ID: 956632590

View in Genome Browser
Species Human (GRCh38)
Location 3:71331229-71331251
Sequence GCCAGCTGGCCCGCAAGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 6, 3: 41, 4: 189}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956632587_956632590 -9 Left 956632587 3:71331215-71331237 CCGCACTTGGAGTGGCCAGCTGG 0: 2
1: 18
2: 39
3: 141
4: 473
Right 956632590 3:71331229-71331251 GCCAGCTGGCCCGCAAGCCTGGG 0: 1
1: 0
2: 6
3: 41
4: 189
956632578_956632590 27 Left 956632578 3:71331179-71331201 CCAGCGCGAGTTCTGGGGTGAGT 0: 1
1: 0
2: 1
3: 4
4: 68
Right 956632590 3:71331229-71331251 GCCAGCTGGCCCGCAAGCCTGGG 0: 1
1: 0
2: 6
3: 41
4: 189
956632586_956632590 -8 Left 956632586 3:71331214-71331236 CCCGCACTTGGAGTGGCCAGCTG 0: 1
1: 14
2: 46
3: 190
4: 768
Right 956632590 3:71331229-71331251 GCCAGCTGGCCCGCAAGCCTGGG 0: 1
1: 0
2: 6
3: 41
4: 189
956632585_956632590 -7 Left 956632585 3:71331213-71331235 CCCCGCACTTGGAGTGGCCAGCT 0: 1
1: 11
2: 32
3: 145
4: 533
Right 956632590 3:71331229-71331251 GCCAGCTGGCCCGCAAGCCTGGG 0: 1
1: 0
2: 6
3: 41
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956632590 Original CRISPR GCCAGCTGGCCCGCAAGCCT GGG Intronic
900411037 1:2512811-2512833 ACCTCCTTGCCCGCAAGCCTGGG + Intronic
903928750 1:26850167-26850189 ACCAGCTGGCTCCCAGGCCTTGG - Intronic
904775665 1:32904676-32904698 GCCAGCTACCTGGCAAGCCTTGG + Intergenic
905150258 1:35921543-35921565 TCCAGCTGGCCTCCAAGCCTGGG - Exonic
905179228 1:36156245-36156267 GGCAGGTGGCCCGCGAGTCTCGG - Exonic
906280395 1:44549522-44549544 GCCAGCAGGTCCTGAAGCCTTGG + Intronic
907371159 1:54004489-54004511 GCCAGCCAGCCCACAAGCCCGGG - Intergenic
910088871 1:83437932-83437954 GCCAGATGGCCCTCACACCTTGG + Intergenic
911001446 1:93170364-93170386 GCCGGCCGGCCTGCAAGCCCTGG + Intronic
916606053 1:166343296-166343318 GCCGGCTGGCCTGCAAGCCCCGG - Intergenic
916773351 1:167935802-167935824 GGTAGGTGGCCCGCAGGCCTCGG + Exonic
917135425 1:171784356-171784378 GCCAGCTGCGCCGCAAGGCCAGG + Exonic
917788945 1:178487237-178487259 CCCAGGTGGCCAGCGAGCCTGGG + Intergenic
919914508 1:202131101-202131123 GCCAACCCCCCCGCAAGCCTGGG - Exonic
920129865 1:203723812-203723834 GGCAGCTGGCCCTCCAGCCAAGG - Intronic
921622812 1:217344626-217344648 GCCATCTTTCCCGCAAGGCTTGG - Intergenic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
923552364 1:234974036-234974058 GCCAGCTGGAGTCCAAGCCTTGG + Intergenic
924775405 1:247112133-247112155 GCCAGCGGCCTCCCAAGCCTGGG - Exonic
1063309317 10:4937646-4937668 GCCCCCCGGCCCGCAAGCCCCGG - Intronic
1064090343 10:12378027-12378049 GTGAGCTGGGCCGCATGCCTGGG - Intronic
1068373990 10:56155153-56155175 TCCAGCTGGCCAGCAAGCGCCGG - Intergenic
1069855753 10:71440090-71440112 ACCAGCTGTCCCCAAAGCCTGGG + Intronic
1071055688 10:81505923-81505945 GCCAGCCGGCCCGCAAGCCCTGG + Intergenic
1072664029 10:97381006-97381028 GCTAGCTGGCCAGCAAGAATGGG + Intronic
1073063953 10:100747770-100747792 GCGAGCGGGCCGGAAAGCCTCGG + Intronic
1073124221 10:101139912-101139934 CCAAGCTGGCTCCCAAGCCTGGG + Intergenic
1077364970 11:2157993-2158015 GCCAGCTGCCCTGCAAGTCCTGG + Intronic
1079296796 11:19241552-19241574 GCCAGCCGGCCCGCCAGTCCCGG - Exonic
1081643514 11:44774406-44774428 GGCAGGTGGCCCACAGGCCTGGG + Intronic
1082261517 11:50079059-50079081 GCCAGCTGAGTCACAAGCCTTGG - Intergenic
1083008275 11:59368938-59368960 TCCAGCTGTCCTGTAAGCCTAGG + Intergenic
1085245571 11:75098237-75098259 TCCAGCTGGCCTGCAAGCGCAGG - Intergenic
1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG + Intergenic
1087130384 11:94664575-94664597 GCCACCTGGCCTGGAAGGCTAGG - Intergenic
1088720145 11:112585017-112585039 GCCAGGTGGCCTCCAGGCCTAGG + Intergenic
1089176393 11:116551877-116551899 GCCAGCTGGCTCTCTTGCCTGGG + Intergenic
1089584786 11:119503339-119503361 GCCAGCTGACCCCCAAACATAGG - Intergenic
1091447820 12:554030-554052 GCCAGCTGGCCTGGAAGGCAGGG + Intronic
1091936922 12:4441940-4441962 GACAGCTGTGCCCCAAGCCTGGG - Intronic
1094825312 12:34264840-34264862 GCCAGCCTGCCCGCTTGCCTAGG - Intergenic
1095396829 12:41771586-41771608 GCCAGCTGGCAAGCTAGTCTAGG - Intergenic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1095587382 12:43863930-43863952 TCTAGCTGGCCCGCAAGCGCCGG - Intronic
1096501100 12:52064212-52064234 GCCTGCTGACCCTCCAGCCTGGG - Intergenic
1096801324 12:54112537-54112559 CCCAGATGGCGGGCAAGCCTGGG + Intergenic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1099436813 12:82655925-82655947 GCCAGCTGGTCAGCAAGCCTGGG - Intergenic
1100536766 12:95518895-95518917 CGCAGCTTGCCCTCAAGCCTGGG + Intronic
1101588588 12:106106992-106107014 GCCAGCTCTGCCTCAAGCCTCGG + Intronic
1101961754 12:109256096-109256118 GCCACCTGGCCCTCCAGCCTGGG + Intronic
1108259998 13:48646688-48646710 CCCAGTGGGCCCGCAAGCCTGGG + Intergenic
1113126743 13:106987601-106987623 GCCAGCTGGCCGGCACACCCCGG - Intergenic
1113664027 13:112128421-112128443 GCCCGCTGGCCAGCAATCCGGGG - Intergenic
1113787257 13:113008964-113008986 GCCCGCCCGCCCGCAAGCCCTGG - Intronic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1116900948 14:50362023-50362045 GCCCCCTGGCCCACAAGCCCCGG + Intronic
1117828551 14:59727542-59727564 GCCAGCTGGCCCACCGGCCGTGG + Exonic
1119303685 14:73590698-73590720 GCCGGCCGGCCCGCAAGCCCCGG - Intergenic
1119338127 14:73851858-73851880 CCCAGCTCGCCCCCAGGCCTCGG - Exonic
1121632547 14:95431871-95431893 GCCAGCCTCCCCCCAAGCCTGGG + Intronic
1121843747 14:97155569-97155591 GCCAGGTGGCCAGAAAGCCTGGG - Intergenic
1122399454 14:101458393-101458415 GCCCGCCGGCCCGCCCGCCTGGG - Intergenic
1122904252 14:104794874-104794896 CCCAGCTGCCCTCCAAGCCTTGG + Intronic
1123028676 14:105440404-105440426 GCCAGCTGGCAGGCAACCCGGGG + Intronic
1124198591 15:27656668-27656690 GCCAGTGGGCCCACAAGCCCCGG - Intergenic
1124464660 15:29925991-29926013 TCCTGGTGGCCAGCAAGCCTTGG + Intronic
1127426694 15:58865221-58865243 GCCAGCCGACACGCAGGCCTGGG + Intronic
1127888117 15:63222024-63222046 GCTAGCTGACCCAGAAGCCTGGG - Intronic
1128147093 15:65337755-65337777 GACAGCTGACCCGGGAGCCTGGG - Intronic
1129190408 15:73934130-73934152 TCCAGCTGGCCCACAAGCAGGGG - Intronic
1129196926 15:73973849-73973871 GCCGGCCGGCCCGCAAGCCCCGG + Intergenic
1131250245 15:90825610-90825632 GCCGGCCAGCCCGCAAGCCCGGG + Intergenic
1132679367 16:1133440-1133462 GCTAGCAGGCCCGCAGGGCTGGG - Intergenic
1133216232 16:4294151-4294173 TACAGCTGGCCCTCCAGCCTCGG + Intergenic
1138019301 16:53463072-53463094 GTCAGGTGGTCCGCATGCCTTGG + Intronic
1141704265 16:85655968-85655990 GGCAGCTGGGCAGAAAGCCTGGG + Intronic
1142008440 16:87701478-87701500 GCCAGCTTGTTCCCAAGCCTAGG + Intronic
1142742633 17:1940048-1940070 GCCTGCTGGGCCGTGAGCCTGGG - Intronic
1143208771 17:5167292-5167314 GTGAGCTGGCCCTCAAGCCAGGG - Intronic
1143798305 17:9356549-9356571 GCCAGCTGGCAGGGGAGCCTGGG - Intronic
1144618098 17:16795403-16795425 GTGAGCTGGCCCTCAAGCCAGGG - Intronic
1144894606 17:18520288-18520310 GTGAGCTGGCCCTCAAGCCAGGG + Intergenic
1145049116 17:19646091-19646113 GCCAGCGGGCACGAGAGCCTGGG + Intergenic
1146798747 17:35801702-35801724 GGCATCTGGCCTGAAAGCCTGGG + Intronic
1148023364 17:44568314-44568336 GCCAGCCAGCCCGCAAGCCCCGG + Intergenic
1149871518 17:60186269-60186291 GTGAGCTGGCCCTCAAGCCAGGG + Intronic
1150321527 17:64218352-64218374 GCCACCTTGCCCTCAAGCATTGG + Intronic
1151354620 17:73551015-73551037 GCCAGCTGACCGGGGAGCCTGGG + Intronic
1152292955 17:79451024-79451046 GCCATCGGGCCCCCCAGCCTGGG - Intronic
1153070364 18:1098322-1098344 GCTGGCCGGCCCGCCAGCCTCGG + Intergenic
1153743656 18:8154518-8154540 GCCAGCTCGCCTGCTAGCTTGGG + Intronic
1156610504 18:38718648-38718670 GCCCGCCAGCCCGCAAGCCCTGG - Intergenic
1156969659 18:43139619-43139641 GCCAGCTGGCCCCCCAGCCCCGG + Intergenic
1158120603 18:54044013-54044035 TCCAGCTGGTACTCAAGCCTGGG - Intergenic
1158546610 18:58403179-58403201 CCCAGCTGGGCTGCAAGTCTCGG + Intergenic
1159322214 18:66866802-66866824 GCGGGCCGGCCCGCAAGCCCGGG + Intergenic
1160424624 18:78771489-78771511 GGCAGCTGCCTCGAAAGCCTCGG - Intergenic
1160432472 18:78821281-78821303 GCCAGCGGGCCAGCAAAGCTCGG + Intergenic
1160529477 18:79555187-79555209 CCCTGCTGGTCCGCACGCCTTGG - Intergenic
1160904191 19:1444919-1444941 GGCAGCTGACCCGCAAGCGCCGG - Intergenic
1160932535 19:1577428-1577450 GCCAGCCGGCCCCCCTGCCTCGG - Exonic
1161314813 19:3612852-3612874 GCCAGTGGGCCAGCAAGCCCAGG + Intronic
1163584253 19:18155521-18155543 GCCAGCAGAGCCGCCAGCCTTGG + Exonic
1164562037 19:29299246-29299268 GCCAGCTGGCCTGAGGGCCTGGG - Intergenic
926136410 2:10339836-10339858 CCCAGGAGGCCCACAAGCCTGGG - Intronic
928106086 2:28471484-28471506 GCCAGCTGGACCTTCAGCCTGGG - Intronic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
931441542 2:62293831-62293853 GCCAGCTGGCACGAAGGCCAAGG + Intergenic
933060846 2:77735002-77735024 GCCGGCCGGCCCGCAAGCCCTGG - Intergenic
933506315 2:83181140-83181162 GCCAGCCGGCCTGCAAGCCCCGG + Intergenic
936894299 2:117409076-117409098 TTAAGCTGGCCCGGAAGCCTAGG - Intergenic
937299153 2:120828227-120828249 GCCACCTGGCCCGGGGGCCTTGG - Intronic
938292058 2:130155622-130155644 GCCAGGTGCCACGGAAGCCTGGG + Intronic
938403240 2:131011700-131011722 GCCAGATGGGCAGCAAGCTTTGG + Intronic
938464491 2:131517345-131517367 GCCAGGTGCCACGGAAGCCTGGG - Intergenic
940112660 2:150171290-150171312 GCCGGCCGGCCCGGAAGCCCCGG - Intergenic
941178861 2:162234890-162234912 TCTAGCTGGCCGGCAAGCGTGGG - Intronic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
943520634 2:188944688-188944710 GCCGGCTGGCCCGCCAGCCTCGG - Intergenic
944482793 2:200174880-200174902 GCCGGCCGGCCGGCAAGCCCGGG + Intergenic
945069632 2:205977324-205977346 GCCGGCAGGCCCGCAAGCCCTGG + Intergenic
945401382 2:209387476-209387498 GCCAGCCGGCCGGCAAGCCCCGG + Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
948620608 2:239232117-239232139 GCCAGCTCGACCTCCAGCCTTGG + Intronic
1171795362 20:29561929-29561951 CCCAGATGGCAGGCAAGCCTGGG - Intergenic
1171853090 20:30322336-30322358 CCCAGATGGCAGGCAAGCCTGGG + Intergenic
1173502762 20:43565877-43565899 GGCAGCTGCCCTGGAAGCCTTGG - Exonic
1174171518 20:48620612-48620634 GGCAGGAGGCCCGCAAGGCTAGG + Intergenic
1174354353 20:49988284-49988306 GGCAGCTGGCCCCCAGCCCTGGG + Exonic
1174842352 20:53912147-53912169 GCCAACTGGCCTGCAGGCCCAGG - Intergenic
1176296287 21:5075232-5075254 CCCGGGTGGCCCGCCAGCCTCGG + Intergenic
1178280091 21:31274628-31274650 GCCAGCTGACCCACAGGGCTGGG - Intronic
1179860762 21:44186889-44186911 CCCGGGTGGCCCGCCAGCCTCGG - Intergenic
1179925532 21:44532080-44532102 GGCTGCTGGCCCCCAAGCCCTGG + Intronic
1181097843 22:20518230-20518252 GTCACCAGGCACGCAAGCCTGGG - Intronic
1185105511 22:48867357-48867379 GCCAGCTGGGCAGCATGCCGGGG - Intergenic
1185301243 22:50082174-50082196 CCCCTCTGGCCCGCAAGCCGCGG - Intronic
1185301254 22:50082205-50082227 CCCCTCTGGCCCGCAAGCCGCGG - Intronic
1185330811 22:50251352-50251374 ACCAGCGGGCGCGGAAGCCTCGG + Exonic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
950202691 3:11056349-11056371 GCCAGCTTGAGCTCAAGCCTTGG + Intergenic
950633533 3:14299470-14299492 CCCAGCTAGCCAGCCAGCCTGGG - Intergenic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
954340091 3:49946471-49946493 GTCAGGTGACCCGCCAGCCTTGG + Intronic
954640232 3:52093455-52093477 TCCCCCTGGCCCCCAAGCCTTGG + Intronic
954661546 3:52229376-52229398 GCCTGCTGCCCTGCATGCCTTGG + Intronic
956632590 3:71331229-71331251 GCCAGCTGGCCCGCAAGCCTGGG + Intronic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
960338322 3:116445413-116445435 GCCCGCCCGCCCGCCAGCCTGGG - Exonic
960868602 3:122227440-122227462 GCTGGCTGGCCCGCAAGCCCCGG - Intronic
961465054 3:127076504-127076526 GCTGGCTGGCCCACAAGCCCCGG - Intergenic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
964375043 3:156041416-156041438 GCCAGCCGGCCTGCAAGCCCCGG + Intronic
966076051 3:175937471-175937493 GCCAGCTGCCCTGCCAGCCCCGG + Intergenic
967941101 3:194767437-194767459 GCCAACTAGCCCCCCAGCCTCGG - Intergenic
969423648 4:7111348-7111370 GGCAGCTGGCCCACCAGCCTTGG - Intergenic
969868636 4:10091592-10091614 GGCAGCTGCTCAGCAAGCCTGGG + Intronic
970108306 4:12609729-12609751 GCCGGCAGGCCTGCAAGCCCCGG + Intergenic
970508041 4:16752938-16752960 GCCAGCTGGCCCTGCAGACTTGG - Intronic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
986772961 5:10990014-10990036 GCCAGCTGGCCAGAAGTCCTGGG + Intronic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
987196400 5:15530810-15530832 CCCAGCTGGCCCCAAAGCATGGG - Intronic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
994613699 5:102077796-102077818 GCCAGCTTGCCATAAAGCCTTGG + Intergenic
995112385 5:108442301-108442323 GCCAGCCGGCCCGCAAGCCCCGG - Intergenic
1000889327 5:166784760-166784782 GCTGGCAGGCCCGCAAGCCCAGG - Intergenic
1001134388 5:169090369-169090391 GCCAGCTGACATGCAAGCCTGGG + Intronic
1001990869 5:176114441-176114463 GCCTGCTGGCCTGCAATACTGGG - Exonic
1001999547 5:176189988-176190010 GGCAACTGGCCAGCAAGCCCAGG + Intergenic
1002226005 5:177723699-177723721 GCCTGCTGGCCTGCAATACTGGG + Exonic
1002267842 5:178047511-178047533 GCCTGCTGGCCCGCAATACTGGG - Exonic
1002649620 5:180681918-180681940 GGCAACTGGCCAGCAAGCCCAGG - Intergenic
1002697407 5:181100201-181100223 TCCAGATGGCCTGCAAGCCCTGG - Intergenic
1002790740 6:435800-435822 GCCAGTTGGCCCGCAAGTCCCGG - Intergenic
1003178473 6:3771735-3771757 GCTGGCTGGCCCGCAAGCCCCGG + Intergenic
1004250306 6:14018133-14018155 GCCGGCCGGCCCGCAAGCCCCGG + Intergenic
1004338227 6:14783826-14783848 GCCGGCCGGCCCGCAAGCCCCGG - Intergenic
1005005074 6:21279772-21279794 GCCAGATGGCCCGAGAGCCGGGG - Intergenic
1006127954 6:31852154-31852176 GCAGGCTGGCCCACAAGCCCCGG + Intergenic
1006996619 6:38267139-38267161 GCCAGCTGGACCTGATGCCTGGG - Intronic
1009461872 6:63922873-63922895 GTCAGCTGGCTCCCAATCCTGGG - Intronic
1012733545 6:102910904-102910926 GCCGGCGGGCCCGCAAGCCCGGG - Intergenic
1012945039 6:105456280-105456302 GCCAACTGGCATGCAAACCTTGG - Intergenic
1013232476 6:108170027-108170049 GCAAGCTCGCCCGGACGCCTCGG + Intronic
1019589777 7:1825216-1825238 TCCACCTGGCCTGCAACCCTCGG + Intronic
1023292004 7:38678523-38678545 GCCCACTGGCCCACCAGCCTTGG - Intergenic
1023396236 7:39754267-39754289 TCTAGCTGGCCTGCAAGCCCCGG + Intergenic
1024251678 7:47510180-47510202 GCCAGCAGGCCCACAAGCTATGG + Intronic
1024262424 7:47582216-47582238 GCCAGGTGACCCGCCAGGCTCGG - Intronic
1027305723 7:76894368-76894390 GCCAGATGGCCCTCACACCTTGG + Intergenic
1027778947 7:82499711-82499733 ACCGGCCGGCCCGCAAGCCCCGG + Intergenic
1031187254 7:118498448-118498470 GTCAGCTGATCCACAAGCCTCGG + Intergenic
1033273893 7:139956778-139956800 GCCACCTGCCCCACAGGCCTGGG - Intronic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1035833902 8:2727933-2727955 GCAGGCCGGCCCGCAAGCCCCGG + Intergenic
1037590918 8:20311312-20311334 GCCAGCAGGACCCCAAGCCCAGG - Intergenic
1039579336 8:38651114-38651136 CCGAGCTGGGCCCCAAGCCTCGG + Intergenic
1040323946 8:46331831-46331853 GCCAGCTGACCCACCAGCCCCGG + Intergenic
1043705726 8:83347571-83347593 GCTAGCTGGCCTCCAAGCCCTGG + Intergenic
1046288872 8:112132724-112132746 TCCAGCTGGCCTGCAAGCGCCGG - Intergenic
1047424378 8:124731841-124731863 ACCAGCTGTCCCCCAGGCCTAGG - Intergenic
1049369559 8:142257366-142257388 GCCAGCTGTCCAGTATGCCTCGG - Intronic
1049454237 8:142678897-142678919 GCCAGCTGGCATGAGAGCCTGGG + Intronic
1051419721 9:16877316-16877338 GCCAGCAGGCCAGCAAGCCCCGG - Intergenic
1053015314 9:34658572-34658594 TCCAGCTGGCTCGCAGGCGTCGG - Exonic
1053475233 9:38377674-38377696 GCCCCGTGGCCCGCAAGCCCCGG + Intergenic
1053790888 9:41685635-41685657 CCCAGATGGCAGGCAAGCCTGGG + Intergenic
1054154266 9:61629137-61629159 CCCAGATGGCAGGCAAGCCTGGG - Intergenic
1054179235 9:61897329-61897351 CCCAGATGGCAGGCAAGCCTGGG + Intergenic
1054474051 9:65560257-65560279 CCCAGATGGCAGGCAAGCCTGGG - Intergenic
1054658303 9:67683492-67683514 CCCAGATGGCAGGCAAGCCTGGG - Intergenic
1056968897 9:91186569-91186591 GCCAGGTGGCCCTCAATGCTGGG + Intergenic
1057828098 9:98386594-98386616 TCCAGCTGCCCAGCAAGCCAGGG + Intronic
1059167990 9:112097280-112097302 GGCACCTGGCCCTCCAGCCTGGG + Intronic
1059454114 9:114388894-114388916 GCCAGGTGGCACTGAAGCCTGGG + Intronic
1060586078 9:124786872-124786894 GCCAGCTGGCCAGCCAGCCTTGG - Intronic
1060982738 9:127803074-127803096 GCCAGCGGGCCAGCGGGCCTGGG + Intronic
1061664986 9:132155411-132155433 GTCACCTGGCCATCAAGCCTGGG - Intergenic
1061802738 9:133121113-133121135 GCCAGCAGGCCCGGCCGCCTCGG + Exonic
1062080278 9:134620073-134620095 GCCAGCTGGCCGGGAAACCCTGG - Intergenic
1062252107 9:135603392-135603414 GCCACATGGCCCCCGAGCCTGGG - Intergenic
1062473212 9:136715171-136715193 GGAAGCTGGCCCCCAAGCCTGGG + Intronic
1062482401 9:136758588-136758610 GCCAGGCGGGCTGCAAGCCTGGG - Intergenic
1062707505 9:137953588-137953610 GCCAGCTACCCCGCCAGGCTAGG - Intronic
1185835547 X:3343678-3343700 GCCAGCGGGCACGGAAGCCAGGG + Exonic
1187269779 X:17769208-17769230 GCTAGCTGGTCCCCAAGGCTTGG + Intergenic
1192251386 X:69416865-69416887 GCCGGCTGGCCCGCAAGCCCCGG + Intergenic
1194025600 X:88746590-88746612 GCCGGCTGGCCTGCAAGCCCCGG - Intergenic
1194890496 X:99372299-99372321 GCAGGCCGGCCCGCAAGCCCCGG - Intergenic
1196682642 X:118484424-118484446 GCCAGATAGCCAGCATGCCTGGG - Intergenic
1197607910 X:128606702-128606724 GCCGGCGGGCCCGCCAGCCCTGG + Intergenic
1199285109 X:146046419-146046441 GCCGGCGGGCCCGCAGGCCCCGG - Intergenic
1199615620 X:149652699-149652721 GACATCCGGCCCCCAAGCCTGGG + Intergenic
1200283617 X:154800120-154800142 GACAGCTGCCCAGCAAGCCCTGG + Intronic
1201469098 Y:14314588-14314610 GCCGACTGGCCCACAAGCCCCGG + Intergenic