ID: 956630286

View in Genome Browser
Species Human (GRCh38)
Location 3:71310607-71310629
Sequence CGGAACATGGAGAGGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 631
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 592}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956630286_956630295 5 Left 956630286 3:71310607-71310629 CCTGCCTCCCTCTCCATGTTCCG 0: 1
1: 0
2: 0
3: 38
4: 592
Right 956630295 3:71310635-71310657 AGACTTTGACTGGTTTCTCAAGG 0: 1
1: 0
2: 1
3: 15
4: 167
956630286_956630300 30 Left 956630286 3:71310607-71310629 CCTGCCTCCCTCTCCATGTTCCG 0: 1
1: 0
2: 0
3: 38
4: 592
Right 956630300 3:71310660-71310682 CTAACTTTTGGTTCTCTTCTGGG 0: 1
1: 0
2: 0
3: 14
4: 263
956630286_956630298 18 Left 956630286 3:71310607-71310629 CCTGCCTCCCTCTCCATGTTCCG 0: 1
1: 0
2: 0
3: 38
4: 592
Right 956630298 3:71310648-71310670 TTTCTCAAGGGGCTAACTTTTGG 0: 1
1: 0
2: 5
3: 20
4: 177
956630286_956630293 -5 Left 956630286 3:71310607-71310629 CCTGCCTCCCTCTCCATGTTCCG 0: 1
1: 0
2: 0
3: 38
4: 592
Right 956630293 3:71310625-71310647 TTCCGGGATGAGACTTTGACTGG 0: 1
1: 0
2: 1
3: 3
4: 46
956630286_956630299 29 Left 956630286 3:71310607-71310629 CCTGCCTCCCTCTCCATGTTCCG 0: 1
1: 0
2: 0
3: 38
4: 592
Right 956630299 3:71310659-71310681 GCTAACTTTTGGTTCTCTTCTGG 0: 1
1: 0
2: 1
3: 11
4: 183
956630286_956630297 7 Left 956630286 3:71310607-71310629 CCTGCCTCCCTCTCCATGTTCCG 0: 1
1: 0
2: 0
3: 38
4: 592
Right 956630297 3:71310637-71310659 ACTTTGACTGGTTTCTCAAGGGG 0: 1
1: 0
2: 0
3: 13
4: 135
956630286_956630296 6 Left 956630286 3:71310607-71310629 CCTGCCTCCCTCTCCATGTTCCG 0: 1
1: 0
2: 0
3: 38
4: 592
Right 956630296 3:71310636-71310658 GACTTTGACTGGTTTCTCAAGGG 0: 1
1: 0
2: 1
3: 12
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956630286 Original CRISPR CGGAACATGGAGAGGGAGGC AGG (reversed) Intronic
900155878 1:1203111-1203133 TGGAGCCTGGAGTGGGAGGCTGG + Intergenic
900408821 1:2503857-2503879 CAGAAGAGAGAGAGGGAGGCAGG - Intronic
900542797 1:3212502-3212524 CAGAACATGGGGACGGAGGCAGG - Intronic
900814957 1:4836655-4836677 AGGAACATGGGGTGGGAGGATGG + Intergenic
901232127 1:7647158-7647180 CGGAACAGAGGGAGGGAGGCTGG - Intronic
901787480 1:11634326-11634348 CCAAACCTGGAGAGGGAGGCAGG + Intergenic
902018442 1:13327509-13327531 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
902018448 1:13327528-13327550 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
902018454 1:13327547-13327569 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
902018460 1:13327566-13327588 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
902018466 1:13327585-13327607 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
902018472 1:13327604-13327626 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
902018478 1:13327623-13327645 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
902018484 1:13327642-13327664 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
902793914 1:18787950-18787972 AGGAAAAGAGAGAGGGAGGCAGG + Intergenic
903323080 1:22554085-22554107 CAGATCATGGAGAAGGAGCCAGG - Intergenic
903638152 1:24834812-24834834 CGGGAGAGGGAGAGGGAGACGGG + Intronic
903638158 1:24834831-24834853 CGGGAGAGGGAGAGGGAGACGGG + Intronic
903638164 1:24834850-24834872 CGGGAGAGGGAGAGGGAGACGGG + Intronic
903638174 1:24834882-24834904 CGGGAGAGGGAGAGGGAGACGGG + Intronic
903638192 1:24834939-24834961 CGGGAGAGGGAGAGGGAGACGGG + Intronic
903638202 1:24834971-24834993 CGGGAGAGGGAGAGGGAGACGGG + Intronic
903827455 1:26156269-26156291 CGGTTCATGGCGAGGGTGGCTGG + Intergenic
903921806 1:26804866-26804888 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
903921812 1:26804885-26804907 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
904383120 1:30124752-30124774 AGGAAACTTGAGAGGGAGGCTGG - Intergenic
904499709 1:30907107-30907129 AGGAACTTGCAGAGGGCGGCTGG + Intronic
904525405 1:31129764-31129786 CGTAACATGGCCAGGGAGGTGGG + Intergenic
905253312 1:36664177-36664199 GGGACCATGGGGAGGGTGGCTGG + Intergenic
905388504 1:37621201-37621223 GGGAAGTTGGAGAGGGAAGCAGG + Intronic
905440024 1:37989745-37989767 CGGAGCTCGGAGAGGGAGCCCGG + Intronic
906580404 1:46930861-46930883 CGGACCCTGGGGTGGGAGGCAGG - Intronic
906603319 1:47148027-47148049 CGGACCCTGGGGTGGGAGGCAGG + Intronic
906662137 1:47590573-47590595 CTGAGGATAGAGAGGGAGGCTGG + Intergenic
907375745 1:54037833-54037855 TGGAACATGGAGAGGAAAGTGGG - Intronic
907651084 1:56295412-56295434 AGGGACAGGGAGAGGGAGACGGG - Intergenic
909001842 1:70226788-70226810 GGGAAGCTGGAGTGGGAGGCTGG + Intronic
909601489 1:77466058-77466080 CGGGCCATGGTGAGGGAGTCGGG - Intronic
909914057 1:81295640-81295662 TGGAACTTAGAGAGGGAGGAAGG - Intergenic
911197068 1:95005337-95005359 GTGAACATGAAAAGGGAGGCAGG + Intronic
912381115 1:109248790-109248812 CAGGACATGGACAGGGAGGCAGG + Intergenic
912493866 1:110078753-110078775 GGGCAGATGGAGAGGCAGGCAGG + Intergenic
916351422 1:163853997-163854019 TGGAACCTGCAGAGGCAGGCAGG + Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
918148934 1:181781591-181781613 CAGAACATGGGGAGGAAGCCAGG + Intronic
919801560 1:201357555-201357577 CCCAAAATGGACAGGGAGGCAGG - Intergenic
920041878 1:203103354-203103376 GGGAAGATGGGGAAGGAGGCAGG - Intronic
920365719 1:205447470-205447492 TGGAACAGGGAGTAGGAGGCGGG + Intronic
920504032 1:206504113-206504135 GGGAACTTGGGGAGGGAGGCTGG + Intergenic
920890303 1:209978804-209978826 TGGAACCTGCAGAGGCAGGCAGG + Intronic
921764918 1:218960267-218960289 CGGAAAGTGGAGGGGGAGGAGGG - Intergenic
921877378 1:220213690-220213712 AGGGAAATGGAGAGGGAGGGAGG + Intronic
922751754 1:228073392-228073414 AGGAACATGCAGAGGGTGGGTGG - Intergenic
922801899 1:228368279-228368301 CTTAAAGTGGAGAGGGAGGCTGG + Intronic
922888972 1:229046090-229046112 AGAAACAGGGAGAGAGAGGCGGG - Intergenic
923699760 1:236288741-236288763 GGGAACATGGAGCGGGAAGAAGG - Intergenic
1063254154 10:4308134-4308156 AGGAACGTGGAGTGGGAGGGGGG - Intergenic
1063596656 10:7441553-7441575 GGGAAAATGGAGGGGGTGGCAGG + Intergenic
1064331848 10:14401592-14401614 CTGAGCATGGAGAGGGAGGAGGG - Intronic
1065175103 10:23068133-23068155 AGGAAACTGGAGAGGGCGGCAGG - Intergenic
1065728754 10:28691662-28691684 GGGAAGAGGGAGAGGGAGGGAGG - Intergenic
1065840140 10:29695785-29695807 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1065840150 10:29695817-29695839 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1065840164 10:29695861-29695883 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1065840170 10:29695880-29695902 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1065840176 10:29695899-29695921 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1065967926 10:30784010-30784032 AGGGGCTTGGAGAGGGAGGCTGG + Intergenic
1066085114 10:31968974-31968996 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1066085120 10:31968993-31969015 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1066085126 10:31969012-31969034 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1066085132 10:31969031-31969053 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1066085138 10:31969050-31969072 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1066085144 10:31969069-31969091 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1066085150 10:31969088-31969110 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1066367450 10:34791305-34791327 TGGAGCATCGAGAGGGACGCAGG - Intronic
1066478699 10:35773816-35773838 TGGAACACGGAGAAGGAGGGGGG + Intergenic
1067006163 10:42665653-42665675 TGGAACCTGCAGAGGCAGGCAGG - Intergenic
1067014612 10:42748059-42748081 TGGAAGATGGAGATGGAGGTGGG + Intergenic
1067743390 10:48913938-48913960 TGGAACTTGGAGATGGAGTCAGG + Exonic
1067781694 10:49212412-49212434 GGGAGTAGGGAGAGGGAGGCAGG - Intergenic
1068813531 10:61283723-61283745 AGGAATTTGGAGAGGCAGGCAGG - Intergenic
1069773928 10:70916009-70916031 CGGGTCAGGGAGAGGGAGGCTGG + Intergenic
1070393862 10:75994542-75994564 CGGGAGCAGGAGAGGGAGGCTGG + Intronic
1070845233 10:79516915-79516937 CGGGAGATGGAGATGAAGGCAGG - Intergenic
1070982461 10:80660434-80660456 GGGAAGATGGTGAGGGAGCCGGG - Intergenic
1071435957 10:85648411-85648433 TGGAACCTGGAGAGAGAGGCTGG - Intronic
1072573045 10:96675226-96675248 AGGAAAATGGGGAGGGAGGGTGG + Intronic
1072999445 10:100276289-100276311 AGGGAGATGGAGAGGGAGACGGG - Intronic
1072999472 10:100276385-100276407 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1072999478 10:100276404-100276426 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1072999484 10:100276423-100276445 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1072999490 10:100276442-100276464 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1072999496 10:100276461-100276483 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1073339632 10:102735182-102735204 AGCAACATGGAGAGGGAGGAAGG - Intronic
1073771058 10:106736404-106736426 GGGAACATGAAGAGGAAGGCAGG - Intronic
1076785468 10:132747546-132747568 CGGAACCTGCACAGGAAGGCCGG + Intronic
1077219257 11:1408168-1408190 AGGAACAGGCGGAGGGAGGCTGG - Intronic
1077837661 11:5938452-5938474 GGGAAAAAGGAGAGAGAGGCGGG + Intronic
1078090087 11:8259644-8259666 CCAACCCTGGAGAGGGAGGCAGG - Intronic
1079243496 11:18737156-18737178 CAGAACTTGGCGAGGGTGGCAGG + Intronic
1079301272 11:19281189-19281211 GGGGACCTGGAGGGGGAGGCTGG - Intergenic
1082778901 11:57270987-57271009 AGGAACATGGGGAGGGAGGGAGG - Intergenic
1082805432 11:57446395-57446417 CTGAAGATGAACAGGGAGGCAGG + Intergenic
1083378285 11:62243876-62243898 TTGAACAGGGAGAGGAAGGCAGG + Intronic
1083503658 11:63134880-63134902 ATGAAGCTGGAGAGGGAGGCAGG - Intronic
1083865269 11:65450348-65450370 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1083865275 11:65450367-65450389 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1083935107 11:65865909-65865931 CGGAACCTGGAGGGAGTGGCAGG + Intronic
1084476637 11:69393249-69393271 GGGAACATGGAGAGGAAGGAAGG + Intergenic
1084950145 11:72660495-72660517 CGCAACCTGGAGAGGGAGCCAGG + Intronic
1084960593 11:72714200-72714222 AGGGAGGTGGAGAGGGAGGCTGG + Exonic
1085085343 11:73662849-73662871 TGGATCATGGAGAGGGAAACAGG - Intergenic
1085116908 11:73937715-73937737 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1085159028 11:74324025-74324047 CTGTACATTGAGACGGAGGCAGG - Intergenic
1085754223 11:79190845-79190867 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754229 11:79190864-79190886 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754235 11:79190883-79190905 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754241 11:79190902-79190924 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754247 11:79190921-79190943 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754253 11:79190940-79190962 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754261 11:79190966-79190988 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754267 11:79190985-79191007 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754273 11:79191004-79191026 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754279 11:79191023-79191045 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754285 11:79191042-79191064 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754291 11:79191061-79191083 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085960064 11:81451173-81451195 CTGAACATGGAGAGGTAGCTGGG + Intergenic
1086858239 11:91892654-91892676 AGGAAAAAGGAGAGGGAGGAAGG - Intergenic
1088891843 11:114050747-114050769 AGGCAAATGGAGAGCGAGGCAGG - Intergenic
1089654678 11:119938442-119938464 CCCAACATGGAGAGGGAGGGAGG - Intergenic
1091250662 11:134141427-134141449 CGGTACATGGACAGGGAGAGAGG + Intronic
1091378387 12:41224-41246 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1091378393 12:41243-41265 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1091378399 12:41262-41284 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1091666791 12:2424695-2424717 TGGAATTGGGAGAGGGAGGCAGG - Intronic
1091962918 12:4714021-4714043 CAGAACGTGGAGGCGGAGGCGGG - Intronic
1092233836 12:6793209-6793231 CAGAACAGGGAGCTGGAGGCAGG + Intronic
1092275886 12:7060728-7060750 CAGAACCAGGACAGGGAGGCTGG + Intronic
1093516329 12:19990808-19990830 CTTAAGAGGGAGAGGGAGGCAGG + Intergenic
1096743499 12:53711190-53711212 GGGGACCTGGAGAGGGAGGGGGG + Intronic
1096752761 12:53772650-53772672 TGGCATCTGGAGAGGGAGGCTGG + Intergenic
1100570930 12:95842367-95842389 CGGGAAAGGGAGAGGGAGACGGG + Intergenic
1100570936 12:95842386-95842408 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1100570942 12:95842405-95842427 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1100570948 12:95842424-95842446 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1100570954 12:95842443-95842465 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1100570960 12:95842462-95842484 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1100570966 12:95842481-95842503 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1100570972 12:95842500-95842522 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1100570978 12:95842519-95842541 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1101079062 12:101163336-101163358 TGGGGCATGGGGAGGGAGGCAGG + Intronic
1101396786 12:104355819-104355841 CAGAACAGGGAGAGAGGGGCAGG + Intergenic
1102727836 12:115081161-115081183 TGGAACATCCAGATGGAGGCTGG + Intergenic
1103437237 12:120936440-120936462 CGGCACTTGCAGAGGGAGGGAGG - Intergenic
1103447544 12:121004051-121004073 TTGAACTTGGAGAGGGAGGTGGG + Exonic
1104845748 12:131845959-131845981 CCGACCAGGGAGAGGCAGGCCGG - Intronic
1107562514 13:41571306-41571328 CGGGAGAGGGAGAGGGAGGAGGG - Intronic
1107562521 13:41571325-41571347 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1108321795 13:49297382-49297404 CGGCACAGGGACAGTGAGGCTGG + Intergenic
1109722866 13:66298629-66298651 AGGAAGATGGAGATGGAGGGAGG + Intergenic
1112693848 13:101926003-101926025 AGGATCTTGAAGAGGGAGGCAGG - Intronic
1113346390 13:109482526-109482548 GGGAAGAGGGAGAGGGAAGCAGG + Intergenic
1113593640 13:111517337-111517359 TGTGACAAGGAGAGGGAGGCGGG + Intergenic
1113596954 13:111540198-111540220 CGGAACTTGGGGAGGGGGGACGG - Intergenic
1113812044 13:113148921-113148943 CGGAACACGGAGCAGGAGGAGGG + Exonic
1114084123 14:19226562-19226584 GGGAACATGCACAGGGAGGAGGG - Intergenic
1114183502 14:20383645-20383667 CTGTACATGGAGAGGAAGTCAGG + Intronic
1114458577 14:22872610-22872632 CGGAAGAGGGAGTGGGGGGCGGG - Intronic
1114590450 14:23859995-23860017 CAGAAAATGGAGGGGGAGCCTGG - Intergenic
1114615378 14:24065265-24065287 CGGAAGATGGTAAGTGAGGCAGG + Exonic
1114854749 14:26424783-26424805 GGGAACAGAGAGAGGGAGGGAGG - Intergenic
1116609486 14:47049277-47049299 CAGGACATGGAGATGGAGGTGGG + Intronic
1118341424 14:64896672-64896694 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1118341430 14:64896691-64896713 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1118341436 14:64896710-64896732 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1118341442 14:64896729-64896751 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1118341448 14:64896748-64896770 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1118341454 14:64896767-64896789 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1118341460 14:64896786-64896808 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1118621776 14:67620266-67620288 CAGAGAATGGAGAGGGAGGGAGG + Intronic
1121092377 14:91191564-91191586 GGGAACAGGGAGAATGAGGCTGG - Intronic
1121552791 14:94814983-94815005 CAGAACCTGGAGAGAGAGACAGG - Intergenic
1122435746 14:101695494-101695516 AGGAAAAAGGGGAGGGAGGCTGG + Intergenic
1122646258 14:103196420-103196442 CAGCACATGAAGACGGAGGCAGG - Intergenic
1122915957 14:104859101-104859123 TGGAAGATGGAGATGGAGGGTGG - Intergenic
1123129274 14:105972436-105972458 GGGAAAAGGGAGAGGGAAGCAGG + Intergenic
1123409789 15:20048603-20048625 GGGAAAAGGGAGAGGGAAGCAGG + Intergenic
1123519121 15:21055311-21055333 GGGAAAAGGGAGAGGGAAGCAGG + Intergenic
1124239942 15:28020440-28020462 AGGAACCTGAAGGGGGAGGCTGG - Intronic
1125675281 15:41498888-41498910 TGGAACTTGGGGAGGGAGGATGG + Intronic
1127616515 15:60691251-60691273 AGCAAAATGGAGAGGGGGGCAGG - Intronic
1127952412 15:63822198-63822220 ATAAACAAGGAGAGGGAGGCAGG + Intronic
1128682307 15:69660969-69660991 CAGAACATTGAGATGGAAGCTGG + Intergenic
1130137599 15:81195169-81195191 CGGAAAATAGAGGGAGAGGCGGG + Intronic
1131908096 15:97166076-97166098 TGGAACAGAGAGAGGGAGGGAGG - Intergenic
1132318148 15:100905412-100905434 AAGAACATGCAGAGGGAGGATGG + Intronic
1133854440 16:9536451-9536473 CTGAAACTGGAGAGGCAGGCAGG + Intergenic
1134257389 16:12623447-12623469 CTTTACATAGAGAGGGAGGCAGG - Intergenic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1136392396 16:29973886-29973908 AGGAAGAGGGAGAGGGAGACCGG + Exonic
1136414277 16:30094217-30094239 AGGACTATGGAAAGGGAGGCTGG + Intronic
1136588186 16:31201398-31201420 AGGGACATGGAGCTGGAGGCTGG + Intergenic
1136777230 16:32878522-32878544 CAGAACCTGGAGAGGTGGGCAGG + Intergenic
1136871018 16:33808432-33808454 GGGAAAAGGGAGAGGGAAGCAGG - Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137750901 16:50860302-50860324 TGAGACATGGAGAGAGAGGCGGG + Intergenic
1140562791 16:76003144-76003166 AGGGACAGAGAGAGGGAGGCAGG + Intergenic
1140642505 16:76992902-76992924 TGTAAGATGGATAGGGAGGCTGG - Intergenic
1142211942 16:88812474-88812496 CGGACCCGGGGGAGGGAGGCCGG + Intergenic
1203101154 16_KI270728v1_random:1307626-1307648 GGGAAAAGGGAGAGGGAAGCAGG + Intergenic
1142499692 17:325373-325395 AGGAAGATGGAGAGGTAGGCAGG - Intronic
1143319616 17:6059627-6059649 GGGAGCAGGGAGAGGAAGGCGGG + Intronic
1143714162 17:8755167-8755189 GGGAACCTGGAGAAGGAGGATGG + Intronic
1144256619 17:13474723-13474745 CGGTAAATGCAGAGGGAAGCAGG + Intergenic
1145733431 17:27211256-27211278 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1145733448 17:27211313-27211335 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1145733462 17:27211357-27211379 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1145733468 17:27211376-27211398 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1145733474 17:27211395-27211417 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1147196524 17:38770265-38770287 GGGAACATGGCAAGGCAGGCAGG + Intronic
1148102139 17:45098704-45098726 GGGAGCATGGAGAGGGCGGGAGG + Intronic
1148130130 17:45257335-45257357 GGGAACAAGGAGAGCGGGGCAGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148704978 17:49622149-49622171 AGGATCATGCAGAGGGAGGGAGG - Intronic
1148837360 17:50472431-50472453 CGGATCATGAACATGGAGGCAGG + Exonic
1150621031 17:66807811-66807833 CTGAGAAGGGAGAGGGAGGCGGG + Exonic
1150636228 17:66915190-66915212 TGGGGCAGGGAGAGGGAGGCAGG + Intergenic
1151490771 17:74431318-74431340 CGGAACAGGGAGTGGGGGGTGGG + Exonic
1151755945 17:76075294-76075316 CGGGGGATGGAGCGGGAGGCGGG + Intronic
1151760981 17:76103180-76103202 CGGAACATGGGGAGGGGGCTAGG + Intronic
1152380857 17:79941689-79941711 GGGAACACTGAGAAGGAGGCTGG - Intronic
1152386952 17:79980426-79980448 GGGAACATGCAGTGGGAGTCTGG + Intronic
1152817802 17:82418544-82418566 CGTAACAGGGAGCGCGAGGCAGG + Exonic
1154132941 18:11751816-11751838 CGGGGAAGGGAGAGGGAGGCTGG - Intronic
1155109200 18:22697175-22697197 TGGAAAATGGACAGGGAGTCTGG + Intergenic
1156301673 18:35841689-35841711 GGGAACATGGAGAGGACTGCAGG - Intergenic
1156473963 18:37394262-37394284 CAGAGCAGGGAGAGGGACGCGGG + Intronic
1156482603 18:37445582-37445604 GGGAGCAGGGAGAGAGAGGCAGG + Intronic
1156492854 18:37506541-37506563 AGGCAGATGGAGAGGGAGGTTGG + Intronic
1157399102 18:47372029-47372051 GGGAACATAGTGAGTGAGGCAGG - Intergenic
1158427260 18:57351844-57351866 CGGAAAGGGGAGAGGAAGGCAGG + Exonic
1158852265 18:61506768-61506790 CTGTCCATGGAGAGGCAGGCTGG + Intronic
1159954187 18:74507800-74507822 CCTGACAAGGAGAGGGAGGCCGG - Intronic
1160011519 18:75110061-75110083 GGGAGGAGGGAGAGGGAGGCTGG + Intergenic
1160391900 18:78540350-78540372 CTGAAGATGGAGGTGGAGGCTGG + Intergenic
1160681520 19:413580-413602 CTGAGCCTGGAGTGGGAGGCAGG - Intergenic
1160816525 19:1038540-1038562 GGGAGCATGGAGAGGGGGTCAGG - Exonic
1160865243 19:1253282-1253304 GGGCCCATGGGGAGGGAGGCAGG - Intronic
1161289951 19:3488326-3488348 CGGCACAGGGACAGGCAGGCGGG + Intergenic
1161734117 19:5979913-5979935 GGGAACAAGGGGAGGGAGGGAGG - Intergenic
1161983801 19:7643546-7643568 GGGACCTTGGAGAGGTAGGCAGG + Intronic
1162337355 19:10070231-10070253 GGGAGCATGGAGAGAGAGGCGGG + Intergenic
1163029915 19:14537262-14537284 GGGACCAGGGAGGGGGAGGCGGG + Intronic
1163029925 19:14537282-14537304 GGGACCAGGGAGGGGGAGGCGGG + Intronic
1163769327 19:19181113-19181135 TGGAACCCAGAGAGGGAGGCTGG + Intronic
1164066236 19:21720258-21720280 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1164066242 19:21720277-21720299 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1164066248 19:21720296-21720318 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1164066254 19:21720315-21720337 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1164066260 19:21720334-21720356 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1164066266 19:21720353-21720375 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1164245269 19:23422653-23422675 CCTAACGTGGAGAAGGAGGCAGG + Intergenic
1164308791 19:24028888-24028910 CCTAACATGGAGGAGGAGGCAGG - Intergenic
1164515179 19:28928195-28928217 TGGATCCTGGAGGGGGAGGCTGG + Intergenic
1166069945 19:40381173-40381195 CGGGGCATGGAGAAGGGGGCAGG + Intronic
1166079269 19:40433816-40433838 CAGAAAATGGAGACGGAGCCAGG + Intergenic
1166097315 19:40549061-40549083 CTGAACAAGGAGAGGGTGGAAGG + Intronic
1166665659 19:44678750-44678772 AGGAAAATGGAGAGGGGGGAGGG - Intronic
1166813364 19:45527194-45527216 AGGGGCATGGGGAGGGAGGCTGG - Intergenic
1167045506 19:47046667-47046689 CGGAACCAGGAGAGGAAGGCTGG + Exonic
1167748609 19:51367233-51367255 CGGAGCAGGGAGAGGAAGGTGGG + Intronic
1167758404 19:51427487-51427509 AGGGTCATGCAGAGGGAGGCTGG + Intergenic
1168277928 19:55287329-55287351 GGTAACCTGGAGAGGGAGGATGG - Intronic
1168414659 19:56160509-56160531 TGGAGGAGGGAGAGGGAGGCTGG - Exonic
1168505671 19:56932801-56932823 CGGAACAAAGGGAGGGAGGGAGG - Intergenic
925344710 2:3162673-3162695 CGGAACATAGAGAGGCAGAGTGG + Intergenic
925428493 2:3771132-3771154 CGGAGGATGCAGAGGGAGGACGG - Intronic
925705932 2:6684772-6684794 GGGAAGCTGGAGAGGGAGGAGGG + Intergenic
926146511 2:10399809-10399831 GGGGACGTGGAGAGGGAGGCTGG - Intronic
926230970 2:11003544-11003566 CAGAACCTGGAGAGGCAGGAAGG + Intergenic
926994240 2:18716734-18716756 CTGAAGGTGGAGGGGGAGGCTGG - Intergenic
927154935 2:20216050-20216072 CGGGAGGTGGGGAGGGAGGCAGG + Intronic
927842255 2:26453252-26453274 ATGAGCATGGAGAGAGAGGCAGG - Intronic
927998871 2:27506167-27506189 GAGACCCTGGAGAGGGAGGCAGG - Intronic
929533206 2:42764905-42764927 CGGAATAGGGAGTGGGAGGCTGG + Intergenic
930209010 2:48615484-48615506 CGGGAGAGGGAGAGGGAGACGGG + Intronic
930209016 2:48615503-48615525 CGGGAGAGGGAGAGGGAGACGGG + Intronic
930209022 2:48615522-48615544 CGGGAGAGGGAGAGGGAGACGGG + Intronic
930277963 2:49335757-49335779 AGGAACAGGGAGGGGGACGCTGG + Intergenic
930620415 2:53637694-53637716 TGGTCCATGGAGAGGGAGGGAGG - Intronic
931222218 2:60297890-60297912 CGGGACCTTGCGAGGGAGGCGGG + Intergenic
931751864 2:65338174-65338196 CGGGAGAGGGAGAGGGAGACGGG - Intronic
931751870 2:65338193-65338215 CGGGAGAGGGAGAGGGAGACGGG - Intronic
931751876 2:65338212-65338234 CGGGAGAGGGAGAGGGAGACGGG - Intronic
931751886 2:65338244-65338266 CGGGAGAGGGAGAGGGAGACGGG - Intronic
931751892 2:65338263-65338285 CGGGAGAGGGAGAGGGAGACGGG - Intronic
931751898 2:65338282-65338304 CGGGAGAGGGAGAGGGAGACGGG - Intronic
932823486 2:74920801-74920823 CTGGACATTGAGAGGGAGGCAGG - Intergenic
934151306 2:89150155-89150177 GGGACAATGGAGAGGGATGCTGG + Intergenic
935122674 2:100196474-100196496 AGGATTATGTAGAGGGAGGCAGG - Intergenic
935148949 2:100417013-100417035 AGGAGCATGCAGAGGAAGGCAGG - Intronic
937098110 2:119248711-119248733 CTGAACAAGGAGGGGGTGGCAGG + Intronic
938115913 2:128602836-128602858 CGGAACAGGGAGAGGGACGTTGG + Intergenic
938562952 2:132490714-132490736 CTGAACAGGGTGAGGGAGGTAGG + Intronic
938971473 2:136437135-136437157 AGGAAGATGGGGAGGGAGGAAGG + Intergenic
940982083 2:160014902-160014924 AAGGACAGGGAGAGGGAGGCTGG + Intronic
942398302 2:175575370-175575392 CTTCACATGGAGAGGGAGGGAGG - Intergenic
943773168 2:191741099-191741121 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
943773174 2:191741118-191741140 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
943773195 2:191741182-191741204 CGGGAGAGGGAGAGGGAGACAGG - Intergenic
943773200 2:191741201-191741223 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
944509876 2:200453983-200454005 GGGAGCATGGGGAGGGAGGCAGG - Intronic
945090548 2:206172610-206172632 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090554 2:206172629-206172651 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090560 2:206172648-206172670 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090566 2:206172667-206172689 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090572 2:206172686-206172708 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090578 2:206172705-206172727 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090616 2:206172823-206172845 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090662 2:206172967-206172989 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090668 2:206172986-206173008 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090678 2:206173018-206173040 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090688 2:206173050-206173072 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090694 2:206173069-206173091 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090700 2:206173088-206173110 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090706 2:206173107-206173129 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945150545 2:206785643-206785665 TGGAACATGCAGTGGGATGCGGG - Intronic
945922793 2:215772947-215772969 TGGAAGATGGAGATGGAGGTGGG - Intergenic
945970615 2:216227547-216227569 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970621 2:216227566-216227588 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970627 2:216227585-216227607 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970633 2:216227604-216227626 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970643 2:216227636-216227658 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970649 2:216227655-216227677 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970655 2:216227674-216227696 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970661 2:216227693-216227715 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970667 2:216227712-216227734 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970673 2:216227731-216227753 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970679 2:216227750-216227772 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
947678037 2:232002748-232002770 GGGAACAGTGAAAGGGAGGCAGG - Intronic
948058870 2:235029225-235029247 GGGAAGACGGAGAGGGATGCTGG + Intronic
948563170 2:238867238-238867260 AGAAAGAGGGAGAGGGAGGCAGG + Intronic
948658097 2:239489377-239489399 GGGGACAAGGAGGGGGAGGCAGG - Intergenic
1169085318 20:2822528-2822550 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085340 20:2822598-2822620 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085346 20:2822617-2822639 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085352 20:2822636-2822658 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085358 20:2822655-2822677 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085364 20:2822674-2822696 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085370 20:2822693-2822715 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085376 20:2822712-2822734 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085382 20:2822731-2822753 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085388 20:2822750-2822772 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085394 20:2822769-2822791 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085400 20:2822788-2822810 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085406 20:2822807-2822829 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085412 20:2822826-2822848 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085418 20:2822845-2822867 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085424 20:2822864-2822886 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085430 20:2822883-2822905 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085436 20:2822902-2822924 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085442 20:2822921-2822943 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085448 20:2822940-2822962 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085454 20:2822959-2822981 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085460 20:2822978-2823000 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1170822734 20:19767957-19767979 CGAAACATGGAGAGAGACGGAGG + Intergenic
1170868437 20:20181851-20181873 TGGAACAGGTAGAGGGAGGTGGG + Intronic
1171488422 20:25500060-25500082 GGGAATAGGGAGAGGGGGGCAGG + Intronic
1172393652 20:34583686-34583708 CGGAACAAGGACAGGGAAGGTGG + Intronic
1173221466 20:41136358-41136380 TGGAACATGCAGTGGGATGCTGG + Intergenic
1173615422 20:44400328-44400350 CGAAACAGGGAGAGGGAGGAGGG + Intronic
1173860144 20:46277890-46277912 CGGTAGCTGGAGAGGAAGGCAGG + Intronic
1174194080 20:48760631-48760653 CTGAGCCAGGAGAGGGAGGCTGG + Intronic
1174680939 20:52407507-52407529 AGGAAGATGTAGAGGGAGGGCGG + Intergenic
1174837616 20:53873150-53873172 AGGAACGGGGAGAGGGAGGGAGG + Intergenic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175871156 20:62210148-62210170 CGGATCCTGGAGCAGGAGGCAGG - Intergenic
1175900020 20:62356313-62356335 CGGGTCATGGCGAGGGCGGCCGG - Intronic
1176027975 20:62995823-62995845 CTGGACATGGAGAGTGACGCTGG + Intergenic
1179080336 21:38164963-38164985 CCAAACATGGGGAGGGAGGGAGG + Intronic
1179095478 21:38310846-38310868 CAAAACATGGAGAGGAAGCCAGG - Intergenic
1179195025 21:39156588-39156610 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1180293848 22:10866641-10866663 GGGAACATGCACAGGGAGGAGGG + Intergenic
1180496655 22:15896056-15896078 GGGAACATGCACAGGGAGGAGGG + Intergenic
1180960429 22:19759905-19759927 CGGAAGAGGGCGAGTGAGGCTGG + Intronic
1181469315 22:23128057-23128079 TGGCACAAGGAGAGGGAGACTGG + Intronic
1182995628 22:34809431-34809453 TGGAACATGGAGAAAGTGGCAGG - Intergenic
1183558104 22:38547412-38547434 CTGAGCTTGGAGAGGCAGGCTGG + Intronic
1183691090 22:39388829-39388851 CGGGAAGTGGACAGGGAGGCGGG - Intergenic
1183871898 22:40746386-40746408 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871904 22:40746405-40746427 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871910 22:40746424-40746446 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871924 22:40746468-40746490 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871930 22:40746487-40746509 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871936 22:40746506-40746528 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871942 22:40746525-40746547 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871948 22:40746544-40746566 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871954 22:40746563-40746585 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871964 22:40746595-40746617 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1184114181 22:42412656-42412678 CGGTAGACAGAGAGGGAGGCAGG + Intronic
1184268834 22:43365937-43365959 CAGACCATGGAGAGAGAGGCTGG + Intergenic
1184533518 22:45071504-45071526 CAGAACAAGGAGAGGGAGCAGGG + Intergenic
1184959351 22:47917854-47917876 GGGAAGAAGGAGAGGGAGGAGGG - Intergenic
1185371129 22:50461433-50461455 GAGAAAAGGGAGAGGGAGGCAGG + Intronic
1185382087 22:50514169-50514191 AGGCAGCTGGAGAGGGAGGCTGG + Intronic
949935033 3:9109928-9109950 GTGAACATGGAGACTGAGGCAGG + Intronic
950447473 3:13046650-13046672 CGGGCCATGGAGAGGGAGGAGGG - Intronic
950525347 3:13519704-13519726 AGGAACATGGAGAGCGTGGGTGG + Intergenic
950969916 3:17176039-17176061 GAGAACATGGAGAGGCAGCCTGG + Intronic
951543867 3:23806719-23806741 CGAAACAGGGGGACGGAGGCGGG - Intronic
952881588 3:37989300-37989322 CGGAAGATGGAGACTTAGGCCGG + Intronic
952920834 3:38282740-38282762 CGGTCCCTGCAGAGGGAGGCTGG + Intronic
953074083 3:39551628-39551650 AGGAACATAGAGAGGCAGTCTGG - Intergenic
954763774 3:52896749-52896771 AGGGCCACGGAGAGGGAGGCGGG + Intronic
955275047 3:57539331-57539353 GTGAAGATGGAGAGGGAGGTGGG - Intronic
955419299 3:58720956-58720978 CGGCACTTGGGGAGGGTGGCGGG + Intronic
955424682 3:58776036-58776058 CAGAAAAGGGAGAGGAAGGCTGG - Intronic
956630286 3:71310607-71310629 CGGAACATGGAGAGGGAGGCAGG - Intronic
956859545 3:73308787-73308809 CGCAACATGGAGCCAGAGGCTGG + Intergenic
958427458 3:93995580-93995602 AGGAAGATGGAAAGGGAGGTAGG - Intronic
958442869 3:94177923-94177945 CGGAACTTGGAGGAGGAGGAAGG + Intergenic
959086356 3:101854552-101854574 GGGAACATGGAAAGGAAAGCGGG - Intronic
959138115 3:102450526-102450548 AGGAGCATGCAGAGGTAGGCAGG + Intronic
959407338 3:105976497-105976519 GGGAAGGTGGAGAGGGAGGGAGG + Intergenic
961026550 3:123563369-123563391 ATGAGCATGGAGTGGGAGGCAGG + Intronic
961821062 3:129575861-129575883 GGAAACAGGGAGTGGGAGGCGGG + Intronic
962795304 3:138844808-138844830 TTGAAAAAGGAGAGGGAGGCTGG + Intergenic
963749977 3:149167110-149167132 CAGAACATGGACACTGAGGCCGG - Exonic
966209846 3:177442023-177442045 CTGAAGATGGAGAGAGAGCCTGG + Intergenic
967769110 3:193314366-193314388 CAGAATATGGAGAGGGAGATGGG - Intronic
967787106 3:193509144-193509166 AGGCACATGGAGAGTGATGCAGG - Intronic
968636835 4:1685048-1685070 GGGAGGCTGGAGAGGGAGGCAGG - Intergenic
968731619 4:2271801-2271823 CGGGGTATGGTGAGGGAGGCGGG + Intronic
968844030 4:3029809-3029831 AGGAGCATGGGGAAGGAGGCAGG - Intronic
968934934 4:3604942-3604964 TGGACCAGGGAGAGGCAGGCAGG + Intergenic
969218795 4:5746020-5746042 GGGACCATGGAGAGGCTGGCCGG + Intronic
970946369 4:21697784-21697806 CAGACCATTCAGAGGGAGGCGGG + Intronic
971037419 4:22709283-22709305 GGGAAAATGGGGAGGGAGCCAGG + Intergenic
972339887 4:38142961-38142983 CTGGATATGGAGAGGCAGGCAGG - Intergenic
972636297 4:40886867-40886889 CGGCCCCTGGAGATGGAGGCTGG - Intronic
973177074 4:47220355-47220377 TGGAACAGGGAGAAGGAAGCAGG - Intronic
975469073 4:74743927-74743949 GGGAGCATGGAGAGGGAGCAGGG - Intergenic
975536921 4:75460703-75460725 CGGAAAGTGGAGAGGGAGGGAGG + Intergenic
975661124 4:76689720-76689742 CTGGGCACGGAGAGGGAGGCGGG + Intronic
976165398 4:82249112-82249134 GGGAATATGGGAAGGGAGGCTGG - Intergenic
976231240 4:82845505-82845527 TGAAACAGGGAGAGGAAGGCAGG + Intronic
976701570 4:87974979-87975001 GGGAACAAGGATAGGTAGGCTGG + Intergenic
976887306 4:90001374-90001396 AGGAACATGGAGAGGAAGGAAGG - Intergenic
977428797 4:96904561-96904583 CTAAACATGGAGAGGGAGGGAGG + Intergenic
979288829 4:118957433-118957455 TGGTAAATGGAGAGGGAGGGAGG - Intronic
980493482 4:133560651-133560673 AGGAGCAGGGAGAGGGAGCCAGG + Intergenic
980773492 4:137409384-137409406 AGGAACCAGGAGAGGGAGGGAGG + Intergenic
982076897 4:151746800-151746822 GGGAACAGGGAGATGGAGGCAGG + Intronic
984191123 4:176606935-176606957 GTGAAGATGGAGAGAGAGGCTGG + Intergenic
984382746 4:179015960-179015982 GTGAAGATGGAGAGAGAGGCTGG - Intergenic
985647895 5:1093707-1093729 CTGAACACGGGGAGGGAGGTCGG - Intronic
985826276 5:2193944-2193966 CCTAATATGGAAAGGGAGGCTGG - Intergenic
985948357 5:3203865-3203887 TGGAACGTGGGGAGGGAGGTGGG + Intergenic
987298259 5:16573655-16573677 AGGCACAGGGAGAGGGAGGATGG + Intronic
989565405 5:42896463-42896485 TGGTAAATGGAGAGAGAGGCAGG + Intergenic
989626035 5:43430266-43430288 TGGAAGATGGACAGGGAGACAGG - Intergenic
991017408 5:61946557-61946579 CAGAACTTGGAGAGGGAAGATGG + Intergenic
991469397 5:66951982-66952004 CGGAACATGGAGAGAGACGAAGG - Intronic
991559534 5:67934922-67934944 GGGAACATGGGAAGGGAGCCAGG + Intergenic
992089490 5:73304316-73304338 GGGAAGATGGAGGGGGAGGAAGG + Intergenic
993177359 5:84503708-84503730 CAGGATTTGGAGAGGGAGGCTGG + Intergenic
994001660 5:94788677-94788699 CTAAACATGGGGAGGGAGGGAGG - Intronic
995725816 5:115179662-115179684 CGGAAGATGGAGAGGAGGGCGGG - Intronic
996384409 5:122895698-122895720 AGGAACATGGTGAGGGTGGCAGG - Intronic
996423315 5:123285762-123285784 GGGAAGAGGGAGAGGGAGTCGGG - Intergenic
996519734 5:124413555-124413577 TGGAGCATGGAGAAGAAGGCAGG + Intergenic
997713142 5:136022857-136022879 GGGAAGCTGGAGAGGGAGCCAGG + Intergenic
997813844 5:136997396-136997418 GGGAACATGGCGGGGGAGGGAGG - Intronic
997999766 5:138615694-138615716 AGGAGGATAGAGAGGGAGGCTGG + Intronic
998880299 5:146638437-146638459 AGGAACCAGGAGAAGGAGGCAGG + Intronic
999708875 5:154298743-154298765 CTGAAAATGTACAGGGAGGCAGG - Intronic
1000056198 5:157608742-157608764 CGGAGCATGGAGAGAGGGCCTGG + Intergenic
1001383828 5:171321647-171321669 TGGTGCAGGGAGAGGGAGGCCGG - Intergenic
1002294740 5:178224076-178224098 CTGATCCTGGAGAGGCAGGCAGG - Intronic
1002886082 6:1295505-1295527 AGGAGCAGGGAGAGGAAGGCAGG - Intergenic
1003085004 6:3053843-3053865 CGGAGCTTGGAGCCGGAGGCGGG - Intergenic
1004135726 6:12964443-12964465 GGGAACAGAAAGAGGGAGGCAGG + Intronic
1005689280 6:28286647-28286669 AGGAAGATGGAGAGAGAGACAGG - Intronic
1005836967 6:29717718-29717740 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005836973 6:29717737-29717759 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005836979 6:29717756-29717778 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005836985 6:29717775-29717797 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005836991 6:29717794-29717816 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005836997 6:29717813-29717835 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005837014 6:29717864-29717886 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005837020 6:29717883-29717905 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005837026 6:29717902-29717924 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005990228 6:30897756-30897778 AGGAACATGGACAGAAAGGCTGG + Intronic
1005996116 6:30932386-30932408 AGGGAAATGGAGAGGGAAGCGGG + Intergenic
1006295137 6:33166895-33166917 GAGGACATGGAGAGGGAGCCGGG + Intronic
1006510277 6:34517628-34517650 AGGAAGGTGGAGAGGGAGCCAGG - Intronic
1006931716 6:37692690-37692712 TGGAACATGGAGGGACAGGCTGG - Intronic
1008926791 6:56896008-56896030 CGGGAGAGGGAGAGGGAGACGGG + Intronic
1008926797 6:56896027-56896049 CGGGAGAGGGAGAGGGAGACGGG + Intronic
1008926803 6:56896046-56896068 CGGGAGAGGGAGAGGGAGACGGG + Intronic
1008926809 6:56896065-56896087 CGGGAGAGGGAGAGGGAGACGGG + Intronic
1008926815 6:56896084-56896106 CGGGAGAGGGAGAGGGAGACGGG + Intronic
1008926821 6:56896103-56896125 CGGGAGAGGGAGAGGGAGACGGG + Intronic
1008926827 6:56896122-56896144 CGGGAGAGGGAGAGGGAGACGGG + Intronic
1010800481 6:80168725-80168747 AGGAAGAGGGGGAGGGAGGCAGG + Intronic
1011227860 6:85127409-85127431 AGCAAGGTGGAGAGGGAGGCAGG + Intergenic
1013425577 6:110009682-110009704 CTAAACATAGAGAGGAAGGCTGG - Intergenic
1013968358 6:115983791-115983813 TGGAAGATGGACAGTGAGGCTGG - Intronic
1014764414 6:125390118-125390140 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1014764420 6:125390137-125390159 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1014764426 6:125390156-125390178 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1014764432 6:125390175-125390197 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1014943465 6:127470340-127470362 CCCCACATGTAGAGGGAGGCAGG - Intronic
1017345071 6:153370388-153370410 CGGAACATTGAGAGGGAACACGG + Intergenic
1017919336 6:158857649-158857671 AAGTACATGGTGAGGGAGGCAGG - Intergenic
1018618331 6:165708670-165708692 AGGAGCATGGAGAGGGAGAGTGG - Intronic
1018948439 6:168363334-168363356 AGGAAGATGGAGGGGGAGGGGGG + Intergenic
1019117338 6:169775546-169775568 CTGAACATGGAACGAGAGGCAGG + Intronic
1019404821 7:877705-877727 GAGAACAGGGAGGGGGAGGCCGG - Intronic
1019911068 7:4100789-4100811 CTGGGCCTGGAGAGGGAGGCTGG + Intronic
1020007738 7:4791347-4791369 CGGCTGGTGGAGAGGGAGGCCGG + Exonic
1020969212 7:14913087-14913109 TGGAACATTGTGAGTGAGGCTGG - Intronic
1021446931 7:20743972-20743994 AGGAGCTTGGAGTGGGAGGCAGG - Intronic
1021626778 7:22601399-22601421 TGGAAGATGGGGAGGGAGGATGG + Intronic
1022181631 7:27926109-27926131 CTCAAGATGGAGAGGAAGGCTGG + Intronic
1022597980 7:31731020-31731042 CAAATCATGGAGAGGGGGGCGGG + Intergenic
1023727786 7:43162422-43162444 CAGACCATGGAGATGGAGGTTGG - Intronic
1025607103 7:63047354-63047376 CTGAAGATGGTGAGGGAGGTTGG - Intergenic
1026360945 7:69600029-69600051 CGGAGCGCGGCGAGGGAGGCAGG - Intronic
1027059334 7:75073343-75073365 CCGAACAGGTCGAGGGAGGCCGG + Intronic
1028792186 7:94865537-94865559 GGGAGCAAGGAGGGGGAGGCGGG - Intergenic
1028966775 7:96810806-96810828 CGGAATTTGAAAAGGGAGGCCGG - Intergenic
1029315631 7:99710700-99710722 CAGTACATGGAGAAGGAGGGAGG - Intronic
1029321385 7:99763823-99763845 TGGTACATGGAGAAGGAGGGAGG - Intronic
1032305856 7:130732647-130732669 CGGACCTTGGAGAGGGTGTCAGG - Exonic
1033255613 7:139798985-139799007 CGGCAGGTGGAGAAGGAGGCTGG - Intronic
1033356872 7:140607282-140607304 GGGAACAAGGAGAGGAAGGGAGG + Intronic
1033532007 7:142273655-142273677 TGGAACAAGTAGAGGGATGCTGG - Intergenic
1035352060 7:158253982-158254004 CTGAACGTGGAGATGGAGGGCGG - Intronic
1035352074 7:158254056-158254078 CTGAACGTGGAGATGGAGGGCGG - Intronic
1035352088 7:158254130-158254152 CTGAACGTGGAGATGGAGGGCGG - Intronic
1035352120 7:158254281-158254303 CTGAACGTGGAGATGGAGGGCGG - Intronic
1035352135 7:158254355-158254377 CTGAACGTGGAGATGGAGGGCGG - Intronic
1035352167 7:158254503-158254525 CTGAACGTGGAGATGGAGGGCGG - Intronic
1035352196 7:158254651-158254673 CTGAACGTGGAGATGGAGGGCGG - Intronic
1035555519 8:564619-564641 TGGAACACAGGGAGGGAGGCGGG - Intergenic
1035868184 8:3108100-3108122 CTGCACATGGACAGGGAGCCAGG - Intronic
1036777830 8:11625671-11625693 CTGAAGACGGTGAGGGAGGCTGG + Intergenic
1038611775 8:29065577-29065599 CTGAGAAGGGAGAGGGAGGCCGG - Intergenic
1040053033 8:43033995-43034017 AGGGACAGGGAGAGGGAGACGGG + Intronic
1041357859 8:57021180-57021202 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1041357865 8:57021199-57021221 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG + Intergenic
1044908488 8:97030860-97030882 AGGAAAATGGAGAGGGAGGGAGG + Intronic
1044946701 8:97396294-97396316 CAGAAGATGGGGAGGGAAGCGGG - Intergenic
1045367880 8:101493436-101493458 CGGACCCGGGGGAGGGAGGCGGG - Intronic
1047192812 8:122693676-122693698 CTGAACATAGAGAGGCAGGAAGG + Intergenic
1047756611 8:127923747-127923769 GGGCACATGGAGAAGGAGGAAGG + Intergenic
1048282313 8:133114417-133114439 CAGTACTAGGAGAGGGAGGCAGG - Intronic
1048456623 8:134584289-134584311 GGGAACATTGATAGGGAGGCAGG - Intronic
1048651972 8:136487869-136487891 CAGAACATGAAGTGGGAGGTGGG + Intergenic
1049183474 8:141235635-141235657 CGGAAGAGGGAGAGAGGGGCAGG + Intronic
1049212644 8:141393747-141393769 CAGAACATGGTGAGGGTGGCTGG + Intronic
1049415204 8:142491881-142491903 CCTGACAGGGAGAGGGAGGCAGG + Intronic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051504748 9:17814584-17814606 CTGAAAAGGAAGAGGGAGGCAGG + Intergenic
1051745520 9:20291558-20291580 AGACACATGGAGAGGGAGTCAGG - Intergenic
1051896717 9:21995519-21995541 GGGGACATGGAGGGGGAGACCGG - Intronic
1052994524 9:34544124-34544146 CAGAAGAGGGAGAGGAAGGCAGG + Intergenic
1053284070 9:36839260-36839282 GGGAACTTGGAGAGGGAGCTTGG - Exonic
1056986951 9:91372090-91372112 GAGAACATGAACAGGGAGGCAGG - Intergenic
1057226602 9:93296294-93296316 GGGAAGATGGAGGGGGAGGAAGG - Intronic
1057392658 9:94652596-94652618 CTGAATATGGAGCGGGGGGCGGG - Intergenic
1057750660 9:97790190-97790212 AGGAACAAGGAGAGCGAAGCAGG + Intergenic
1057791496 9:98127866-98127888 GGGAACAGGGACAGGGAGTCTGG + Intronic
1057831273 9:98409125-98409147 CGGAACACAGTGAGGGAGGCAGG + Intronic
1057911581 9:99023906-99023928 AGTAGCCTGGAGAGGGAGGCAGG - Intronic
1058815923 9:108682820-108682842 GAGATCATGGAGAGGGAGGTGGG - Intergenic
1058947770 9:109875072-109875094 CTGAAGATGGAGAAGAAGGCAGG - Intronic
1060354714 9:122894581-122894603 AAGAACATGAAGAGAGAGGCTGG + Intronic
1060718353 9:125955535-125955557 TGGTCCAGGGAGAGGGAGGCAGG + Intronic
1061777911 9:132978090-132978112 CTGAACTTGGGGAGGGAGGGAGG + Intronic
1062008007 9:134251255-134251277 AGAAACTTGGAGAGGGAGGATGG - Intergenic
1062131589 9:134897185-134897207 CTGGAGATGGAGTGGGAGGCAGG - Intergenic
1062287526 9:135779645-135779667 TGGAACCAGGAGATGGAGGCAGG + Intronic
1185485831 X:481466-481488 CGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485863 X:481580-481602 CGGAGGAAGGAGAGGGAGGGAGG + Intergenic
1185485880 X:481635-481657 CGGAGGAAGGAGAGGGAGGGAGG + Intergenic
1185485896 X:481690-481712 CGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485972 X:481949-481971 CGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185707216 X:2276829-2276851 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707235 X:2276915-2276937 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707253 X:2277005-2277027 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707273 X:2277093-2277115 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707290 X:2277182-2277204 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707308 X:2277271-2277293 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707326 X:2277362-2277384 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707345 X:2277450-2277472 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707363 X:2277541-2277563 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707382 X:2277630-2277652 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707401 X:2277719-2277741 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707440 X:2277897-2277919 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707636 X:2278785-2278807 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707655 X:2278874-2278896 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707674 X:2278963-2278985 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707713 X:2279141-2279163 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707732 X:2279230-2279252 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707808 X:2279580-2279602 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707963 X:2280284-2280306 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185707982 X:2280373-2280395 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185708001 X:2280462-2280484 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185708040 X:2280640-2280662 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185708059 X:2280729-2280751 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185708135 X:2281079-2281101 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185708191 X:2281340-2281362 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185708405 X:2282310-2282332 GGGAACAGGGAGAGAGAGGGAGG + Intronic
1185794118 X:2950151-2950173 GGAAACATGGAGATGGAGACTGG - Intronic
1187289591 X:17940310-17940332 ATGAGCCTGGAGAGGGAGGCAGG + Intergenic
1187364074 X:18652093-18652115 GGGAGAATGGGGAGGGAGGCAGG - Intronic
1190287728 X:48971875-48971897 CGGGAGATGGAGAGGCAGGGAGG + Intergenic
1190739468 X:53279881-53279903 AGGAAGATGGAGAGAGAGGAAGG + Intronic
1192106771 X:68325616-68325638 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1192537321 X:71939218-71939240 CGGAGCCTAGAGAGGCAGGCAGG + Intergenic
1192884938 X:75326883-75326905 GGAAACATGGAGAGGGAAACTGG - Intergenic
1195882009 X:109602203-109602225 GGGAACATGGTGAGGGGGGAGGG - Intergenic
1196764796 X:119233483-119233505 GGGAACTTGGAGAGGGAGAAAGG + Intergenic
1196769799 X:119282107-119282129 AAGAAAATGGAGAGGGAGGCCGG - Intergenic
1196881367 X:120200902-120200924 TGGAGCTTGGAGAGGGGGGCTGG - Intergenic
1197644580 X:129004023-129004045 TGGAGCATGGAGAGGGAGGGGGG - Intergenic
1197967111 X:132076895-132076917 CAGAACATGGAAAAGGAGGGAGG - Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic