: 0
2: 3
3: 43
4: 388
Right 956628641 3:71292049-71292071 AAAATCCTTAACCCACAAACTGG 0: 1
1: 0
2: 1
3: 20
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956628639 Original CRISPR TACCCAAGACTTTTAAAAAA TGG (reversed) Intronic
900267104 1:1763172-1763194 TACCTCAGCCTTTTAAAAATTGG + Intronic
901113082 1:6815115-6815137 GAAACAATACTTTTAAAAAAAGG - Intronic
901268382 1:7930352-7930374 TCCTAAAAACTTTTAAAAAATGG + Intronic
901279367 1:8021261-8021283 TAGCTAAGTATTTTAAAAAATGG + Intronic
902101488 1:13993861-13993883 TACAAATGACTTTTTAAAAATGG + Intergenic
903981866 1:27194621-27194643 TCCCAAAAACTTTTAAAAAGAGG - Intergenic
908551159 1:65210103-65210125 TCTACAAGACTTTTAAAATATGG - Intronic
908690769 1:66777232-66777254 TAACCTAGAAATTTAAAAAAAGG - Exonic
908749842 1:67410498-67410520 TAAGCAAGACTTTTAAAAATTGG - Intronic
909373316 1:74912955-74912977 TACCCAAGACTGGGAAGAAAAGG + Intergenic
909628079 1:77741720-77741742 TTCCCAAGACTTTCAAAATGAGG + Exonic
910008250 1:82426852-82426874 TACCAAAGAGTTTTCCAAAATGG + Intergenic
910150647 1:84139481-84139503 TACCTAAGTATTTTAAAAATTGG - Intronic
911050140 1:93663996-93664018 TACCCTAGACTGTAAGAAAAAGG - Intronic
911267773 1:95763219-95763241 TACCCAAGACTGGGAAAAAAAGG + Intergenic
911562644 1:99425279-99425301 TAACCAAGACTTCTTGAAAATGG + Intergenic
914462376 1:147897260-147897282 AACCCAAGACTTTTAGTTAAGGG + Intergenic
914833596 1:151189283-151189305 TACTCAACACATTTAATAAACGG + Intronic
914959242 1:152191499-152191521 AACCCAGGACTTTTAACACAAGG - Intergenic
915738539 1:158100158-158100180 TACATAATATTTTTAAAAAAAGG - Intronic
916383042 1:164234491-164234513 TACCAAAGAATCTTAAAATATGG - Intergenic
916709493 1:167390987-167391009 AACCGAGGACTTTTAAAGAAGGG + Intronic
917917214 1:179714456-179714478 CACTCAAGACATTTAGAAAAAGG - Intergenic
918390574 1:184055689-184055711 TACCTAAGCTTTTTAAAAAAAGG - Intronic
919177257 1:194033936-194033958 TAGCCAAGACAATGAAAAAAAGG - Intergenic
919634572 1:199990914-199990936 TACCCTTGACTTTTAAAAAGTGG - Intergenic
919691594 1:200532695-200532717 TACTCAAGACTTTTAATCCATGG + Intergenic
921252281 1:213309417-213309439 TACCCAAGTATTTAAAAAAATGG + Intergenic
922371555 1:224916345-224916367 AAACCAAGACTTGGAAAAAATGG + Intronic
1063083108 10:2787143-2787165 TACACATGATTTTTAAAAATTGG - Intergenic
1063179777 10:3587684-3587706 TTCCCAAGACTTGCAAAGAAGGG - Intergenic
1063589283 10:7380129-7380151 TAGGAAAGACTTTTTAAAAAGGG + Intronic
1064236258 10:13578943-13578965 TCCTCAAGAATTTTTAAAAATGG + Intergenic
1064678652 10:17787060-17787082 TACCCAAGACTGGGAAGAAAAGG - Intronic
1065065027 10:21953438-21953460 TACCTAATAATTTGAAAAAATGG - Intronic
1065125487 10:22569537-22569559 TCCCAAATACTTTTTAAAAATGG + Intronic
1066316793 10:34255370-34255392 TACCTAGGATTTTTAAAGAAGGG - Intronic
1066505466 10:36038075-36038097 TCCCCAAGAGTTTTTAAAAAAGG + Intergenic
1067050604 10:43016388-43016410 TACCCAAGACTGAGAAAAAAAGG - Intergenic
1068386891 10:56341427-56341449 TACCCAAGTCTTTCAGAAAATGG - Intergenic
1068509020 10:57939743-57939765 TATACTAGACATTTAAAAAATGG - Intergenic
1068538336 10:58266344-58266366 AACTCAAGGCTTTTAGAAAATGG - Intronic
1069259706 10:66379749-66379771 TACATAAGTCTTTTAAAAGATGG + Intronic
1071594944 10:86914535-86914557 AACCCAATTTTTTTAAAAAATGG + Intronic
1072060514 10:91805719-91805741 TACCCAAGCATTTTAGAATAAGG - Intronic
1072869149 10:99098967-99098989 TAACCAAAGCTTTGAAAAAAAGG - Intronic
1073805610 10:107094540-107094562 CACCTATGACTTTCAAAAAATGG + Intronic
1073874110 10:107901541-107901563 TCCTGAGGACTTTTAAAAAAAGG - Intergenic
1073911099 10:108345717-108345739 TACCCAAGTTTTATCAAAAATGG + Intergenic
1074088998 10:110229095-110229117 TACTCAAAAGTTTTCAAAAATGG - Intronic
1075482223 10:122791639-122791661 TACCCTTGAGTTTTAATAAATGG - Intergenic
1075502245 10:122985847-122985869 AACCCAAGATTCTTAACAAAAGG - Intronic
1075984455 10:126771730-126771752 TACATAAGACATTTAAAAAGTGG - Intergenic
1076660702 10:132054328-132054350 TTACCAAGAATTTAAAAAAAGGG + Intergenic
1078954479 11:16175666-16175688 TAAAAAACACTTTTAAAAAATGG + Intronic
1079965343 11:26973118-26973140 TAACAAAGACTTTCAAAGAAAGG + Intergenic
1080198442 11:29639410-29639432 TACAGAAGAAATTTAAAAAATGG + Intergenic
1080669952 11:34366761-34366783 TGCTCATGAGTTTTAAAAAATGG - Intergenic
1082200744 11:49363807-49363829 TACCCTATACTTTTAATTAATGG + Intergenic
1082914174 11:58413635-58413657 TACCAAACATTTTTAAAAAGAGG - Intergenic
1084343444 11:68525630-68525652 TAGCTAAAACTTTAAAAAAACGG + Intronic
1086019509 11:82209662-82209684 TGGACAAAACTTTTAAAAAATGG + Intergenic
1086246501 11:84759687-84759709 TGCCTAACACTTTTGAAAAAAGG - Intronic
1086541116 11:87914270-87914292 TACCTAAGACTTTATCAAAATGG - Intergenic
1086611959 11:88768096-88768118 TACCCAAAACGTTGAAAACAAGG + Intronic
1086654929 11:89342420-89342442 TACCCTATACTTTTAATTAATGG - Intronic
1086758486 11:90595587-90595609 GATCCTTGACTTTTAAAAAATGG + Intergenic
1086942646 11:92814577-92814599 GACCCAACATTTATAAAAAAAGG + Intronic
1087083893 11:94197506-94197528 TACCCAAGACTGGGAAGAAAAGG - Intergenic
1087840514 11:102916246-102916268 TGCCCAATTTTTTTAAAAAATGG - Intergenic
1087999582 11:104860019-104860041 TAAGAAAGAATTTTAAAAAACGG + Intergenic
1088833625 11:113559066-113559088 TACTCAAGACTATTACAATAAGG + Intergenic
1089687303 11:120162561-120162583 AACTCAAGAATTTTAAAAAAGGG + Intronic
1089824177 11:121258452-121258474 TATTAAAGACTTTTAAGAAAAGG - Intergenic
1089991333 11:122863788-122863810 TATATAAGACTTTTAAAATAGGG + Intronic
1090131158 11:124143527-124143549 TTGCAAAGACTTTTATAAAAAGG + Intronic
1090180415 11:124693752-124693774 TACCCAATTTTTTTAAAAGAGGG + Intronic
1090331589 11:125936688-125936710 TACCCCAGACTTTTGAGAAAGGG - Intergenic
1090809852 11:130228015-130228037 TACCTAGGATTTTTATAAAATGG + Exonic
1090899965 11:131020656-131020678 TACCAAACATTTTTTAAAAATGG + Intergenic
1092555462 12:9555773-9555795 TAATCACTACTTTTAAAAAATGG + Intergenic
1093985027 12:25520992-25521014 CTCCAAAGACATTTAAAAAATGG - Intronic
1094516636 12:31134908-31134930 TAATCACTACTTTTAAAAAATGG - Intergenic
1096108380 12:49012766-49012788 TACCCAGGACTTCTAAAACATGG + Intronic
1097357671 12:58620456-58620478 TACCCAAGACTGGAAAGAAAAGG - Intronic
1097412786 12:59276052-59276074 AACCAAAAAATTTTAAAAAATGG + Intergenic
1097427213 12:59461158-59461180 TACACTAGATTTATAAAAAATGG + Intergenic
1097485503 12:60193505-60193527 TACTTATGACTTTGAAAAAAAGG - Intergenic
1097636270 12:62126126-62126148 TAATAAAGACTTTTAAAATATGG - Intronic
1098857704 12:75671312-75671334 TACCTAATACTTTTAAATATTGG + Intergenic
1100454925 12:94742497-94742519 GACCCATCCCTTTTAAAAAATGG - Intergenic
1100972491 12:100085628-100085650 TTTCCAGGACATTTAAAAAATGG - Intronic
1102805611 12:115777315-115777337 GACCCAAGAGTTTTGAATAAAGG - Intergenic
1104380679 12:128305071-128305093 TACGCAACGCTTTTAAAGAAAGG - Intronic
1106356896 13:28991780-28991802 AACCCAGGACCTTTAAACAAAGG - Intronic
1107890387 13:44909358-44909380 TGACCAAGACTTGTGAAAAATGG + Intergenic
1109287935 13:60434160-60434182 TGCTCAAAACTTTTTAAAAAGGG - Intronic
1109567220 13:64132717-64132739 TATCCAATAATTTTAACAAATGG + Intergenic
1111222500 13:85222171-85222193 TACCCATGACTTCAAAAATATGG + Intergenic
1112111878 13:96310377-96310399 AACCCAAGACTCTTAAGCAAAGG - Intronic
1112991468 13:105518710-105518732 GACCCAAGACTTTTTTAAGAGGG + Intergenic
1113226448 13:108164905-108164927 AAACCAAGACTTTTAAGAAGCGG - Intergenic
1114082037 14:19209790-19209812 TAGCCAAGACAATTAAAAAAAGG + Intergenic
1114553891 14:23550744-23550766 TACTCAACACTTTCAAAAAAAGG + Intronic
1115062578 14:29211235-29211257 TAACTCAGATTTTTAAAAAATGG + Intergenic
1115112192 14:29837494-29837516 TACTCAAGAGTTTTTACAAATGG - Intronic
1115384469 14:32779830-32779852 TATCCAAGGCTTTTATCAAAAGG + Intronic
1115751432 14:36496294-36496316 TAACAAAGACTGTCAAAAAAAGG + Intronic
1117284617 14:54275081-54275103 TGCCCAAGACTTGACAAAAATGG + Intergenic
1117484406 14:56179870-56179892 AACCCAAGATTTTAAAAAAGAGG - Intronic
1118069228 14:62227139-62227161 TACCAAAGATTATTCAAAAAAGG - Intergenic
1118585714 14:67350835-67350857 TAACCAAAACTGTTAAAAATTGG - Intronic
1119549984 14:75502224-75502246 TCCCCAAAAATTTTTAAAAATGG - Intergenic
1120454816 14:84717545-84717567 TACCCAAGACTTGGAAGAAAAGG - Intergenic
1120730583 14:87996641-87996663 TCCCCAAGACTATCATAAAACGG + Intergenic
1123688743 15:22819541-22819563 TACTGAAAACTTTTAAAAACTGG - Intronic
1125012574 15:34896354-34896376 AAAACAAAACTTTTAAAAAATGG + Intronic
1126041935 15:44599860-44599882 TATCCCAGAACTTTAAAAAAAGG - Intronic
1127641852 15:60923572-60923594 CTCCCAAGTCTTTTTAAAAAAGG + Intronic
1127644835 15:60947727-60947749 TACCCATGACTTCTGGAAAACGG - Intronic
1127925739 15:63538984-63539006 TTCCCAAGATTTTTACACAAAGG + Intronic
1127943331 15:63723772-63723794 TACTTAAGTCTATTAAAAAAAGG - Intronic
1128823410 15:70684196-70684218 TACCTAAGTCTTTTAAAAAGTGG + Intronic
1130002032 15:80056234-80056256 TACCCAAGACAAATAAAAACAGG + Intergenic
1130679904 15:85987666-85987688 TACCCAAGACTTCTCATAGAAGG - Intergenic
1130840127 15:87691490-87691512 TAGCCAAGTTTTTTAAAAATGGG + Intergenic
1131050441 15:89343964-89343986 AAACTAAAACTTTTAAAAAAAGG + Intergenic
1131776924 15:95812711-95812733 GATCCAAGACTTCTAAACAAAGG - Intergenic
1133595882 16:7291381-7291403 TAGCCTAGATTTTTAGAAAAGGG - Intronic
1133640277 16:7709969-7709991 TTGCCAATACTTTTAGAAAAAGG + Intronic
1134338875 16:13327079-13327101 AAGGCAAGACTTTTAAAAATTGG - Intergenic
1135013804 16:18906985-18907007 CAGCCAAGAATTTTTAAAAAAGG - Intronic
1135320751 16:21494557-21494579 CAGCCAAGAATTTTTAAAAAAGG - Intergenic
1135373586 16:21926047-21926069 CAGCCAAGAATTTTTAAAAAAGG - Intergenic
1135438201 16:22444655-22444677 CAGCCAAGAATTTTTAAAAAAGG + Intergenic
1136445604 16:30315985-30316007 CAGCCAAGAATTTTTAAAAAAGG - Intergenic
1139625651 16:68186640-68186662 TAAACAAAATTTTTAAAAAATGG + Intronic
1140073573 16:71675242-71675264 TACTCATCACATTTAAAAAAAGG - Intronic
1140130151 16:72153296-72153318 GACCATAGACTTTTTAAAAAGGG - Intronic
1140184881 16:72760039-72760061 TATCAAAGACTTTAAAACAACGG - Intergenic
1141869754 16:86776785-86776807 TCACCTAGACTTTTAAGAAATGG - Intergenic
1143877980 17:10007314-10007336 TAACCAAGACGTCTAAAGAATGG + Intronic
1143950003 17:10624858-10624880 TCCCCAGGACTTTTGAACAAGGG + Intergenic
1144362259 17:14506697-14506719 TACTCAAGGCTTTTAAAAAATGG + Intergenic
1144570298 17:16393393-16393415 TAGCACAGATTTTTAAAAAATGG + Intergenic
1145362453 17:22223157-22223179 TAGCACAGATTTTTAAAAAATGG + Intergenic
1146149206 17:30452779-30452801 TACCCAAGACTGGAAAGAAAAGG + Intronic
1146742233 17:35296878-35296900 TACCCAAGACTGGGAAGAAAAGG - Intergenic
1147343865 17:39773606-39773628 TACATAAAACTTTTAAAATAAGG + Intronic
1149123590 17:53200250-53200272 TTGCCAAGACTTTAAAAAAATGG + Intergenic
1150597436 17:66618671-66618693 TACTCATGAATTTTAATAAAAGG + Intronic
1151920903 17:77154819-77154841 TACACAAGACATTTACAAACTGG - Intronic
1153068977 18:1082907-1082929 CACACAACACTTTTAAAACATGG - Intergenic
1153387463 18:4514036-4514058 TTCCTTAGACTTTTAAAAAAAGG + Intergenic
1153390654 18:4554126-4554148 TGCCCAAACCTTTTAACAAATGG - Intergenic
1153992351 18:10411669-10411691 CACCCAAGAGTTGGAAAAAAAGG - Intergenic
1154300532 18:13187238-13187260 TACCTGTGACTTTTAAACAAAGG + Intergenic
1155419813 18:25643099-25643121 TGCCAAAGACTTTTAAACTATGG + Intergenic
1155522648 18:26684644-26684666 GTTCAAAGACTTTTAAAAAATGG + Intergenic
1155531684 18:26773529-26773551 TACCCGAGAATGTTAAAAATTGG - Intergenic
1155714990 18:28931027-28931049 ATCCCAAGACATTTACAAAATGG - Intergenic
1155814473 18:30287728-30287750 TATTCAAGACTATTAAAATAGGG - Intergenic
1156796846 18:41056324-41056346 TTCCCAAGGCTTTTGATAAATGG - Intergenic
1157005563 18:43579743-43579765 TAGCCAAGATTTCTAGAAAAAGG - Intergenic
1157154597 18:45253682-45253704 AACCCAAGCCATTTGAAAAATGG + Intronic
1157226675 18:45872392-45872414 AACACAAATCTTTTAAAAAATGG + Intronic
1158078904 18:53565194-53565216 TAAAGAAGACATTTAAAAAATGG - Intergenic
1159109414 18:64039513-64039535 TTCTCAAGAGTTTTAAAAACTGG + Intergenic
1159483098 18:69016291-69016313 TAAGCAAAACTTTTAGAAAAAGG + Intronic
1159513308 18:69424819-69424841 TGCACAAGAATTTTAATAAATGG - Intronic
1159620415 18:70631062-70631084 CACCAAAGACTTTTTAAGAATGG - Intronic
1168336765 19:55601442-55601464 TAATCAAGACTTTTGCAAAATGG - Intronic
1168488502 19:56786552-56786574 TAGTCCAGAATTTTAAAAAAAGG - Intronic
925496158 2:4452018-4452040 TAAGCAACACTTTTGAAAAAAGG + Intergenic
926851057 2:17197706-17197728 TATCAAAGATTTTGAAAAAAGGG + Intergenic
927362492 2:22252275-22252297 TACAAAAGACATTTAACAAAAGG + Intergenic
928126346 2:28619240-28619262 CACCTAGGACTTTTAAAATAGGG + Intronic
929063164 2:37944068-37944090 TACACAAAACGTTTAATAAATGG - Intronic
929367268 2:41175213-41175235 GACAGAAGACTTTTATAAAAGGG + Intergenic
930146075 2:48005875-48005897 TTACCACAACTTTTAAAAAATGG - Intergenic
932177027 2:69612293-69612315 TAACCACAACTTTTAAAAAAGGG + Intronic
932263462 2:70346102-70346124 TAGCCAAGACTCTTAAAACTAGG - Intergenic
932532411 2:72550203-72550225 TTACAAAGACTTTTAAAAAATGG - Intronic
932867545 2:75361406-75361428 TATCCAAGACTTTTTAGAAGTGG - Intergenic
933227017 2:79761877-79761899 TACCTAATACATTTAAAATATGG + Intronic
934093488 2:88576120-88576142 TAACAAACATTTTTAAAAAATGG + Intronic
935925045 2:108058989-108059011 TACCCCTGACTTTTACTAAAGGG + Intergenic
935987078 2:108685468-108685490 AACCTGAGACTTTTTAAAAATGG - Exonic
936109892 2:109656316-109656338 AACCCCAGAATTTTAAGAAAAGG - Intergenic
936586332 2:113761590-113761612 TAGAGAAGACTTTTAAAAAGTGG + Intergenic
936668849 2:114631967-114631989 TATCCTGGATTTTTAAAAAATGG - Intronic
936741651 2:115519067-115519089 TACCCAACACTTTAATAAATTGG - Intronic
939018294 2:136927366-136927388 TACGCAAGAATATTAAGAAATGG + Intronic
939697588 2:145345548-145345570 TCCTGAACACTTTTAAAAAATGG - Intergenic
940238281 2:151534439-151534461 TACCCAAGACAATAAAAACAGGG + Intronic
940540779 2:155013528-155013550 TGACCAACACTTTTCAAAAATGG + Intergenic
941185317 2:162315122-162315144 TAATCAAGACTTCTATAAAATGG - Intronic
941242407 2:163055606-163055628 AAACCAATAATTTTAAAAAAAGG + Intergenic
941405965 2:165089005-165089027 TAACCAAGACTTGTGAAGAATGG + Exonic
941529725 2:166652329-166652351 TAACCATGACTATTAAAAAATGG - Intergenic
941636241 2:167937654-167937676 AACCAAGGTCTTTTAAAAAAAGG - Intergenic
941790518 2:169547485-169547507 TACCCAACATTGTTAACAAAAGG + Intronic
942085052 2:172435926-172435948 GCCCCAAGAGTTTTCAAAAAAGG + Intronic
943451214 2:188044590-188044612 TACCCAAGACTAGGAAAAAGAGG + Intergenic
943802173 2:192074522-192074544 AAAACAAGTCTTTTAAAAAATGG + Intronic
943823595 2:192359804-192359826 AATCCAAGACTCTTAAGAAAAGG + Intergenic
943964366 2:194313701-194313723 TACCCATTACTTTAAAAATAAGG + Intergenic
944768545 2:202889396-202889418 GAGCCAACACTTTTAAAAAATGG + Intronic
944794324 2:203167079-203167101 TATCCAACACATTTAACAAATGG + Intronic
947023604 2:225711797-225711819 TACCCTGGACTTTTACAGAAAGG + Intergenic
948326666 2:237127350-237127372 TAACCAATACTTTTGAACAATGG - Intergenic
1168829407 20:836692-836714 TACCCAAAACAATTAAAAACAGG - Intronic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1169686159 20:8274967-8274989 GAAGCAAGATTTTTAAAAAAGGG - Intronic
1170031913 20:11953077-11953099 AACCCAAGACCTGTAAAAGAAGG + Intergenic
1170189307 20:13628843-13628865 AACCCAAGACCTTTTAAAGATGG + Intronic
1170227435 20:14007329-14007351 TAGTCAAAAATTTTAAAAAAAGG - Intronic
1170269369 20:14507003-14507025 TTCAAAACACTTTTAAAAAATGG + Intronic
1170322786 20:15119054-15119076 TTCCCAAGGATTTTAAAAATTGG - Intronic
1170644032 20:18180603-18180625 TACCCAAGACTGGGAAGAAAAGG + Intronic
1170744459 20:19086831-19086853 TTACAAAGACTTATAAAAAAAGG - Intergenic
1170818468 20:19735424-19735446 AACTCAACACATTTAAAAAAGGG + Intergenic
1171251950 20:23655680-23655702 TACACAACACTTTTGTAAAACGG + Intergenic
1172180133 20:32998039-32998061 TGGCCAAGACTTTTAAATAATGG - Intronic
1175644538 20:60659575-60659597 TACTCTTGATTTTTAAAAAAGGG - Intergenic
1176613385 21:9007466-9007488 TAGCCAAGAAAATTAAAAAAAGG + Intergenic
1176711792 21:10156326-10156348 TAGCCAAGACAATTAAAAAAAGG - Intergenic
1176935492 21:14861727-14861749 TACCCAAGACTGGTAAGAAAAGG + Intergenic
1177050055 21:16221818-16221840 TAGCAAAGACATTTAAAAATTGG + Intergenic
1178139981 21:29671683-29671705 AACCCCAGACCTTTAAACAAAGG + Intronic
1179374806 21:40841111-40841133 CAGCCAAGATTTTTAGAAAAAGG + Intronic
1180498737 22:15912880-15912902 TAGCCAAGACAATTAAAAAAAGG - Intergenic
1182648305 22:31828611-31828633 TACCCAAGTCTTTGAAAAAAAGG - Intronic
1183133324 22:35861463-35861485 AACCCACGTTTTTTAAAAAATGG + Intronic
951503465 3:23416350-23416372 TATCCAACATTCTTAAAAAAAGG - Intronic
952299838 3:32094874-32094896 TACCAAAAACTTTTTAAAATTGG + Intergenic
952486119 3:33811681-33811703 TACCCAAAACATTTAAAAGTCGG + Intronic
953637165 3:44673246-44673268 TACCCAAGACTGGGAAGAAAAGG + Intergenic
954781046 3:53060665-53060687 TATGCAAGATTTTTAAAAAGTGG - Intronic
955803538 3:62710121-62710143 TTCTCAAGACTTTTAATTAACGG - Intronic
956628639 3:71292012-71292034 TACCCAAGACTTTTAAAAAATGG - Intronic
956823427 3:72974249-72974271 AACAAAAGAATTTTAAAAAATGG + Intronic
957302740 3:78413837-78413859 TATCCAAGAATTTTAAAAAGCGG + Intergenic
957470785 3:80654745-80654767 TACCCAAGACTGGGAAGAAAAGG - Intergenic
957710676 3:83855010-83855032 TAACCAAGAGTTTTAAATAAAGG - Intergenic
958050647 3:88340168-88340190 TACCCATTTCTTTTGAAAAAAGG - Intergenic
958462027 3:94410541-94410563 TCCCCAAGATGATTAAAAAATGG + Intergenic
960582942 3:119295689-119295711 TACCCTAAACTATTTAAAAATGG - Intronic
960645376 3:119875077-119875099 TACCATAAACTTTTAAAAAAGGG + Intronic
960675813 3:120193643-120193665 CTCCCAAGTCTTTTAAAAGAAGG + Intronic
961616335 3:128184546-128184568 TACCCTATACTTTTAAAACATGG - Intronic
962567954 3:136682773-136682795 TACCCAAAAGATTTAAAAGAAGG + Intronic
964461354 3:156933375-156933397 TACCCAAGACTTTTCCAAAGTGG + Intronic
964796423 3:160502666-160502688 TACCCAAGACTTTTTCTTAAGGG + Intronic
965344252 3:167528074-167528096 GACATAACACTTTTAAAAAAAGG + Intronic
965810643 3:172588773-172588795 CAACAAAGATTTTTAAAAAAAGG - Intergenic
965826692 3:172737869-172737891 TACCCATGGCTTTTATAAATGGG + Intergenic
966354368 3:179063889-179063911 TTCCAAGGACTTTTAAAAACTGG - Intronic
966619829 3:181952024-181952046 TAGCCCAAAGTTTTAAAAAAGGG + Intergenic
967066441 3:185921360-185921382 AACCAAAGATTTTTAAAAATAGG - Intronic
969659937 4:8520941-8520963 TACCCAAGCTTTCTAGAAAATGG + Intergenic
970785830 4:19794784-19794806 TACCCAGGCCTGTTAAAATATGG + Intergenic
971156729 4:24091331-24091353 TACCCATGACTTTTTTCAAAAGG + Intergenic
972366019 4:38375214-38375236 TAGCCAGAATTTTTAAAAAATGG + Intergenic
972424510 4:38919710-38919732 TAGGCAAGGCTTTTAAAACATGG - Intronic
972857929 4:43130557-43130579 TACCCAAGACTATTGTAAAAGGG - Intergenic
972946099 4:44257648-44257670 TACAAAAGACTTGTTAAAAATGG - Intronic
973191610 4:47392022-47392044 CACTCAAGATTTTTCAAAAAGGG + Intronic
974140854 4:57884721-57884743 TACCCAAGAACTTAAAATAAAGG + Intergenic
974602254 4:64098951-64098973 TAAATAAGAATTTTAAAAAATGG + Intergenic
974796653 4:66761209-66761231 TTGCCAAGACATTTTAAAAAAGG + Intergenic
975563888 4:75733653-75733675 AACCAAAAACTCTTAAAAAATGG - Intronic
976003778 4:80402572-80402594 TACCCAAGACTGGGAAGAAAAGG - Intronic
976177827 4:82373061-82373083 TGCCCAAGACTGTAGAAAAAGGG + Intronic
976233104 4:82866608-82866630 TTACCATGATTTTTAAAAAAGGG + Intronic
977349795 4:95867947-95867969 TTCCCAGGATTTTTAAAAAGAGG - Intergenic
977533265 4:98225341-98225363 AAGCTAAAACTTTTAAAAAAAGG + Intergenic
977843308 4:101736645-101736667 CAACCCAGATTTTTAAAAAATGG + Intronic
978025590 4:103868943-103868965 AAAGCAAGATTTTTAAAAAAAGG - Intergenic
979063875 4:116101759-116101781 TTGCCATGACTTTTTAAAAATGG - Intergenic
979083148 4:116368929-116368951 TGCCCTAGATTCTTAAAAAAAGG + Intergenic
979514625 4:121593362-121593384 TGCCAAAGAGTTTTAAAAAGTGG - Intergenic
979538968 4:121857495-121857517 TACACAAAACTGTTAAAAAGAGG + Intronic
980275183 4:130641842-130641864 CACCAAACACTTTTTAAAAATGG + Intergenic
981090364 4:140725965-140725987 TACTCAAAACTTTAAAAAATTGG + Intronic
981124705 4:141092445-141092467 TACCAAAGGATTTTTAAAAAAGG - Intronic
981189888 4:141850455-141850477 AACCCAAATCTTATAAAAAAAGG + Intergenic
981564130 4:146080390-146080412 TACCAACAACTTTTAAAAATTGG - Intergenic
983167943 4:164499935-164499957 TCACCAAGACATTTTAAAAATGG - Intergenic
983425416 4:167577943-167577965 AACCCAAGGATTTCAAAAAAAGG + Intergenic
983523251 4:168733441-168733463 TCTCAAACACTTTTAAAAAATGG - Intronic
983549992 4:169008352-169008374 TACTTACCACTTTTAAAAAATGG + Intronic
983711290 4:170720064-170720086 TTCCTAAGACTATTAAAACATGG - Intergenic
984355683 4:178654573-178654595 TACCCAAGACTGGGAAGAAAAGG - Intergenic
984894588 4:184526675-184526697 TTCTGAAGACTTTTAAGAAAAGG - Intergenic
985179858 4:187247135-187247157 TAACTATGACTTTTAAAAAGTGG - Intergenic
986069692 5:4269862-4269884 TACCCAAGACTGGGAAGAAAAGG + Intergenic
986210109 5:5664147-5664169 GTCCCTAGATTTTTAAAAAATGG - Intergenic
986522733 5:8638760-8638782 GACTCAAGACATTTAAAAATAGG - Intergenic
986672370 5:10153789-10153811 TCCCCAAGAGTTTTAAAAATAGG - Intergenic
987950276 5:24665566-24665588 TTCCTAAGATTTTTAACAAAGGG + Intergenic
987984176 5:25124470-25124492 TACCCAAGACTGGGAAGAAAAGG - Intergenic
988427504 5:31080479-31080501 TACCCAAGACTGGGAAGAAAAGG + Intergenic
989480907 5:41929051-41929073 TACCCAAGACATTTGAAATTTGG + Intronic
989529390 5:42489798-42489820 TAAATAAGACTTTTTAAAAAAGG + Intronic
991543037 5:67750970-67750992 TACCAAATACTTTTCCAAAAAGG - Intergenic
992234664 5:74697334-74697356 TAGCCAAGACTGTTAAGAGAAGG + Intronic
993325686 5:86532894-86532916 TACCCATGACTTGCAAAAGAGGG - Intergenic
993344566 5:86766449-86766471 TCACCAAGACTTTAAAAAAGTGG - Intergenic
993377501 5:87166252-87166274 TTTCAAAGTCTTTTAAAAAATGG + Intergenic
994043221 5:95281882-95281904 GACCAAAGACATCTAAAAAATGG + Intronic
994869434 5:105327586-105327608 CACTCAATACTTTTTAAAAATGG + Intergenic
994932731 5:106209581-106209603 ATCTCAAGACTTTTAAAAATTGG - Intergenic
996696837 5:126406682-126406704 TACCCAAGGCTTTAAAGAATTGG + Intronic
996791071 5:127293682-127293704 TGCCAAAGATTTTTAAACAAGGG - Intronic
998461199 5:142311374-142311396 TAACCAGCACTTTTCAAAAAAGG + Exonic
998723151 5:144976553-144976575 TACCCAAGACTGGGAAGAAAAGG - Intergenic
999653475 5:153790374-153790396 TCCCCAAGGTTTTTAATAAAAGG - Intronic
999661470 5:153867775-153867797 TCCACAAGCCTTTTTAAAAATGG - Intergenic
999896865 5:156043756-156043778 TATCCAACACTCTTTAAAAAAGG + Intronic
1000205374 5:159052943-159052965 TGCCCCAGACTTTTTAAAGATGG - Intronic
1000439379 5:161248673-161248695 TACCCAAATCTTATAAAAATGGG + Intergenic
1000748113 5:165061046-165061068 TAAACAAGAAATTTAAAAAATGG - Intergenic
1000799704 5:165710405-165710427 TACACTTGACTTTTTAAAAAAGG - Intergenic
1002986561 6:2194794-2194816 TAACCAAGAGTTTTAAACAATGG - Intronic
1003389953 6:5705243-5705265 TACCTGGGACTATTAAAAAACGG - Intronic
1003821949 6:9907835-9907857 TACCCTAGTCTTTTATTAAAAGG + Intronic
1004870433 6:19898705-19898727 TATCCATAATTTTTAAAAAAAGG - Intergenic
1005000773 6:21239068-21239090 ACCCCAAAACTGTTAAAAAATGG - Intergenic
1005211723 6:23473367-23473389 AAACCAAGATTTTTAAAAAGAGG + Intergenic
1006625437 6:35394416-35394438 TAAGCAAGTTTTTTAAAAAAAGG - Intronic
1006907551 6:37543217-37543239 TACCAAATTCATTTAAAAAATGG - Intergenic
1007087730 6:39161358-39161380 TAGCCAACATTTTTTAAAAAAGG + Intergenic
1007865826 6:44969034-44969056 TACGCAAGACCTTGAAGAAAGGG - Intronic
1008152311 6:47969154-47969176 TAGACAAAATTTTTAAAAAATGG + Intronic
1008767857 6:54941261-54941283 TCCCCAAGTTTTTTGAAAAAGGG + Exonic
1009432098 6:63575232-63575254 TACCAAAGTGTTTTAACAAAAGG - Intronic
1011335510 6:86255285-86255307 TGCCCAAGAGTTTAACAAAAAGG + Intergenic
1012282686 6:97347569-97347591 AACCCAAAACTTTTAAAACCCGG + Intergenic
1013879565 6:114879537-114879559 TAAGCAAGACTTTTTAATAAGGG - Intergenic
1014021950 6:116601277-116601299 TGCCCAAGACATTGAAAAATAGG + Intergenic
1014722034 6:124928573-124928595 TACCAAAAACTTTTGGAAAAAGG + Intergenic
1015384057 6:132601807-132601829 TCCCACACACTTTTAAAAAATGG - Intergenic
1016759139 6:147718059-147718081 AAGCCAATACTTTTCAAAAAGGG - Intronic
1017110798 6:150930450-150930472 TAGAAAAGACTTTTAGAAAAAGG - Intronic
1018105813 6:160485135-160485157 TACCAAAGACATGAAAAAAATGG - Intergenic
1018552682 6:165016391-165016413 TGCACAAAACTTTTAAAAAATGG + Intergenic
1018645083 6:165940752-165940774 TATTCAAGACCTTTTAAAAATGG - Intronic
1018747933 6:166776899-166776921 TACCCAAGATTGTTGAAAACAGG - Intronic
1020968364 7:14901794-14901816 TAACCAACTCTTTTAAAAACAGG - Intronic
1021942958 7:25697386-25697408 TACTCAAGAATTTTAAAATGTGG - Intergenic
1023887653 7:44372092-44372114 TAAATAAGACTTTTTAAAAATGG - Intergenic
1024469802 7:49755978-49756000 TGGCCAAAACTTTTAAAAATTGG + Intergenic
1024726436 7:52201655-52201677 CAGCCAATACTTTTAATAAATGG + Intergenic
1024777208 7:52801470-52801492 TACCATAGACTTTAAAAACAGGG + Intergenic
1026512071 7:71035732-71035754 TATCCAAGTCTTATAAAATATGG - Intergenic
1027305685 7:76893938-76893960 TACCCAAGCCTATTTAATAATGG - Intergenic
1027687647 7:81296810-81296832 TACCCAAGACTGGGAAGAAAAGG - Intergenic
1028101463 7:86826004-86826026 TATCCATGACTTTTTTAAAAAGG - Intronic
1028617125 7:92780897-92780919 TAGCAAAAATTTTTAAAAAAAGG - Intronic
1029575260 7:101399300-101399322 TGTCCAAAAATTTTAAAAAAAGG + Intronic
1029847960 7:103432660-103432682 TCCCCAAGAATTTAAAACAATGG - Intronic
1029900451 7:104033922-104033944 TATCCAGGACTTTTACAAACTGG - Intergenic
1030303859 7:108001203-108001225 AACCCAAGGGTTTTAAAAAGAGG + Intronic
1030504302 7:110400026-110400048 TACTCAAGACTTTAACAAGAGGG - Intergenic
1031350934 7:120730205-120730227 CACACACGGCTTTTAAAAAAGGG - Intronic
1032244259 7:130194694-130194716 TATACAAGAATTTTAAAAATTGG + Intronic
1032787182 7:135210395-135210417 TACCTCACATTTTTAAAAAAGGG + Intronic
1032791975 7:135248993-135249015 TACCCAAGGCTTGTATGAAAGGG + Intronic
1033633083 7:143180786-143180808 TTGCCATTACTTTTAAAAAAAGG - Intergenic
1033785936 7:144730369-144730391 TACCATATATTTTTAAAAAATGG - Intronic
1034239761 7:149601392-149601414 TGCACAAGACAATTAAAAAATGG - Intergenic
1034320077 7:150172242-150172264 TACCCAAGACTAGGAAGAAAAGG + Intergenic
1034772671 7:153794980-153795002 TACCCAAGACTAGGAAGAAAAGG - Intergenic
1035107552 7:156454788-156454810 TACCCAATTCTTTAATAAAATGG + Intergenic
1035876788 8:3198451-3198473 TACCCAGTAGTTTTTAAAAATGG - Intronic
1036160901 8:6387740-6387762 TGCAGAAGACTTTTGAAAAACGG - Intergenic
1036529715 8:9572870-9572892 TACCTATGAGTTTAAAAAAAAGG - Intronic
1037121737 8:15296467-15296489 TACCCAAGACTCTTAATTATTGG + Intergenic
1037250490 8:16887547-16887569 TATCAAAGACTTTTAAACGAGGG + Intergenic
1037449191 8:18999744-18999766 CACCCAAGTTTTTTAAAAAATGG + Intronic
1038043350 8:23745661-23745683 TCCCAAAGACTTTTAAACAAGGG + Intergenic
1039156622 8:34566193-34566215 AACCCAAGAGTTATACAAAAGGG + Intergenic
1039769680 8:40672212-40672234 TATCCATGACTTTAATAAAATGG - Intronic
1040396188 8:47002597-47002619 TACCCAAGTGTTTTAAAATCAGG - Intergenic
1040961588 8:53039465-53039487 GAACCAAAAATTTTAAAAAATGG - Intergenic
1041756972 8:61324450-61324472 TACCCAAGACTGGGAAGAAAAGG - Intronic
1041993740 8:64027662-64027684 TACCCAATACTGTTAAAAGTTGG - Intergenic
1042439209 8:68805641-68805663 TACCCCAGCTTTTTAAAAATTGG + Intronic
1043285989 8:78532193-78532215 TACCTAATAATTTTAAGAAAAGG - Intronic
1044624825 8:94226840-94226862 TACCTGAGACGTTTTAAAAATGG - Intergenic
1044768410 8:95602702-95602724 AACCCACCACATTTAAAAAAGGG + Intergenic
1046653599 8:116869009-116869031 TAGACAAAACTTTTAAAAAATGG + Intronic
1047419955 8:124699383-124699405 TCCCACAGAGTTTTAAAAAATGG + Intronic
1049937362 9:512264-512286 CACACAAGATTTTTAAAACAAGG + Intronic
1050237680 9:3598744-3598766 TTCCCAAGACTTTATACAAATGG + Intergenic
1050925869 9:11262006-11262028 TACCCAAGAACTTTAAAAAATGG + Intergenic
1051289230 9:15528497-15528519 TACCTAGGAATTTTATAAAATGG - Intergenic
1051388103 9:16532303-16532325 TACCAGAGTCTTTTAATAAAAGG - Intronic
1053093454 9:35301994-35302016 TGACCAAGACTTCTAAAAAATGG - Intronic
1053648785 9:40142013-40142035 TAGCCAAGACAATTAAAAAAAGG - Intergenic
1053756959 9:41321829-41321851 TAGCCAAGACAATTAAAAAAAGG + Intergenic
1054329766 9:63739954-63739976 TAGCCAAGACAATTAAAAAAAGG - Intergenic
1054352876 9:64033621-64033643 AACCAAAGACTTTAATAAAATGG + Intergenic
1054535797 9:66234157-66234179 TAGCCAAGACAATTAAAAAAAGG + Intergenic
1055753800 9:79535403-79535425 GACTCAAGGCTATTAAAAAAAGG + Intergenic
1056151497 9:83794702-83794724 GAGTCATGACTTTTAAAAAAAGG + Intronic
1058174974 9:101724835-101724857 TACCCAAGACTGGGAAGAAAAGG - Intronic
1058181889 9:101808797-101808819 TACCCAAGACTGGGAAGAAAAGG - Intergenic
1058339894 9:103881776-103881798 TACTTAAGTATTTTAAAAAATGG - Intergenic
1058859686 9:109103782-109103804 TACCAAAAAGTTTAAAAAAATGG + Intronic
1061447431 9:130648407-130648429 TTCAGAAGATTTTTAAAAAAAGG - Intergenic
1202796547 9_KI270719v1_random:125315-125337 TAGCCAAGAAAATTAAAAAAAGG - Intergenic
1185893526 X:3839913-3839935 TACCCAAGACTGGGAAGAAAAGG - Intronic
1185893848 X:3842093-3842115 TACCCTAGACTTAGAAGAAAAGG - Intronic
1185898642 X:3878337-3878359 TACCCAAGACTGGGAAGAAAAGG - Intergenic
1185898963 X:3880517-3880539 TACCCTAGACTTAGAAGAAAAGG - Intergenic
1185903758 X:3916766-3916788 TACCCAAGACTGGGAAGAAAAGG - Intergenic
1185904080 X:3918946-3918968 TACCCTAGACTTAGAAGAAAAGG - Intergenic
1185957198 X:4503966-4503988 CACCCAACCCATTTAAAAAATGG + Intergenic
1188569138 X:31561136-31561158 TATACAAAACTTTTGAAAAAAGG + Intronic
1189677335 X:43474977-43474999 AACCAGAGATTTTTAAAAAATGG + Intergenic
1189860567 X:45266804-45266826 TAAGCAAAACTTTTAAAAGAAGG - Intergenic
1190469876 X:50768220-50768242 TATCCAAGTCTTTCACAAAAAGG - Intronic
1191031488 X:55978395-55978417 TACACAAAATTTTTAAAAGAAGG - Intergenic
1192711201 X:73591268-73591290 TACCCATGTCATTAAAAAAAGGG - Intronic
1192944186 X:75947870-75947892 GACTCAAAATTTTTAAAAAATGG - Intergenic
1194616815 X:96114570-96114592 TAGCCAAGAGGTATAAAAAAAGG + Intergenic
1194826259 X:98566444-98566466 GATCAAAGACTTTTAAAAATGGG - Intergenic
1195373556 X:104203212-104203234 TCCTAAAGTCTTTTAAAAAATGG - Intergenic
1195450994 X:105012847-105012869 TACCCACATCTTTTATAAAAAGG + Intronic
1196103320 X:111870200-111870222 TCCCCAAGAGTTTTGTAAAAGGG - Intronic
1196491415 X:116271779-116271801 TCACCAAGAATTTTTAAAAAGGG - Intergenic
1197060189 X:122169768-122169790 TATCCAGGATTTTTAAAAAAGGG + Intergenic
1201469635 Y:14318934-14318956 TACCCAAGACTGGAAAGAAAAGG - Intergenic