ID: 956636181

View in Genome Browser
Species Human (GRCh38)
Location 3:71367816-71367838
Sequence ACTAGCCATCATTATGGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 67}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956636181 Original CRISPR ACTAGCCATCATTATGGTCT TGG (reversed) Intronic
907511994 1:54968572-54968594 AATAGACATTATTATGGTCCAGG - Intergenic
921238631 1:213154016-213154038 ACCAGCCACCTTGATGGTCTTGG + Intronic
922877252 1:228949457-228949479 ACTACCCATTATTTTGTTCTGGG + Intergenic
1066147601 10:32577552-32577574 ACTCACCATCATTATGGTGAAGG + Intronic
1069453516 10:68535939-68535961 AATAGCCACCATTAAGGGCTTGG - Intergenic
1074578776 10:114696298-114696320 ACCTGCCATCATTTTGGTCTTGG - Intergenic
1075062120 10:119264485-119264507 ACTGGCCATCTTTATCGTCATGG - Intronic
1078030368 11:7744979-7745001 CCTAGGTATCATTATGGGCTAGG - Intergenic
1086483450 11:87270413-87270435 ACTAGCCATTTTTATGGACAAGG - Intronic
1086492789 11:87372180-87372202 ACCAGGCATGATTATGGGCTTGG + Intergenic
1087681649 11:101224778-101224800 TTTAGCCATCAGTATGGGCTTGG + Intergenic
1088111185 11:106263781-106263803 ACTAACCCTCATTATGACCTGGG + Intergenic
1090263407 11:125338906-125338928 ATTTCCTATCATTATGGTCTGGG - Intronic
1092633460 12:10412635-10412657 ATTAGCCAGCATGATGGTATTGG + Intronic
1093227514 12:16503629-16503651 ACTAGCCCTCCTTTCGGTCTGGG - Intronic
1093762491 12:22925735-22925757 CCCAGCCATCATTATGGAGTTGG - Intergenic
1093774450 12:23056283-23056305 ACTAGCTTTAATTAGGGTCTTGG - Intergenic
1095833234 12:46609810-46609832 ACTAGCCATCTCTATGGCCTTGG + Intergenic
1096091605 12:48905626-48905648 ATCAGCCATCCTTATGCTCTTGG + Intronic
1106012641 13:25839755-25839777 ACTAGCTCTCATTATGCTTTAGG - Intronic
1115208739 14:30942944-30942966 ACTAGCCATCACTTTGGACAAGG - Intronic
1117513948 14:56481817-56481839 ACTGGCACTCATTGTGGTCTTGG + Intergenic
1119936849 14:78599891-78599913 ACCAGCTATCATTATAGGCTGGG + Intronic
1120447891 14:84624247-84624269 ACAAGCCATCATTATGGGTTTGG - Intergenic
1120467397 14:84877237-84877259 ACTCCCCATGATTTTGGTCTTGG + Intergenic
1121224482 14:92311257-92311279 ACAAGCCCTCGTTCTGGTCTTGG - Intergenic
1122686161 14:103508214-103508236 AATAGAAATCATTATTGTCTAGG - Intergenic
1124573669 15:30888716-30888738 ACTAGCAATAATAAGGGTCTGGG + Intergenic
1126550044 15:49918860-49918882 ACTAGCCAATATTAAGATCTGGG - Exonic
1127314195 15:57779168-57779190 ACCAGCCATCACCGTGGTCTTGG + Intronic
1130787934 15:87120900-87120922 ACTTTCCATCATTCTGGACTAGG + Intergenic
1135908811 16:26540703-26540725 ACTAGCCCTCTTTATTCTCTGGG - Intergenic
1149890326 17:60383736-60383758 ACTAGCCATCTTCTTGTTCTTGG - Intronic
1151529193 17:74693536-74693558 ACTAGCAATCATTGTGGGCTTGG + Intronic
1153533019 18:6068950-6068972 ACTAACAATCACTGTGGTCTGGG - Intronic
1165555608 19:36629290-36629312 ACTTCCTAGCATTATGGTCTCGG - Intergenic
927932863 2:27056715-27056737 ACTGGCCATCTCTACGGTCTCGG - Exonic
929617871 2:43326619-43326641 ACTGGCCATCTTTCTAGTCTTGG - Intronic
930437686 2:51366035-51366057 AATAGCCATCACTATGGCATTGG + Intergenic
944212437 2:197220334-197220356 ACTAGCCACTATGATGTTCTTGG + Intronic
948561173 2:238854249-238854271 AATAGCCATCAGTATCTTCTGGG + Intronic
1173073980 20:39798409-39798431 CCAAGCCATCATTATGAGCTTGG - Intergenic
1177391706 21:20482998-20483020 ACTAGTCTTCATGATGGTTTAGG - Intergenic
1182829870 22:33296429-33296451 ACAAGCCATGATGATGGTCATGG + Intronic
949690185 3:6627715-6627737 TCTCGCCATCATGATGGTCATGG - Intergenic
952051173 3:29386293-29386315 AATAGTCATCATTATGGAATGGG - Intronic
952404390 3:32992603-32992625 ACTTTCCATCAGCATGGTCTCGG - Intergenic
953981270 3:47414369-47414391 ACTGGCCAGCACCATGGTCTGGG + Exonic
956248537 3:67211546-67211568 TCTAGCCATCAAGATGGTCTAGG + Intergenic
956636181 3:71367816-71367838 ACTAGCCATCATTATGGTCTTGG - Intronic
970998889 4:22300445-22300467 CCTTGCCATCACTGTGGTCTCGG + Intergenic
972056817 4:34814225-34814247 ACTAGACAACATTTTAGTCTGGG - Intergenic
972410531 4:38789095-38789117 ATTTACCATCATTATGTTCTGGG + Intergenic
982121435 4:152147013-152147035 CTTACCCATCATTATGGTCACGG - Intergenic
991667848 5:69017254-69017276 ACTTGTCATCATTGTGGTCAAGG - Intergenic
993148607 5:84130113-84130135 ACTATACATTCTTATGGTCTCGG + Intronic
995282896 5:110355506-110355528 AAAAGCCTTCATTATGATCTGGG + Intronic
996643913 5:125792413-125792435 ACTAGCCATCAGCATAGTCTTGG + Intergenic
1009301744 6:62032124-62032146 ATTAACCATCACAATGGTCTTGG - Intronic
1009847003 6:69146500-69146522 CCTAGGCATCATTGTGCTCTTGG - Intronic
1013700047 6:112756113-112756135 ACTTTCCATCATTATAGTTTTGG + Intergenic
1023272139 7:38475330-38475352 AGTTACCATCATTATGGTCAAGG - Exonic
1030066751 7:105665468-105665490 GCTAGCAATAATTATGTTCTGGG + Intronic
1035686367 8:1526460-1526482 ACTGCCCATGATTATGGTCCTGG - Intronic
1037140890 8:15519510-15519532 ACAAGCCAGCATTATGACCTGGG + Intronic
1041798967 8:61777336-61777358 ACTAGACAACATTACTGTCTAGG + Intergenic
1044636655 8:94331944-94331966 TCTAGACATCCTTATTGTCTGGG + Intergenic
1050216203 9:3327497-3327519 ACTATCAATCAATATGGGCTTGG + Intronic
1051520462 9:17981553-17981575 GTGAGCCATCTTTATGGTCTAGG + Intergenic
1052567400 9:30173606-30173628 ACAAGCCATGATTTTGGCCTTGG - Intergenic
1060491224 9:124086136-124086158 ACTTTCCCTCATTGTGGTCTTGG - Intergenic
1186543930 X:10429072-10429094 AATAGGCTTCATTATGGTGTTGG + Intergenic
1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG + Intergenic
1198777194 X:140192433-140192455 ACTAGCCATGCTTCTGTTCTTGG - Intergenic