ID: 956641320

View in Genome Browser
Species Human (GRCh38)
Location 3:71418353-71418375
Sequence ATATGCAAATGGCCTTTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 1, 2: 2, 3: 24, 4: 220}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956641320_956641322 -10 Left 956641320 3:71418353-71418375 CCACAGAAAGGCCATTTGCATAT 0: 1
1: 1
2: 2
3: 24
4: 220
Right 956641322 3:71418366-71418388 ATTTGCATATTCTCCTGCACAGG 0: 1
1: 0
2: 0
3: 14
4: 166
956641320_956641323 -2 Left 956641320 3:71418353-71418375 CCACAGAAAGGCCATTTGCATAT 0: 1
1: 1
2: 2
3: 24
4: 220
Right 956641323 3:71418374-71418396 ATTCTCCTGCACAGGAAAAATGG 0: 1
1: 0
2: 3
3: 29
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956641320 Original CRISPR ATATGCAAATGGCCTTTCTG TGG (reversed) Intronic