ID: 956633482

View in Genome Browser
Species Human (GRCh38)
Location 3:71339381-71339403
Sequence GGAATGATAATGTACCTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 121}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956633482_956633488 29 Left 956633482 3:71339381-71339403 CCTCTAAGGTACATTATCATTCC 0: 1
1: 0
2: 0
3: 8
4: 121
Right 956633488 3:71339433-71339455 AGGAAGACTGTATAATTACTAGG 0: 1
1: 0
2: 1
3: 14
4: 193
956633482_956633483 -3 Left 956633482 3:71339381-71339403 CCTCTAAGGTACATTATCATTCC 0: 1
1: 0
2: 0
3: 8
4: 121
Right 956633483 3:71339401-71339423 TCCCACACTCAGATTAGCATTGG 0: 1
1: 0
2: 0
3: 3
4: 90
956633482_956633486 0 Left 956633482 3:71339381-71339403 CCTCTAAGGTACATTATCATTCC 0: 1
1: 0
2: 0
3: 8
4: 121
Right 956633486 3:71339404-71339426 CACACTCAGATTAGCATTGGTGG 0: 1
1: 0
2: 1
3: 12
4: 89
956633482_956633489 30 Left 956633482 3:71339381-71339403 CCTCTAAGGTACATTATCATTCC 0: 1
1: 0
2: 0
3: 8
4: 121
Right 956633489 3:71339434-71339456 GGAAGACTGTATAATTACTAGGG 0: 1
1: 0
2: 1
3: 9
4: 145
956633482_956633487 9 Left 956633482 3:71339381-71339403 CCTCTAAGGTACATTATCATTCC 0: 1
1: 0
2: 0
3: 8
4: 121
Right 956633487 3:71339413-71339435 ATTAGCATTGGTGGCAACGAAGG 0: 1
1: 0
2: 0
3: 6
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956633482 Original CRISPR GGAATGATAATGTACCTTAG AGG (reversed) Intronic
903412265 1:23154853-23154875 GAAATAATAAGGTAACTTAGAGG - Intronic
903691465 1:25176898-25176920 GGACTGATACACTACCTTAGTGG + Intergenic
907159061 1:52358222-52358244 GGAAAGAATATGTACCTTATTGG + Intronic
907271725 1:53295270-53295292 GGAAGGATAATGGGGCTTAGGGG + Intronic
908646969 1:66288726-66288748 GGAACAAAATTGTACCTTAGTGG + Intronic
909658626 1:78058126-78058148 GGAATTATAGTATAGCTTAGTGG + Intronic
909908065 1:81223201-81223223 GGAATGTTAATACAACTTAGAGG + Intergenic
910907362 1:92194925-92194947 GGAATTATTATGGAACTTAGTGG + Intergenic
915201745 1:154234998-154235020 GGAATGGTAATGTGCCTTAATGG - Intronic
918289143 1:183089596-183089618 GAAATGATAATGTGCTTTACGGG + Intronic
918611408 1:186496718-186496740 GGAATGATGATATAACTTACAGG + Intergenic
918997614 1:191782335-191782357 GGAATGATAAAGTATATAAGGGG - Intergenic
919396514 1:197056466-197056488 GGAATGATAGTGTAGCCTGGTGG + Intronic
920362231 1:205426933-205426955 GAAATGATAATGAACAGTAGTGG + Intronic
922372435 1:224924890-224924912 GGAATGAAAATGTAAAATAGAGG - Intronic
922582393 1:226708571-226708593 GAAATGATAATATCCCTTGGAGG - Intronic
924442468 1:244097662-244097684 GGAAGGAAGATGTACCTGAGGGG + Intergenic
1063270480 10:4504651-4504673 GGTCTGGTAATGTGCCTTAGGGG + Intergenic
1064173389 10:13053653-13053675 GGAATGTTGATGAACCTTGGAGG + Intronic
1065315372 10:24458664-24458686 GGAATTATAATGTATCTAATGGG + Intronic
1067467923 10:46514996-46515018 GGAATGATGATATAGCTAAGGGG - Intergenic
1071728398 10:88222511-88222533 ATAATAATAATATACCTTAGGGG + Intergenic
1073392412 10:103190437-103190459 GGAATATTAATGTAGCTTGGTGG - Intronic
1077679837 11:4228537-4228559 GGAGTGATAATGTCCCTAATGGG + Intergenic
1077689251 11:4325112-4325134 GGAGTGATAATGTCCCTAATGGG + Intergenic
1077734043 11:4769505-4769527 AGAATGGTAGTGTACCTCAGAGG + Exonic
1078757793 11:14227704-14227726 GGGATAATAATCTACCTTACAGG - Intronic
1079062761 11:17263894-17263916 AGATTGATTATGTTCCTTAGAGG + Intronic
1081551658 11:44119089-44119111 GGAATGATTATGTCCCCCAGGGG + Intronic
1093929875 12:24945094-24945116 GGAAAGATAATTTAGCTTTGTGG + Intronic
1094078336 12:26503539-26503561 GCAATGACAATGCACGTTAGTGG + Intronic
1095755291 12:45758635-45758657 GGACTGATAATGTAGCTTTGTGG + Intronic
1098290114 12:68950253-68950275 CGAATGAAGATATACCTTAGTGG - Intronic
1101486391 12:105166476-105166498 GGAATGACAATGTACTGTAATGG + Intronic
1103639191 12:122335417-122335439 GGAAGGATACTCTAACTTAGGGG + Intronic
1105590416 13:21788343-21788365 GGAATGTTAACGCACCTCAGAGG - Intergenic
1110762415 13:79245023-79245045 GGAATGCTACTGCCCCTTAGGGG + Intergenic
1115863017 14:37710922-37710944 GGAAAGATTGAGTACCTTAGTGG + Intronic
1123692525 15:22850450-22850472 GGAACGATAATGCACCTTAATGG + Intronic
1126363938 15:47873971-47873993 GGAATGAGAAAGGATCTTAGAGG - Intergenic
1127667206 15:61159675-61159697 TGGATAATAATGTACCTTTGCGG + Intronic
1129442496 15:75591908-75591930 GGAATGAGAATGCACCCTGGAGG - Intergenic
1135665409 16:24331514-24331536 GGAATGAAAGTGCATCTTAGAGG - Intronic
1138697714 16:58831038-58831060 GGAATGATAATGGTACTTACAGG + Intergenic
1140802845 16:78505047-78505069 GGAACAATAATATCCCTTAGAGG - Intronic
1141207560 16:81945051-81945073 GAAATGACAATACACCTTAGGGG + Intronic
1143260776 17:5596810-5596832 GCAGTGATAATGTGTCTTAGGGG + Intronic
1146967748 17:37047306-37047328 AGAAAAATAATTTACCTTAGCGG - Intronic
1148814632 17:50318734-50318756 GGAATGAGACTGTACCCTGGAGG + Intergenic
1150197787 17:63319083-63319105 GGAATCATATTGTACCTGCGAGG - Exonic
1150947944 17:69767343-69767365 GGAATGATCATATACCTCTGTGG - Intergenic
1157057421 18:44247158-44247180 AAAATGAAAATGTCCCTTAGGGG + Intergenic
1158058398 18:53309671-53309693 GGAATGATAATAAACCAGAGTGG - Intronic
1158195518 18:54881091-54881113 GGAGTGATAATGTAGCTTTGGGG + Intronic
1159273786 18:66189052-66189074 GGAATGATGAGATTCCTTAGGGG + Intergenic
1164757176 19:30698663-30698685 AGAATGGTAATTTACCTTTGTGG - Intronic
926104278 2:10140750-10140772 GAAATGAAAAGGTGCCTTAGGGG + Intergenic
926676237 2:15623767-15623789 GTAATGAAAATGTACCTACGTGG - Intronic
926795243 2:16613636-16613658 GAGATGATAATGCCCCTTAGTGG - Intronic
927490456 2:23517845-23517867 GGAAGGCCAATGTATCTTAGAGG - Intronic
928001591 2:27527529-27527551 GGAAAGATAAAGGACTTTAGTGG + Intergenic
928258331 2:29744244-29744266 GGAAGGACACTGTACCATAGTGG - Intronic
928467582 2:31536882-31536904 AGAATGAAAATTTACATTAGAGG - Intronic
932910706 2:75803324-75803346 GGAAGGATAAAGTAACTTAAAGG + Intergenic
933408449 2:81893378-81893400 GGAATGATAGTGTACATCTGGGG + Intergenic
939418241 2:141929246-141929268 GGAATGGTCGTGTACGTTAGTGG - Intronic
939838856 2:147162750-147162772 GTTGTGATAATGTACCTTTGTGG - Intergenic
940495573 2:154423922-154423944 GGAATGACACTGTACCTTTGAGG + Intronic
941274173 2:163469823-163469845 AGAATGATAATGAACCTGTGAGG + Intergenic
943439731 2:187913408-187913430 GGAATGAAAATGTAACATATGGG - Intergenic
944863096 2:203834176-203834198 AGAATGCTAATGTATCTCAGAGG + Intergenic
946820781 2:223627244-223627266 GGTATGACAATGTACCATAAAGG + Intergenic
1177252388 21:18611467-18611489 GGAATGATAAATTACCTAACTGG + Intergenic
1179602732 21:42491119-42491141 GGTTTGATAATGTGCCATAGCGG - Intronic
949767680 3:7544922-7544944 GGAGTGATAATGCCCCTAAGGGG - Intronic
950880744 3:16321107-16321129 GGAATGGCATTGCACCTTAGGGG - Intronic
956633482 3:71339381-71339403 GGAATGATAATGTACCTTAGAGG - Intronic
962123889 3:132593954-132593976 GAAATAATCATGTAGCTTAGAGG - Intronic
963928243 3:150974645-150974667 AGAATGCCAATGTACCTTCGGGG + Intergenic
966366506 3:179193903-179193925 GAAATCATAATGTAGCTTGGAGG - Intronic
968683999 4:1944063-1944085 GGAATGATAGTGTATCTCAGCGG + Intronic
969197827 4:5577258-5577280 GGAGAGACAATGTAGCTTAGTGG - Intronic
971589417 4:28447952-28447974 GGGATGATAATGATACTTAGAGG + Intergenic
971794503 4:31209520-31209542 AGAATGAAAATGTATTTTAGGGG + Intergenic
972293777 4:37716922-37716944 GGTATGATAATGTAACTTTAAGG + Intergenic
973644940 4:52940849-52940871 GGAATGAGCATGTTCTTTAGGGG + Intronic
975014412 4:69395825-69395847 GGTAAGATAAAGTACCTTACTGG + Intronic
980301628 4:131002762-131002784 GAAATGATAAAGTAAATTAGGGG - Intergenic
986514442 5:8546535-8546557 GAAATGAAAATATACCTGAGAGG - Intergenic
991779128 5:70115293-70115315 GGAATGATAAGATAACTAAGAGG + Intergenic
991858420 5:70990766-70990788 GGAATGATAAGATAACTAAGAGG + Intronic
991871577 5:71115648-71115670 GGAATGATAAGATAACTAAGAGG + Intergenic
993091427 5:83431351-83431373 AAAATGATAAAGTACCTTAGAGG - Intergenic
994453517 5:99975139-99975161 GAAATGAAAATGCACCTTTGTGG - Intergenic
995652804 5:114389834-114389856 GAAATCATAATGTAAATTAGTGG + Intronic
996107789 5:119525598-119525620 GGAAGGATCATGTACCTGTGTGG + Intronic
996411364 5:123162819-123162841 GGAATGAGAATCCATCTTAGAGG - Intronic
999684967 5:154094357-154094379 GGAATGAGAATGTTACCTAGTGG - Intronic
1000442756 5:161282775-161282797 GGAATGAAAATGTAAATTTGAGG + Intergenic
1005262001 6:24071122-24071144 GTGATGATCATGTACCTTTGGGG - Intergenic
1008433669 6:51450077-51450099 GGAAAGATAGTTTACCTTAAAGG - Intergenic
1013199738 6:107881796-107881818 TGAATGATAATGTAGGCTAGTGG - Intronic
1014818947 6:125964114-125964136 GGAATGAAAATGCTCTTTAGTGG + Intronic
1015333194 6:132005265-132005287 GCAATGAGAATGTACCTCATAGG + Intergenic
1018380116 6:163251427-163251449 GCAATGATTATGTATTTTAGTGG + Intronic
1027468450 7:78543878-78543900 TGAATAATTATCTACCTTAGTGG - Intronic
1027752448 7:82167063-82167085 GAAATGTTAATGTACCTTTTAGG + Intronic
1027955916 7:84879646-84879668 GGAATGAAAATTTGCCTTCGAGG - Intergenic
1031506127 7:122586043-122586065 GGAATGATTATGTAAATTATGGG + Intronic
1038541415 8:28393222-28393244 GAAATTACAATGTATCTTAGTGG + Intronic
1038951690 8:32422011-32422033 GGGATGAAAAATTACCTTAGAGG + Intronic
1043780994 8:84334987-84335009 GGAAGGATAAAGTACAATAGAGG - Intronic
1046823312 8:118659405-118659427 GAAATAATAATATACCTCAGAGG - Intergenic
1047782675 8:128122973-128122995 GGGAGGATCATCTACCTTAGAGG - Intergenic
1050402729 9:5273155-5273177 GGTGTGATAATGGACTTTAGTGG + Intergenic
1050536046 9:6631658-6631680 GCCATGACAATGTACCTTTGGGG - Intronic
1050753807 9:8974769-8974791 GGTATGTTAATGTATATTAGTGG - Intronic
1053860571 9:42382778-42382800 CAAATGATAATGTACTTCAGAGG + Intergenic
1058263738 9:102872224-102872246 GGATTGAAAAGGTATCTTAGAGG + Intergenic
1058263913 9:102873765-102873787 GGATTGAAAAGGTATCTTAGAGG + Intergenic
1058406244 9:104677989-104678011 CGAATACTAATGTAACTTAGTGG - Intergenic
1061712006 9:132494400-132494422 GGGGTGATAATGTGCCCTAGAGG - Intronic
1185744094 X:2557728-2557750 GGAATCACCATGTACCTGAGAGG - Intergenic
1186896494 X:14009271-14009293 GGAAAGATGAGGGACCTTAGGGG - Intronic
1189790750 X:44602561-44602583 GGAATGAAAATTTAAATTAGAGG + Intergenic
1193000125 X:76554407-76554429 GAAAGGATAATGAACCCTAGTGG + Intergenic
1197314114 X:124942618-124942640 GAAATGGTAATGTAATTTAGAGG + Intronic
1198151662 X:133916525-133916547 GGAATGGTAATATACCCTATGGG - Intronic
1198546564 X:137698404-137698426 GGAATGATCATGGACATTAGGGG + Intergenic
1198792138 X:140357273-140357295 GAAATGGTAATGCACATTAGTGG + Intergenic