ID: 956641320

View in Genome Browser
Species Human (GRCh38)
Location 3:71418353-71418375
Sequence ATATGCAAATGGCCTTTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 1, 2: 2, 3: 24, 4: 220}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956641320_956641322 -10 Left 956641320 3:71418353-71418375 CCACAGAAAGGCCATTTGCATAT 0: 1
1: 1
2: 2
3: 24
4: 220
Right 956641322 3:71418366-71418388 ATTTGCATATTCTCCTGCACAGG 0: 1
1: 0
2: 0
3: 14
4: 166
956641320_956641323 -2 Left 956641320 3:71418353-71418375 CCACAGAAAGGCCATTTGCATAT 0: 1
1: 1
2: 2
3: 24
4: 220
Right 956641323 3:71418374-71418396 ATTCTCCTGCACAGGAAAAATGG 0: 1
1: 0
2: 3
3: 29
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956641320 Original CRISPR ATATGCAAATGGCCTTTCTG TGG (reversed) Intronic
900494505 1:2970430-2970452 ATCTGCAAATGGCCTTTCTGGGG + Intergenic
900779635 1:4609333-4609355 AAATGCAAATGAGTTTTCTGAGG + Intergenic
905196794 1:36286044-36286066 ATATTAAAATGGTCTTTGTGTGG + Intronic
907230357 1:52992364-52992386 ATATGGAATTGATCTTTCTGGGG - Intronic
910263104 1:85310647-85310669 ATATGTAAGTGGCAATTCTGAGG + Intergenic
911241787 1:95475651-95475673 AGATGGAAATGGCCTTACGGTGG - Intergenic
912347025 1:108973153-108973175 CTATGCAAATGGCATTTCCTTGG + Intronic
913001470 1:114584711-114584733 ATATGAAAATGTCCTTTCAAGGG - Exonic
914258907 1:145982578-145982600 ATGAGCCAAAGGCCTTTCTGAGG - Intergenic
917077892 1:171224738-171224760 GTATAGAAATGGCCTTGCTGAGG + Intergenic
918663841 1:187123183-187123205 AAATGCAAATGTCTTTTATGAGG + Intergenic
919441417 1:197638293-197638315 ATATGCTTATAGACTTTCTGAGG + Intronic
920689281 1:208133522-208133544 ATATGCAAATGACTTGTCAGTGG + Intronic
921329745 1:214023704-214023726 ATATCCAAATGGCTTGTATGAGG - Intronic
924905637 1:248449251-248449273 ATCTGCCAGTGTCCTTTCTGTGG - Intergenic
924922253 1:248642785-248642807 ATCTGCCAGTGTCCTTTCTGTGG + Intergenic
1062917860 10:1255683-1255705 AGATGCCAGTGACCTTTCTGTGG + Intronic
1063878195 10:10502632-10502654 ATATGCAAATTGCCATTATCAGG - Intergenic
1064291883 10:14042509-14042531 GTATAAAAATGGCCTTGCTGAGG + Intronic
1066091110 10:32021632-32021654 ATATGGAAATAGCCAATCTGGGG - Intronic
1066247860 10:33601221-33601243 AAAGACAAATGGCCTTGCTGAGG + Intergenic
1067137146 10:43620301-43620323 ATATGCAACTGCCCTAGCTGAGG - Intergenic
1067497476 10:46773615-46773637 CTCTGGGAATGGCCTTTCTGAGG + Intergenic
1067597176 10:47566800-47566822 CTCTGGGAATGGCCTTTCTGAGG - Intergenic
1070584109 10:77748119-77748141 ACAAGCAAATGGTCTTTCTTTGG + Intergenic
1070684571 10:78471408-78471430 ATGTGCAAATGGCCACCCTGTGG + Intergenic
1073376881 10:103042796-103042818 ATATGCAAATTGGCTTCCTCTGG + Intronic
1073848438 10:107586648-107586670 GTATAAAAATGGCCTTGCTGAGG + Intergenic
1074553370 10:114465981-114466003 ATATGCAAATAAGCATTCTGTGG + Intronic
1077955240 11:7012021-7012043 ATATTCAGATGGCTATTCTGAGG + Intronic
1080722206 11:34860936-34860958 AAATGCGAGTGGCCTTGCTGGGG + Intronic
1082298035 11:50468278-50468300 ATCTGCAAAGGGAATTTCTGAGG + Intergenic
1082376172 11:51872664-51872686 ATCTGCAAGTGGACATTCTGAGG + Intergenic
1084424643 11:69077743-69077765 ATTTTCATATGGACTTTCTGGGG + Intronic
1084628419 11:70327949-70327971 ACATGCAAATGTTCTTCCTGTGG - Intronic
1088102819 11:106173870-106173892 GTATAAAAATGGCCTTGCTGAGG - Intergenic
1091999535 12:5020897-5020919 ATATGCAAAAGGACCTACTGAGG - Intergenic
1095064702 12:37756027-37756049 ATCTGCAAATGGGATATCTGTGG + Intergenic
1095431889 12:42143894-42143916 ATTTGGAAATGGCATTTGTGCGG - Intronic
1100040176 12:90307277-90307299 ATATGCAAATGTATATTCTGTGG - Intergenic
1100103091 12:91133660-91133682 ATATGCAACTTGCTTTTCTGTGG - Intergenic
1100991835 12:100259770-100259792 AGTTGTAAATGGCCTGTCTGGGG + Intronic
1101120060 12:101570064-101570086 ATATGCAAATGATCATCCTGTGG - Intronic
1101408747 12:104452401-104452423 AAATGCTAATGTCCTTACTGAGG + Intergenic
1102605551 12:114064866-114064888 AGAAGCAAATAGCCTTGCTGAGG + Intergenic
1104083156 12:125449908-125449930 ATATTCAAATGTCATTTCTTTGG - Intronic
1104389661 12:128381100-128381122 ATAAGCAAGTGGCCTTTCTGCGG - Intronic
1105610823 13:21968427-21968449 AAATCCAAAAGGCCTTTCTGAGG - Intergenic
1107916782 13:45160006-45160028 ATATGCAGTGGGACTTTCTGAGG + Intronic
1111036929 13:82687367-82687389 ATTTGAAAATGGCCTTGTTGAGG + Intergenic
1111087331 13:83393555-83393577 ATAAGCAAATGACCTTGCTAAGG - Intergenic
1111816043 13:93153588-93153610 ATATGTAAATGGCCTATCAAAGG + Intergenic
1112570073 13:100586171-100586193 ACAAGCAAATGCCCTTTCTCTGG + Intronic
1113058703 13:106298031-106298053 CTATGCAAATGGACTTTTGGGGG - Intergenic
1114913199 14:27226973-27226995 ATATTGAAAAGGCCTTTCTCTGG + Intergenic
1116643764 14:47500040-47500062 ATATGCAAATGATTTTTCAGGGG - Intronic
1119529552 14:75350180-75350202 ATATCCAAGTGGACGTTCTGTGG + Intergenic
1120359960 14:83486826-83486848 ATCTGCAGATTCCCTTTCTGTGG + Intergenic
1120993996 14:90401498-90401520 ATGTGCAAAGATCCTTTCTGTGG + Intronic
1123832270 15:24152721-24152743 ATATAAAAATGGCCTTGCTGAGG - Intergenic
1123838072 15:24216544-24216566 ATATTAAAATGGCCTTGCTGAGG + Intergenic
1123847624 15:24318839-24318861 ATATAAAAATGGCATTGCTGAGG + Intergenic
1123866667 15:24526222-24526244 ATATAAAAATGGCCTTGCTGAGG + Intergenic
1124238321 15:28008673-28008695 GTATAAAAATGGCCTTGCTGAGG + Intronic
1125067175 15:35501463-35501485 ATATGCAATTAGTTTTTCTGTGG - Intronic
1126711708 15:51464736-51464758 ATATCCAACTGACCTTTCAGTGG - Exonic
1126870493 15:52981962-52981984 ATATTCATATGGCTTTCCTGTGG + Intergenic
1127604133 15:60569011-60569033 ATTTACAAAAGGCCTTTTTGTGG + Intronic
1127714458 15:61635594-61635616 GTGTAGAAATGGCCTTTCTGTGG - Intergenic
1128575702 15:68773304-68773326 ATTTGCAAAAAGACTTTCTGAGG - Intergenic
1131010381 15:89012531-89012553 GTATAAAAATGGCCTTGCTGAGG + Intergenic
1131416785 15:92266874-92266896 AAATGCACATCCCCTTTCTGAGG + Intergenic
1132182723 15:99771752-99771774 ATATGCAAATGACATATCTCAGG - Intergenic
1136091612 16:27924763-27924785 ATATGAAAACGCCCTTTCTGTGG - Intronic
1137074199 16:35941856-35941878 ATCTGCAAATGGACATTTTGGGG - Intergenic
1137222834 16:46472760-46472782 ATGTGCAAATGGCTCTTTTGGGG - Intergenic
1137374314 16:47939759-47939781 ATATGCATGTGGACTTTGTGTGG - Intergenic
1139187716 16:64826580-64826602 ATATGTAACTGGCCTCTCTTTGG + Intergenic
1139672601 16:68501939-68501961 AGATGCTAATGGGCTTGCTGAGG - Intergenic
1139710501 16:68772185-68772207 ATATGCGATTGGCCGTTGTGTGG - Intronic
1140873957 16:79133065-79133087 ACATGCAAGTGACCTTTCTAGGG + Intronic
1142441319 16:90099806-90099828 AAATAAAAATGGCCTTGCTGAGG + Intergenic
1142602594 17:1061493-1061515 ATAACCAGATGGCCTCTCTGAGG - Intronic
1143060496 17:4196593-4196615 ATATGCAAAGGGCCGTGCTATGG + Intronic
1143324947 17:6092589-6092611 ACATGCAAACGGGCTTCCTGAGG + Intronic
1143999975 17:11044642-11044664 GTATAAAAATGGCCTTGCTGAGG + Intergenic
1146385103 17:32363957-32363979 ATAACCAAATGACATTTCTGAGG - Intronic
1148339778 17:46866561-46866583 CCATGCAAATGGCCTTGCAGCGG + Intronic
1149466815 17:56886507-56886529 GCATGCAAATGGCTTGTCTGTGG + Intergenic
1150485389 17:65539598-65539620 ATATTAAAATTGCTTTTCTGAGG - Intronic
1151092136 17:71453416-71453438 AAATTCAAATGGCCTTTATTTGG + Intergenic
1153386234 18:4500132-4500154 ATGTGCCAATTGCCTTTCTTGGG - Intergenic
1153420416 18:4898969-4898991 AAATTAACATGGCCTTTCTGGGG + Intergenic
1153443562 18:5147998-5148020 ATATGCAAAGAGGCTTACTGAGG - Intronic
1155052499 18:22161095-22161117 ACATGCTAGTGGTCTTTCTGGGG + Intergenic
1155094857 18:22545701-22545723 ATTTGCAAATGTTCTTTCTGTGG - Intergenic
1155491775 18:26407077-26407099 ATATGCAAATGTCCTCACAGAGG + Intergenic
1155498180 18:26462906-26462928 ATCTGGCAATGTCCTTTCTGGGG + Intronic
1155972488 18:32094269-32094291 AATTGCAAATGCCCTTACTGTGG + Intronic
1157092386 18:44651572-44651594 GTATGCAAAGGGCCTTTATCTGG - Intergenic
1157220014 18:45822592-45822614 ATATGCTAATAGCCTTGATGTGG + Intergenic
1157703462 18:49780460-49780482 TCAGACAAATGGCCTTTCTGGGG - Intergenic
1158737054 18:60094230-60094252 ATATTTAAATGGTCTTTTTGAGG + Intergenic
1158817200 18:61116102-61116124 ATAAGCAAGTGTCCTTTCTGGGG + Intergenic
1159826458 18:73218629-73218651 ATATTCAAATTGCCTGTTTGTGG + Intronic
1162749794 19:12822066-12822088 ATCTGCACATGGCCTCTCTGTGG - Intronic
1167319435 19:48787112-48787134 AAATAAAAATGGCCTTGCTGAGG - Intergenic
926251139 2:11156000-11156022 AGGTGCAAATGGCCTTGCTCAGG - Intronic
926469825 2:13240257-13240279 CTATGCAAATGATCTTACTGAGG + Intergenic
927194478 2:20538263-20538285 ATTTGCGACTGGCCTATCTGGGG + Intergenic
929600196 2:43199917-43199939 ATTTGTAAATAGCCTTGCTGAGG + Intergenic
930248948 2:49013959-49013981 ATATGCACATGGCCTTACCTTGG - Intronic
930650717 2:53961759-53961781 GTATAAAAATGGCCTTGCTGAGG - Intronic
930967998 2:57355458-57355480 ATATACAAATGAACTTTCTTTGG + Intergenic
931533903 2:63250426-63250448 ATCTGCTAATTTCCTTTCTGTGG - Intronic
934156735 2:89208118-89208140 GTATCCAAAGGCCCTTTCTGAGG + Intergenic
934210582 2:89974635-89974657 GTATCCAAAGGCCCTTTCTGAGG - Intergenic
935044772 2:99470872-99470894 GTATAAAAATGGCCTTGCTGAGG + Intronic
936248241 2:110847101-110847123 ATCTGCAAAGGGCACTTCTGGGG - Intronic
936707724 2:115095365-115095387 ATATGCAGATGGGCTTTGGGAGG + Intronic
937337029 2:121068498-121068520 ATTTGAAAATGGGATTTCTGAGG + Intergenic
938569280 2:132547233-132547255 ATTTGCAAATGGCATTTCCCTGG + Intronic
939557752 2:143696987-143697009 ATATAAATATGGCTTTTCTGGGG + Intronic
940152810 2:150621511-150621533 ATATGTAAAAGGGCTTTCTGTGG + Intergenic
944947785 2:204710300-204710322 ATATGGAAACGGCATTTCTTAGG - Intronic
945005551 2:205401411-205401433 ATATCCAAATGACCTTTCTTTGG - Intronic
945372841 2:209041559-209041581 ATAAGCAAGTGTCCTTTCTATGG + Intergenic
1169308325 20:4514067-4514089 ATATGATAAAGGCATTTCTGGGG - Intergenic
1169873733 20:10273918-10273940 GTTTGCAACAGGCCTTTCTGAGG - Intronic
1174338079 20:49878267-49878289 ACAAGCAAAAGTCCTTTCTGGGG - Intronic
1175610777 20:60349406-60349428 ATAGGCAAAAGGCCTCTCTGGGG - Intergenic
1177354696 21:19993869-19993891 TTAAGCAAATGTCCTTTTTGTGG - Intergenic
1179071703 21:38077485-38077507 ATTCACAAATGGCCTTGCTGAGG - Intronic
1180659511 22:17453846-17453868 GTATAAAAATGGCCTTGCTGAGG + Intronic
1180659631 22:17454869-17454891 GTATAAAAATGGCCTTGCTGAGG - Intronic
950247248 3:11432404-11432426 AAAGGCAAATGGCATTTATGTGG - Intronic
953263825 3:41366716-41366738 ATATGCAAATTGCTTTCATGTGG + Intronic
954588109 3:51754418-51754440 GTAAGAAAATGGCCTTGCTGGGG - Intergenic
954995329 3:54876083-54876105 AAATGCAAATGGCCTGGCGGAGG - Intronic
955609016 3:60737877-60737899 TTATGTAAATGGCCTTGCTTTGG - Intronic
956641320 3:71418353-71418375 ATATGCAAATGGCCTTTCTGTGG - Intronic
956919998 3:73918190-73918212 AAATGCAAATGGCCCTTCTGTGG + Intergenic
960468804 3:118033728-118033750 ATATTCAAAAGCCCTTTTTGAGG - Intergenic
960554587 3:119013369-119013391 ATATGCAGATTGCCTTTCATTGG - Intronic
961227995 3:125271293-125271315 GCATGTAAATGGCCATTCTGAGG - Intronic
961714811 3:128850955-128850977 ATGTGGAATTTGCCTTTCTGAGG + Intergenic
961785886 3:129346560-129346582 ATGTGGAACTGGTCTTTCTGAGG - Intergenic
962353117 3:134670290-134670312 ATATGCAAAGGGACTGTGTGTGG - Intronic
962582733 3:136812851-136812873 ATATACAAATGGGCTGTGTGTGG - Intergenic
964090147 3:152866252-152866274 ACATGCAAAGGGCCTTTCTAAGG - Intergenic
965820162 3:172676982-172677004 ATAAACAAATGCCCTTCCTGAGG + Intronic
967129939 3:186461368-186461390 ATATGAAACTGGCTCTTCTGAGG - Intergenic
967267889 3:187707111-187707133 ATCTACACATGGCCTTTCTATGG + Intronic
968294138 3:197560621-197560643 GTATAAAAATGGCCTTGCTGAGG + Intronic
968361576 3:198150782-198150804 AAATAAAAATGGCCTTGCTGAGG + Intergenic
972790030 4:42362933-42362955 TTATGTAAATTGCCTTTCAGTGG + Intergenic
972845001 4:42977060-42977082 ATGTGCAATTTGCCTTACTGTGG + Intronic
974620969 4:64354099-64354121 GTATGCCAATGACCTTTCTAAGG - Intronic
976732321 4:88276238-88276260 CTGTGCAAATGACATTTCTGTGG + Intronic
977714726 4:100169104-100169126 ATTTGCAAAGGTCCTTTCTAAGG + Intergenic
977988333 4:103412532-103412554 GTATACAAATGGCCTTGCTGAGG - Intergenic
979909105 4:126337820-126337842 AAATGAAAATTGCCTTTCTGAGG + Intergenic
980473705 4:133282358-133282380 ATTTGCATATGGCCTTACTAAGG - Intergenic
980628084 4:135401277-135401299 ATATATAAATTGCCTTTTTGAGG + Intergenic
982202260 4:152972618-152972640 AGATGCAAAGTGCCTTTCTGTGG - Intronic
985498373 5:224434-224456 AGCTGCATTTGGCCTTTCTGAGG + Exonic
987146039 5:14992697-14992719 AGATGAAAATGGCCTTTATGAGG - Intergenic
987594005 5:19971986-19972008 AAATACAAATGTGCTTTCTGAGG + Intronic
990343021 5:54843131-54843153 ATGTGCACATGGTGTTTCTGTGG - Intergenic
991004239 5:61812239-61812261 AAATTCAAATGGCGTATCTGTGG + Intergenic
991189627 5:63854462-63854484 ATATGCTGGTGTCCTTTCTGAGG - Intergenic
991492528 5:67196880-67196902 AAATGCAACGGGCCATTCTGGGG - Intergenic
992189333 5:74275710-74275732 ATATGCAAGTTGAATTTCTGCGG + Intergenic
992482166 5:77162831-77162853 ATTTGTAAATTGCCTTTCTCAGG + Intergenic
993107803 5:83619373-83619395 ATCTGCAAATGTACTTCCTGGGG - Intergenic
993395799 5:87386570-87386592 ATAAGCAAATGGCTATACTGAGG - Intronic
993830395 5:92749952-92749974 ATAAGCAAATAGCCTTCCTTTGG + Intergenic
995550823 5:113279495-113279517 ATATGTTAATTGCTTTTCTGGGG - Intronic
996749863 5:126877587-126877609 ATTGGGAAATGGCCTTTCTTTGG + Intronic
997359276 5:133284223-133284245 ATTTGCAGATGGTCTCTCTGAGG - Intronic
999136118 5:149320544-149320566 AAATGAAAATGATCTTTCTGAGG - Intronic
1001594095 5:172886626-172886648 ATATCCACGTGGCATTTCTGGGG + Intronic
1002781491 6:370121-370143 ATATTCAAATAGCCATTCTGAGG + Intergenic
1003131569 6:3399351-3399373 ATTTTCAAATGGCTCTTCTGGGG - Intronic
1003422153 6:5968284-5968306 ATGTAAAAATGGCCTTTCTCTGG - Intergenic
1003475572 6:6479065-6479087 GTATAAAAATGGCCTTGCTGAGG - Intergenic
1004228692 6:13812109-13812131 ACATGCAATTCCCCTTTCTGGGG + Intronic
1009419902 6:63454226-63454248 AAATGCTAATAGCCTTACTGTGG - Intergenic
1011777601 6:90749024-90749046 AGAAAAAAATGGCCTTTCTGGGG + Intergenic
1012790414 6:103686707-103686729 ATATACAACTGTCATTTCTGAGG + Intergenic
1013260665 6:108438351-108438373 GTTTTCACATGGCCTTTCTGTGG + Intronic
1016070309 6:139730733-139730755 ATATAAAAATGTCCTTTCAGTGG + Intergenic
1017691019 6:156964470-156964492 ATATTAAATTAGCCTTTCTGTGG - Intronic
1018375564 6:163208000-163208022 ATATGGAAGTGGCCTGTTTGGGG + Intronic
1018708710 6:166482418-166482440 AAATGCAACTGCCCTTGCTGGGG + Intronic
1020625332 7:10571010-10571032 ATATGCAATTTCACTTTCTGTGG - Intergenic
1021451071 7:20784582-20784604 GTGTGCAACTGGCTTTTCTGCGG - Exonic
1023519004 7:41032179-41032201 ATGTGCACTTGGCCTATCTGGGG - Intergenic
1024421099 7:49167731-49167753 ATAGGCAAATGCCCTCTCTCAGG + Intergenic
1025519798 7:61711002-61711024 ATATGGAAACAGCCTTTTTGTGG + Intergenic
1025544122 7:62139654-62139676 ATATGGAAACAGCCTTTTTGTGG + Intergenic
1026288199 7:68982448-68982470 AAGTGAAAATGGCCTTGCTGAGG + Intergenic
1028621651 7:92834344-92834366 ATACACAAATGGTCTTTTTGGGG + Intronic
1030134661 7:106235218-106235240 ATCAGGAAATGGCCTTTCTCTGG + Intergenic
1030760122 7:113340177-113340199 ACATGCAAATGCACTTTTTGAGG + Intergenic
1031673238 7:124577957-124577979 ATATGCAAAAGACTTTTCTGAGG + Intergenic
1032876190 7:136040885-136040907 ATATGCCAGTTGTCTTTCTGGGG + Intergenic
1033022645 7:137742169-137742191 ATATGCCAAAGGCATTTCTTTGG + Intronic
1035582545 8:748661-748683 ATTTGCAAATGGCCTCACTGAGG + Intergenic
1036528731 8:9560689-9560711 GTAAGCAAATGCCCTGTCTGAGG + Intronic
1037362750 8:18091177-18091199 AAATGCAAATGACTTTTCAGGGG - Intergenic
1037649209 8:20821602-20821624 CTAAGCAAATGGCCTGTCTTTGG + Intergenic
1039030033 8:33299172-33299194 AGTTGGAAATGGCTTTTCTGGGG - Intergenic
1040404095 8:47083060-47083082 GTATCTAAAAGGCCTTTCTGTGG - Intergenic
1041777337 8:61537631-61537653 ATATGCATATGCCCTTTGGGAGG - Intronic
1042495864 8:69454007-69454029 ACCTGCAAAGGGGCTTTCTGAGG - Intergenic
1042841647 8:73130230-73130252 GTATAAAAATGGCCTTGCTGAGG + Intergenic
1043720029 8:83536088-83536110 ATTTGCAAATGGCTTTTCTATGG + Intergenic
1044029460 8:87216445-87216467 TTATGCAAAGGTGCTTTCTGAGG - Intronic
1044311807 8:90702130-90702152 ATAAGCAAAAAGCCTTTCTTGGG - Intronic
1045347248 8:101304382-101304404 CTATGCACATGGCATTTCTGGGG + Intergenic
1048161564 8:132026400-132026422 AAATGCAACTGGCATGTCTGGGG - Intronic
1049538202 8:143192520-143192542 AAATGCACATGGCCTTTGTTAGG + Intergenic
1050521022 9:6499908-6499930 ATCTGAAATTGGCCTTTTTGTGG - Exonic
1050647904 9:7741784-7741806 AGATGCAATTTTCCTTTCTGTGG - Intergenic
1051433405 9:17004171-17004193 ATTTGCATATAGGCTTTCTGTGG - Intergenic
1056986902 9:91371776-91371798 ATATCCAAATGCACTTACTGTGG + Intergenic
1057074081 9:92125953-92125975 ATGTGCAGGTGGCCTGTCTGAGG + Intergenic
1057842728 9:98499520-98499542 TTATCCTAATGGACTTTCTGGGG + Intronic
1058118360 9:101109907-101109929 ATATACAAATGGCCATTGTGTGG + Intronic
1059038609 9:110787764-110787786 ATATGCAAGCGGACTTTCAGAGG + Exonic
1061562306 9:131413432-131413454 GTATAAAAATGGCCTTGCTGAGG + Intronic
1062164447 9:135100249-135100271 AGAAGCCAAGGGCCTTTCTGAGG + Intronic
1062746292 9:138214603-138214625 AAATAAAAATGGCCTTGCTGAGG + Intergenic
1185549569 X:972407-972429 ATATGCACATCAACTTTCTGGGG + Intergenic
1187604216 X:20865652-20865674 ATAAGTAAATGGCCTTTCCATGG - Intergenic
1189665494 X:43350718-43350740 GTATAAAAATGGCCTTGCTGAGG + Intergenic
1190602525 X:52107522-52107544 ATATGCTGATGTCCTTTCTTTGG + Intergenic
1191846963 X:65554122-65554144 GTATAAAAATGGCCTTGCTGAGG + Intergenic
1191957581 X:66661858-66661880 ATATGCCAATTTCCTTTCTTTGG - Intergenic
1191963820 X:66734071-66734093 ATATGCAAATGGCAATTTGGAGG + Intergenic
1193609711 X:83615205-83615227 ATATGTAAATGTCCTTTATCAGG - Intergenic
1193812602 X:86069101-86069123 GTATAAAAATGGCCTTGCTGAGG + Intergenic
1198870511 X:141173824-141173846 ATCTGGGAATGACCTTTCTGGGG - Intergenic
1199151693 X:144494563-144494585 GTATAAAAATGGCCTTGCTGAGG - Intergenic
1199477562 X:148262685-148262707 ATTTGCAACTGGGCTTTCTCAGG - Intergenic
1200092250 X:153641502-153641524 ATGTGCACCTGGCCTTTCTGGGG - Intergenic
1201689168 Y:16743869-16743891 ATGTGAAAATTGTCTTTCTGTGG + Intergenic