ID: 956629645

View in Genome Browser
Species Human (GRCh38)
Location 3:71303466-71303488
Sequence CTGTACTCATTTGCAAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 225}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956629641_956629645 -1 Left 956629641 3:71303444-71303466 CCAAATCCTCCAATCAAATGGCC 0: 1
1: 0
2: 0
3: 10
4: 126
Right 956629645 3:71303466-71303488 CTGTACTCATTTGCAAAAACTGG 0: 1
1: 0
2: 0
3: 15
4: 225
956629635_956629645 8 Left 956629635 3:71303435-71303457 CCCATACCCCCAAATCCTCCAAT 0: 1
1: 0
2: 0
3: 18
4: 220
Right 956629645 3:71303466-71303488 CTGTACTCATTTGCAAAAACTGG 0: 1
1: 0
2: 0
3: 15
4: 225
956629640_956629645 0 Left 956629640 3:71303443-71303465 CCCAAATCCTCCAATCAAATGGC 0: 1
1: 0
2: 0
3: 21
4: 208
Right 956629645 3:71303466-71303488 CTGTACTCATTTGCAAAAACTGG 0: 1
1: 0
2: 0
3: 15
4: 225
956629638_956629645 1 Left 956629638 3:71303442-71303464 CCCCAAATCCTCCAATCAAATGG 0: 1
1: 0
2: 0
3: 13
4: 190
Right 956629645 3:71303466-71303488 CTGTACTCATTTGCAAAAACTGG 0: 1
1: 0
2: 0
3: 15
4: 225
956629643_956629645 -10 Left 956629643 3:71303453-71303475 CCAATCAAATGGCCTGTACTCAT 0: 1
1: 0
2: 2
3: 5
4: 119
Right 956629645 3:71303466-71303488 CTGTACTCATTTGCAAAAACTGG 0: 1
1: 0
2: 0
3: 15
4: 225
956629642_956629645 -7 Left 956629642 3:71303450-71303472 CCTCCAATCAAATGGCCTGTACT 0: 1
1: 0
2: 0
3: 4
4: 93
Right 956629645 3:71303466-71303488 CTGTACTCATTTGCAAAAACTGG 0: 1
1: 0
2: 0
3: 15
4: 225
956629637_956629645 2 Left 956629637 3:71303441-71303463 CCCCCAAATCCTCCAATCAAATG 0: 1
1: 0
2: 0
3: 20
4: 257
Right 956629645 3:71303466-71303488 CTGTACTCATTTGCAAAAACTGG 0: 1
1: 0
2: 0
3: 15
4: 225
956629636_956629645 7 Left 956629636 3:71303436-71303458 CCATACCCCCAAATCCTCCAATC 0: 1
1: 0
2: 0
3: 16
4: 295
Right 956629645 3:71303466-71303488 CTGTACTCATTTGCAAAAACTGG 0: 1
1: 0
2: 0
3: 15
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956629645 Original CRISPR CTGTACTCATTTGCAAAAAC TGG Intronic
900845760 1:5099056-5099078 CTGAACTGTTTTGCACAAACAGG - Intergenic
901101829 1:6725107-6725129 GTTTAGTCATTGGCAAAAACAGG + Intergenic
902742480 1:18448559-18448581 CTGTTTTCATTTCCAAAGACAGG - Intergenic
906681254 1:47727067-47727089 CTGACCTCATGTGCAAAACCAGG - Intergenic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
907336794 1:53704953-53704975 CTTTACTCATCTGCAAAATGGGG - Intronic
907634427 1:56119088-56119110 CTGTACTCAATTCCTAAAGCTGG + Intergenic
908180982 1:61605614-61605636 CTCTACTCAGTTCCAAAAAGAGG - Intergenic
908364741 1:63409109-63409131 CTTTTCTCATTTGCAAAATGTGG + Intronic
908619722 1:65963945-65963967 CTTTATACATTTGCAGAAACTGG + Intronic
910135464 1:83963280-83963302 CAGTACTCATTTTCAGAATCTGG + Intronic
911997516 1:104786077-104786099 CATTTCTCATTGGCAAAAACGGG - Intergenic
912225553 1:107729636-107729658 ATTTTCTCATTTGCTAAAACAGG + Intronic
912712019 1:111956791-111956813 CTGTCCTCATTTGCAGAGAGAGG - Intronic
916465418 1:165069581-165069603 ATTTACTCATTTGCAAAATGAGG + Intergenic
916788179 1:168101634-168101656 CTTTGCTCATCTGCAAAATCGGG + Intronic
918373729 1:183887509-183887531 GTGTACTCACTTGTAAACACTGG + Intronic
919405034 1:197168901-197168923 TTGTACTCATTTTTAAAAATTGG - Intronic
921146699 1:212365108-212365130 CTGTACTCACTTGAAGAAATGGG - Exonic
921276399 1:213524962-213524984 CTTTTCTCATTTGCAAAATGTGG + Intergenic
923322926 1:232854182-232854204 CAGTACTCATTTCCAAAAGCTGG - Intergenic
924442581 1:244098761-244098783 CTGTGCTCAGTTGAGAAAACGGG + Intergenic
1064574748 10:16733130-16733152 CTATATTCATTTCTAAAAACTGG + Intronic
1065986848 10:30962862-30962884 CTTTACTGTTTTGGAAAAACTGG + Intronic
1068081526 10:52323914-52323936 CTGTACCCATTTCTGAAAACAGG - Intergenic
1071133093 10:82418443-82418465 CTCTTTTCATTTGCATAAACTGG - Intronic
1071809498 10:89163911-89163933 ATGTACTCTGTTGCATAAACAGG - Intergenic
1072628181 10:97127837-97127859 CTGTCCTCATCTGCAAAGACAGG + Intronic
1072655357 10:97326289-97326311 ATGAACTCATTTGCAAAATGTGG + Intergenic
1074611667 10:115027724-115027746 CTGTGCTGATTTGCAAATAGTGG + Intergenic
1076514782 10:131037867-131037889 TGGTTCTCATTTGCCAAAACTGG - Intergenic
1077639681 11:3870409-3870431 TTGTCCACATTTGCAAAAAAGGG + Intronic
1080271641 11:30456726-30456748 CTGTACCCATGAGAAAAAACTGG - Intronic
1082087392 11:48061341-48061363 CTGCAATCATTTGCCAACACAGG - Intronic
1082216766 11:49580236-49580258 ATGCACTCATTTGGAAAACCTGG - Intergenic
1086632785 11:89043839-89043861 ATGCACTCATTTGGAAAACCTGG + Intronic
1087711442 11:101557639-101557661 CTGTATTCATTTGTTATAACAGG - Intronic
1088376431 11:109146474-109146496 ATCTTCTCATTTGGAAAAACTGG - Intergenic
1088904329 11:114142871-114142893 CCTTTCTCATTTACAAAAACGGG + Intronic
1089997683 11:122924380-122924402 GTTTTCTCATTTGCAAAAAGGGG + Intronic
1090920167 11:131199832-131199854 CTCTACTCTTTTGGAGAAACAGG + Intergenic
1091297832 11:134486328-134486350 CTGTACTCATTGTCAGGAACTGG - Intergenic
1092609762 12:10159739-10159761 CAGAACTCCTTTGCAGAAACTGG - Exonic
1093267343 12:17018935-17018957 CAGAACTCGTTTACAAAAACAGG - Intergenic
1093552687 12:20434226-20434248 CAGTAGTCATGAGCAAAAACAGG - Intronic
1094547316 12:31416846-31416868 ATATAATTATTTGCAAAAACGGG - Intronic
1095326573 12:40901741-40901763 TTGTAATCATTTGCAGAAAAGGG + Intronic
1095332217 12:40980259-40980281 GTGTACTCTTTTGCAGAGACTGG - Intronic
1095978140 12:47953908-47953930 CTGGACTCATATGCAGGAACGGG - Intergenic
1095988664 12:48018133-48018155 CTCTACTTATTTGGAAAAACAGG - Intergenic
1096500118 12:52059629-52059651 GTGTACTCATTTGTAAAAGGCGG + Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098842318 12:75491279-75491301 CTGTTCTCATTTGCCAAACAGGG - Exonic
1099130392 12:78821999-78822021 CTTAACTCATTGGCCAAAACTGG - Intergenic
1101231859 12:102749423-102749445 CTGTTTCCTTTTGCAAAAACGGG + Intergenic
1101928701 12:108994601-108994623 GTGTCCTCATTTGCAAAATAGGG - Intronic
1104128642 12:125871876-125871898 CTGTCCTCATCTGCAAAATGGGG - Intergenic
1105554105 13:21429170-21429192 ATGTATCCATTTGCAAGAACTGG - Intronic
1108714163 13:53062362-53062384 CTGTACTCCTTTGTAAAGAAAGG + Intergenic
1110005747 13:70265809-70265831 CTTTACTGATTTGCAATAACTGG - Intergenic
1110880080 13:80560783-80560805 ATGTTCCAATTTGCAAAAACTGG - Intergenic
1111473435 13:88717151-88717173 ATGTACTCATTGGTAAAAAGGGG - Intergenic
1112613321 13:100977300-100977322 ATGTGCTCATTTTTAAAAACAGG - Intergenic
1115033496 14:28829120-28829142 TTGTAATCATTTGCATAATCAGG + Intergenic
1115733788 14:36301384-36301406 CTTTACTCATTGGCCAGAACTGG - Intronic
1116329647 14:43579147-43579169 CTGGACTCTTTGGGAAAAACAGG + Intergenic
1117169492 14:53078446-53078468 CTTTACCCATTTAAAAAAACTGG + Intronic
1117481798 14:56153254-56153276 CTATAGCCATTTGGAAAAACGGG + Intronic
1119953466 14:78770164-78770186 GTTTACTCATCTGCAAAAATAGG - Intronic
1121319809 14:92985610-92985632 AGGTACACATTTGCAAACACGGG + Intronic
1122363518 14:101181327-101181349 TTTTTCTCATTTGCAAAATCAGG - Intergenic
1122547841 14:102534443-102534465 ATTTACTTATTTACAAAAACCGG + Intergenic
1122618997 14:103042617-103042639 CTTTACTCATTTAAAAAATCGGG - Intronic
1124199529 15:27666528-27666550 GTGTACACATATGCAAAATCTGG - Intergenic
1127618877 15:60713972-60713994 CTGTTCTCACTTGGCAAAACCGG + Intronic
1131798921 15:96049494-96049516 CTGTACCCTTTTGCATAAGCTGG - Intergenic
1132777920 16:1606185-1606207 CTCTAATCATTTCCACAAACTGG - Intronic
1133528428 16:6629487-6629509 CTGTCTTCATTTACAAAAAATGG + Intronic
1138025838 16:53521908-53521930 CTGTATTTTTTTGCAGAAACGGG + Intergenic
1138100491 16:54248374-54248396 CATTAAACATTTGCAAAAACAGG + Intronic
1139511178 16:67429506-67429528 ATGTACTCACTTGCACACACAGG + Intergenic
1140780625 16:78293349-78293371 CTGGACTCAGTTACAAAATCTGG - Intronic
1143442998 17:6990202-6990224 CTGTAATTATTTTAAAAAACAGG + Intronic
1143792624 17:9309768-9309790 CTGTACTGTTTTGCTAAAATAGG + Intronic
1143985674 17:10911706-10911728 CTGTCCTTAATTGGAAAAACAGG - Intergenic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1147262391 17:39216117-39216139 CTGTCTTCATCTGCAAAATCAGG - Intronic
1149347929 17:55756988-55757010 GTTTCCTCATTTGCAAAACCTGG + Intronic
1149347944 17:55757421-55757443 GTTTCCTCATTTGCAAAACCAGG - Intronic
1155438861 18:25840915-25840937 CTGCACTCATTTGAAAGAAAAGG + Intergenic
1157659227 18:49424439-49424461 TTGTACTGACTGGCAAAAACTGG + Intronic
1158149987 18:54357534-54357556 CTGAACTCACTTGGAAAAACTGG + Intronic
1158534011 18:58291306-58291328 CTTTTCTCATTAGCCAAAACTGG + Intronic
1165289913 19:34874688-34874710 CTGTCCTCATTTGTAAAATGAGG + Intergenic
1165784114 19:38451148-38451170 AGGCACTCGTTTGCAAAAACAGG + Intronic
1167201737 19:48070093-48070115 CTGTTCTCATCTGTAAAACCAGG + Intronic
926682350 2:15673623-15673645 ATGTCCTCATTTGCAAAATGGGG + Intergenic
927830224 2:26343750-26343772 CAGTACTCTTTTTCAAAAAGAGG - Intronic
928131224 2:28651973-28651995 TTGAACTCATTTGCAAAAAATGG - Intergenic
928687559 2:33764541-33764563 CTTTCCTCATTTGTAAAAAGGGG - Intergenic
931326328 2:61228837-61228859 CTTTACGAATTTGCAAAAATGGG - Exonic
935319414 2:101871478-101871500 CTGTACTCTGTAGAAAAAACAGG - Intronic
935966902 2:108487590-108487612 TTTTTCTCATTTTCAAAAACAGG + Intronic
936047202 2:109197039-109197061 GTGTACTCATCTGCAGAAAAGGG - Intronic
937092300 2:119214525-119214547 ATGTCCTCATTTGATAAAACAGG - Intergenic
937635605 2:124152369-124152391 GTTTTCTCATTTGCAAAATCCGG - Intronic
939937122 2:148306233-148306255 CTGTATTCAATTGTAAGAACGGG + Intronic
941976188 2:171407662-171407684 CTGGACACATCTGCTAAAACAGG + Intronic
942880396 2:180854345-180854367 CTGTAGTCTTCTGCAAAAAAAGG - Intergenic
942967595 2:181915810-181915832 AGGTACTTATTTGCAAAAGCTGG + Exonic
944110455 2:196125908-196125930 CTGGACACAATTGGAAAAACTGG - Intergenic
947291325 2:228578012-228578034 CTGTAATCATTTGGAAAGAAAGG - Intergenic
948262823 2:236616648-236616670 CTGTAATCATTTGCTGAAATTGG - Intergenic
1169013510 20:2272049-2272071 CTGCACGCATTTGTCAAAACTGG - Intergenic
1173660928 20:44733226-44733248 GTGTGCTCATTTGTGAAAACTGG - Intergenic
1173756166 20:45518398-45518420 CTGTACTCGTTTGGCCAAACAGG + Intergenic
1174773164 20:53320244-53320266 GTTTCCTCATTTGAAAAAACAGG - Intronic
1174932560 20:54831645-54831667 GTGTACTCATTTGCACACAAGGG + Intergenic
1175043436 20:56078288-56078310 CTTTCCTCATTTGCAAAATGTGG + Intergenic
1181764532 22:25081713-25081735 GTGTCCTCATTTGCAAAATTTGG - Intronic
949380725 3:3442757-3442779 CTGAACTTATTTGAAAAAAATGG - Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
951149893 3:19276232-19276254 CTGGACTAATTTCTAAAAACTGG + Intronic
951659576 3:25047677-25047699 GTTTACTTATTTGCAAAAACAGG - Intergenic
952713071 3:36451387-36451409 CTGGATTAATCTGCAAAAACAGG - Intronic
952905039 3:38134249-38134271 CTGTGCTGATTTGGAAAAGCTGG - Intronic
955063627 3:55515869-55515891 CAGTAGTGATTTGCAGAAACAGG + Intronic
955150148 3:56359092-56359114 GTGTACACATGTGCAAAATCTGG + Intronic
955260634 3:57386244-57386266 CTGTACTCATTTGTAAAATGAGG + Intronic
955972125 3:64445892-64445914 CTGTACGAATTTGTCAAAACTGG - Intergenic
956457100 3:69433081-69433103 CTACACTCAGTTGCAAAATCAGG + Intronic
956629645 3:71303466-71303488 CTGTACTCATTTGCAAAAACTGG + Intronic
957656445 3:83083731-83083753 CTATTCTCACTAGCAAAAACTGG - Intergenic
957695455 3:83633232-83633254 TTTTACTCATTTGCAAAAGAAGG - Intergenic
958760900 3:98306616-98306638 CTGTGCACTTTTGCCAAAACAGG - Intergenic
959664628 3:108906720-108906742 GTTTACTCATTTGCAAAAGGTGG - Intergenic
960888756 3:122423346-122423368 ATGTGCTCATTTGCAGACACAGG - Exonic
963677863 3:148335708-148335730 CTGTTCACAATGGCAAAAACTGG - Intergenic
965498233 3:169424862-169424884 CTGTAATAATCTGCAGAAACTGG - Intronic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
965856196 3:173090550-173090572 ATTTCCTCATTTGCAAAAAAAGG - Intronic
969146608 4:5129803-5129825 CTGTACACATTTGCAATGAGAGG - Intronic
969596409 4:8151686-8151708 GTGTACCCATCTGTAAAAACAGG - Intronic
971540700 4:27813264-27813286 CAGAACTCAATTGGAAAAACTGG + Intergenic
971804022 4:31331630-31331652 TTGTACTCATTGGCAAAGACTGG - Intergenic
972122437 4:35721449-35721471 ATTTCCTCATTTGCAAAAAGTGG + Intergenic
973014096 4:45114936-45114958 CTGTACCCACATGTAAAAACAGG + Intergenic
973235155 4:47893973-47893995 CTATTCTCATTTGAAAAAATTGG + Intronic
974498893 4:62671682-62671704 TTGAACTCATTTGCAAAAGCTGG - Intergenic
974817266 4:67021423-67021445 CAGTACTCATTTCTGAAAACTGG + Intergenic
977044953 4:92057929-92057951 ATCTAATCATTTGCAATAACTGG + Intergenic
977427477 4:96886600-96886622 CTGTCCTCATTTGCCAAACTGGG + Intergenic
977704244 4:100053424-100053446 TTGTTCTCATATGCAAATACTGG - Intergenic
978425784 4:108580769-108580791 CAGTACGCATTTGAAAACACTGG - Intergenic
979389672 4:120113453-120113475 CTGTACTTATTTGAAAATAGAGG - Intergenic
980269752 4:130568726-130568748 CAGTACACAATTGGAAAAACTGG - Intergenic
982301844 4:153887050-153887072 GGGTACTCTTTTGCAAAAAAGGG + Intergenic
982651309 4:158090534-158090556 CAGTACTTATTTGCACAAATTGG - Intergenic
984575305 4:181440975-181440997 CTGTACTCATTTGGCACAATAGG + Intergenic
985821825 5:2165784-2165806 CTGCACACATATGCAAACACTGG + Intergenic
987564776 5:19569935-19569957 CTGTAATTATTTAAAAAAACAGG - Intronic
989030167 5:37110704-37110726 CTTTCCTCATTTGCAAAATGGGG - Intronic
994560331 5:101362031-101362053 ATGTAGTCTTTTGCAAAATCAGG + Intergenic
995232405 5:109783316-109783338 CTCTGCTCATTTGCAAAATGTGG + Intronic
995379783 5:111518893-111518915 ATGTACTCATTTGCCAAACCTGG - Intergenic
996947836 5:129092072-129092094 TTGTACTCAGTTACTAAAACGGG + Intergenic
997701579 5:135904721-135904743 CAGAACTCATTTGTAAAATCTGG + Intergenic
1000928387 5:167221423-167221445 CAATACTCATGTGCAAAAGCAGG + Intergenic
1001194584 5:169660487-169660509 CTGTTCTCATTTGAAAATATTGG + Intronic
1003189609 6:3862541-3862563 CTGTCCTCTTTTGCAAATAGTGG - Intergenic
1004555490 6:16693319-16693341 CTGTCCTCATCTGTAAAAATGGG + Intronic
1005359911 6:25022132-25022154 CTGTATACATTTGTTAAAACTGG - Intronic
1008668753 6:53744485-53744507 ATGTACTCAATTGCTACAACTGG + Intergenic
1008727911 6:54443431-54443453 CTCTTTTCATTTGTAAAAACTGG + Intergenic
1013107112 6:107035078-107035100 TTGTACTCATCTGCAAAATGAGG + Intronic
1013752725 6:113425800-113425822 CAATACTCATTTGCTAAAATTGG + Intergenic
1014486014 6:122000103-122000125 CTTTACTAAATTGCAAAAAGAGG + Intergenic
1014962888 6:127708594-127708616 CTGTTCTTATCTGCACAAACAGG + Exonic
1014966898 6:127765466-127765488 CAGTCTTCATTTGCAATAACTGG - Intronic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017372409 6:153727900-153727922 CTGTATTCCTTTGCTAAAAGAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1018040417 6:159916723-159916745 CTGCACTCACTTGCAAATACAGG - Intergenic
1018699219 6:166413304-166413326 CTGGACTCATTTGGAGGAACAGG + Intronic
1020362319 7:7340781-7340803 CTATAATCATTTGCAAACTCTGG + Intergenic
1022022352 7:26413090-26413112 GTTTCCTCAATTGCAAAAACAGG + Intergenic
1022425652 7:30266481-30266503 CAGAACCCCTTTGCAAAAACTGG - Intergenic
1023788271 7:43729756-43729778 CTGAATGCATTTGCAATAACCGG - Intergenic
1023825315 7:44004994-44005016 CTGTACTCATTTGGAAATTGCGG - Intronic
1024244344 7:47457859-47457881 GTGTCCTCATCTGTAAAAACAGG + Intronic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1026088864 7:67283765-67283787 CTGTACTCATTTGGAAATTGCGG - Intergenic
1026725390 7:72866582-72866604 CTGTACTCATTTGGAAATTGCGG + Intergenic
1027118455 7:75499083-75499105 CTGTACTCATTTGGAAATTGCGG - Intergenic
1027326789 7:77055447-77055469 CTGTACTCATTTGGAAATTGCGG + Intergenic
1027671011 7:81099203-81099225 TTGTACTCCTTTGATAAAACAGG - Intergenic
1028056942 7:86256875-86256897 CAGTACATATGTGCAAAAACCGG + Intergenic
1031417796 7:121513740-121513762 CTTTACTCATTTCCACAATCAGG + Intergenic
1031538977 7:122970162-122970184 CTCCTCTCCTTTGCAAAAACAGG - Intergenic
1031679942 7:124659491-124659513 TTTTGCTCATATGCAAAAACTGG + Intergenic
1031709463 7:125027023-125027045 CTGTGCTAATTAGCAAAGACTGG - Intergenic
1031742892 7:125456450-125456472 CTGGACTTATTGGGAAAAACAGG - Intergenic
1032271544 7:130412618-130412640 CTGTCCTCATTTGTAAAACACGG - Intronic
1032612673 7:133432318-133432340 CTTTACTCATTTGTAAAATGTGG + Intronic
1033803822 7:144931753-144931775 TTGTAATTATTTGAAAAAACAGG - Intergenic
1034288721 7:149910044-149910066 CTTTTCTCATTTGCAAAACAGGG - Intergenic
1034662356 7:152782823-152782845 CTTTTCTCATTTGCAAAACAGGG + Intronic
1035342980 7:158176390-158176412 CTTTCCTCATTTGCAAAATGTGG - Intronic
1037093585 8:14953691-14953713 ATTTCCCCATTTGCAAAAACGGG + Intronic
1038120329 8:24606822-24606844 CTTTACTCATTTCCAAATTCAGG + Intergenic
1039294160 8:36131080-36131102 CTGTTCTCATTTGCATAACAGGG - Intergenic
1040868290 8:52072720-52072742 CTGCACTAATTTTAAAAAACAGG - Intergenic
1041988222 8:63952881-63952903 CTGTTCTCATTTGCAAAATAGGG - Intergenic
1043498565 8:80830319-80830341 CAGTGCTCATTTGCAATAACTGG - Intronic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1044669222 8:94662009-94662031 CAGTATTCATTTGCTACAACTGG + Intronic
1045180330 8:99774584-99774606 GTGTACCCATTTTAAAAAACTGG + Intronic
1049707578 8:144050034-144050056 CTGCACGCATTTGCAAGCACTGG + Intergenic
1050657902 9:7849035-7849057 CTGGACTCCTTGGTAAAAACAGG + Intronic
1050923159 9:11231181-11231203 CAGTACACAATTGGAAAAACTGG - Intergenic
1052073573 9:24112730-24112752 CAGAACTCATTTGCAAAAGGTGG - Intergenic
1052202070 9:25794793-25794815 CTGTCATCATTGGCAAAAACTGG - Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1053276883 9:36789941-36789963 GTGTCCTCCTTTACAAAAACAGG + Intergenic
1054728317 9:68675127-68675149 TTGTATTCATTTACAAAAATCGG + Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056259555 9:84834162-84834184 CTGTATTTATTTGCTAAATCTGG - Intronic
1056559717 9:87719393-87719415 CTGTACTCATCTGTAAAATGGGG + Intergenic
1056566401 9:87776681-87776703 CTGTACTCATCTGTAAAATGGGG - Intergenic
1057523749 9:95781826-95781848 CTGTTCTCATTTGTAAAATTGGG + Intergenic
1058109777 9:101019321-101019343 CTCTAGTCATTTTCCAAAACAGG - Intergenic
1058652955 9:107194230-107194252 CTGTCCTGGTTTGCCAAAACTGG - Intergenic
1058706632 9:107642852-107642874 ATGTACTCATTTGTAAAATGGGG + Intergenic
1061165371 9:128919293-128919315 GTGTTCTCATTTGTAAAATCAGG + Intergenic
1193764625 X:85511899-85511921 ATTTACTCATCTGCAATAACAGG + Intergenic
1196142022 X:112273798-112273820 ATGTTCTCATTTGCAAAATGAGG + Intergenic
1197343354 X:125301160-125301182 ATGTGCTCACTTGAAAAAACTGG + Intergenic
1198501579 X:137254555-137254577 CTGATCTCATTTGCAAACATTGG + Intergenic
1198544732 X:137679342-137679364 GTTTACTCATTTGCAAATATAGG - Intergenic
1201904397 Y:19075362-19075384 TTGTATCCATTTGCAAGAACTGG - Intergenic