ID: 956642923

View in Genome Browser
Species Human (GRCh38)
Location 3:71431588-71431610
Sequence GTGTGGGACCAGATGGACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956642923_956642933 29 Left 956642923 3:71431588-71431610 CCCTGGTCCATCTGGTCCCACAC 0: 1
1: 0
2: 0
3: 10
4: 136
Right 956642933 3:71431640-71431662 ACAACTAAACATATTTCCAAAGG 0: 1
1: 0
2: 0
3: 30
4: 331
956642923_956642926 -8 Left 956642923 3:71431588-71431610 CCCTGGTCCATCTGGTCCCACAC 0: 1
1: 0
2: 0
3: 10
4: 136
Right 956642926 3:71431603-71431625 TCCCACACAGCCCCATTGCCTGG 0: 1
1: 0
2: 6
3: 17
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956642923 Original CRISPR GTGTGGGACCAGATGGACCA GGG (reversed) Intronic
900938846 1:5784800-5784822 CTGTGGGGCCAGGGGGACCAGGG - Intergenic
902638270 1:17749555-17749577 ATGTGGGAGGAGATTGACCAAGG - Intergenic
903406336 1:23099927-23099949 GTGAGGGACCAGAGGGAAGAGGG - Intronic
903605979 1:24575536-24575558 GTTTGGGCTCAGATGGACCTAGG - Intronic
903807124 1:26013398-26013420 GTGTGTGAGGGGATGGACCAGGG + Intergenic
903846439 1:26282205-26282227 GCCTGGGACCAGCTGGGCCAGGG - Intronic
904046629 1:27613083-27613105 GTGTTGGAACAGGTGGAGCAGGG - Exonic
904299772 1:29546730-29546752 GTTTGGGAACAGATGGGCCCTGG + Intergenic
905282241 1:36856603-36856625 CTGTGGGACCACAGGTACCACGG + Intronic
906796314 1:48698894-48698916 GTTTGGGATCAGCTGGACCTAGG - Intronic
907265803 1:53260107-53260129 CTGTGGAACCAGATAGACCTGGG + Intronic
909235515 1:73148381-73148403 GTGTTGGACCAGATTCCCCATGG - Intergenic
909866868 1:80685225-80685247 GTGGGGGACCAGATGAATCAAGG - Intergenic
910291286 1:85602701-85602723 GTGTGAGACCACGGGGACCAGGG + Intergenic
913336162 1:117710536-117710558 ATGGGGGACCACGTGGACCATGG + Intergenic
914392629 1:147236127-147236149 GTGAGGCTCCAGCTGGACCAGGG + Intronic
917511666 1:175674140-175674162 GTGTGTGCCCAGCTTGACCAGGG + Intronic
920178599 1:204118767-204118789 GTGTGGGACCTGACGGTACAGGG + Intronic
922087419 1:222364074-222364096 GTGTGAGAGTAAATGGACCAGGG + Intergenic
1070650011 10:78228579-78228601 GTCTGGGAGCAGGTGGAGCAGGG - Intergenic
1078088146 11:8247040-8247062 TTGTGGAAGCAGATGGGCCAAGG - Intronic
1080774290 11:35371323-35371345 CTGAGGGTCCAGCTGGACCATGG - Intronic
1081700337 11:45148487-45148509 GTTTGAGACTGGATGGACCACGG - Intronic
1081758013 11:45558324-45558346 GTTTGGGACCACATGGGCAAAGG + Intergenic
1082884235 11:58066777-58066799 GTGTGGGCCCAGGAGGCCCAGGG - Intronic
1083687758 11:64387164-64387186 GTGTGGGACCATATATTCCATGG - Intergenic
1083975824 11:66119071-66119093 CAGTGGCACCAGATGGACAAGGG + Intronic
1084482843 11:69432112-69432134 GTGTGGGGGCAGAAGGGCCAGGG - Intergenic
1084603329 11:70159238-70159260 GTGGGGGAAGAGATGGGCCAGGG + Intronic
1085051341 11:73381765-73381787 GTGTGGGAGCAGGTGGACGTAGG + Intronic
1085972751 11:81612568-81612590 TTTTGGGGCCAGATGGACCTGGG - Intergenic
1089582342 11:119489294-119489316 CTGGGGGTCCTGATGGACCAGGG + Intergenic
1089733468 11:120534108-120534130 GTGTGGGCCCAGAAGCACAAAGG + Intronic
1091775013 12:3178872-3178894 GTGGGGGATCTGATGGACAATGG + Intronic
1092938410 12:13385542-13385564 GTGTGGGGCCACCTGGATCAGGG + Intronic
1101896538 12:108761332-108761354 GTGTGGGACCAAATGCAGGAAGG + Intergenic
1103723436 12:122986594-122986616 GGGTGGGGGCAGAGGGACCATGG - Intronic
1103931131 12:124451688-124451710 GTGAGTGATCAGATGGAACAGGG + Intronic
1111749279 13:92307252-92307274 GTTTGAGACCAGCTTGACCATGG + Intronic
1112676268 13:101705697-101705719 GAGGGGGAGCAGATGGAGCAAGG + Intronic
1113614343 13:111670350-111670372 GTGTCGCACCAGATAGACAAGGG - Intronic
1113619811 13:111755264-111755286 GTGTCGCACCAGATAGACAAGGG - Intergenic
1114521864 14:23344531-23344553 CTGAGGGACAAGATGGACCTGGG + Intergenic
1117908398 14:60613490-60613512 CTGTGGGCCCAGAGGGTCCAGGG + Intergenic
1119400592 14:74359725-74359747 GTGTGGGACCAGGTGGGGCAAGG + Exonic
1120698709 14:87674018-87674040 GTGTGGGACCAGGGGGCACATGG - Intergenic
1120790772 14:88579542-88579564 GAGTGGAATCAGATGGAGCAGGG + Intronic
1124291346 15:28456066-28456088 GTGCTGGACCAGCTGGGCCAGGG - Intergenic
1128146228 15:65333898-65333920 ATGTTGGACCAGATGGTCCCTGG + Intronic
1129463001 15:75709368-75709390 GTGAAGGAGCAGAGGGACCAGGG + Intronic
1131433266 15:92403267-92403289 GGCTAAGACCAGATGGACCATGG - Intronic
1132714993 16:1285791-1285813 TTGTGGGACCAGGAGGACCCTGG + Intergenic
1132893674 16:2217262-2217284 GTGTGGGAGAAGATGGCCCATGG - Intergenic
1133025474 16:2987325-2987347 GTGTGGGGCCTTCTGGACCAGGG + Intergenic
1133921133 16:10154192-10154214 TTGTGGGCCCAGATGGAGCATGG - Intronic
1134476972 16:14582527-14582549 GTGTGGGACGAGAAAGCCCACGG - Intronic
1134609706 16:15598470-15598492 GTGGGGGTCCAGAGGGCCCAAGG - Intronic
1134789350 16:16974904-16974926 GTGATGGACCACATGGACAACGG + Intergenic
1135302022 16:21338635-21338657 GTGTGGGGCCAGATGGGCCTCGG + Intergenic
1142118436 16:88373477-88373499 GGGTGGGACCAGATCTCCCAAGG - Intergenic
1142352170 16:89585554-89585576 GTGGGGGACGGGATGGACCAAGG + Intronic
1146179402 17:30687610-30687632 GTTGGGGACCACATGGGCCAGGG - Intergenic
1147454973 17:40531371-40531393 GCGGGGGACCAGGGGGACCAGGG + Intergenic
1147787633 17:42991174-42991196 GTGAGGGACCTGCTGGCCCATGG + Exonic
1148470263 17:47888900-47888922 GTGTGGGTTCAGAAGGACCAGGG - Intergenic
1148967216 17:51446270-51446292 GTGTTTCACCAGATGGGCCAGGG + Intergenic
1149291752 17:55224616-55224638 ATGTGTGACCAGGTGAACCAGGG - Intergenic
1155238093 18:23841567-23841589 GTGTGGGACAAAAGGGACAAGGG + Intronic
1156779779 18:40837578-40837600 GCCAGGGACCAGATGGAACAGGG - Intergenic
1158521901 18:58178077-58178099 GTGTGTGAGCTGATGGTCCACGG + Intronic
1159961160 18:74556753-74556775 ATGGGCGACCTGATGGACCAGGG - Intronic
1160036811 18:75309463-75309485 GTGTAGGACAAGATGGAAAAGGG - Intergenic
1161523421 19:4738591-4738613 GAGGGGGACCACATGAACCAGGG + Intergenic
1161741436 19:6023241-6023263 GTGTGGGAGCAGCTGGGCCCTGG - Intronic
1162979223 19:14227949-14227971 GTTGGGGACCACATGGGCCAGGG + Intergenic
1163382221 19:16976614-16976636 GTGTGGGACCAGTTTCACCCAGG - Intronic
1164572843 19:29386556-29386578 TTGTGGGACCTGGGGGACCAGGG + Intergenic
1165036723 19:33039130-33039152 ATTTGGGATCAGATGGACTAAGG - Intronic
1165354263 19:35293944-35293966 GTGAGGGAGCAGATGTCCCACGG - Intronic
1166869874 19:45864574-45864596 GTGTGGGCTCACATGGAGCAGGG + Intronic
926126868 2:10277426-10277448 GTGGTGGACCAGATGGAGGACGG + Intergenic
927114742 2:19888966-19888988 GTGTGGAGGCAGATGGAGCAAGG - Intergenic
927981426 2:27377399-27377421 GGGGGGGCCCATATGGACCAGGG - Exonic
929218249 2:39437619-39437641 AACTGGGACCAGATAGACCAAGG - Intergenic
929995833 2:46825803-46825825 GTTTGGGGCCAGCTGGGCCAGGG - Intronic
930538491 2:52673938-52673960 GTTTGGGACCAGCTGAGCCAAGG - Intergenic
932103617 2:68923544-68923566 GAGTGGGGCCAGATGGAAGACGG - Intergenic
932309985 2:70732022-70732044 CTGTGGGACCTGATGCCCCAAGG + Intronic
942360693 2:175168446-175168468 GGGCGGGACCAGAGGGCCCAAGG + Intergenic
944509895 2:200454089-200454111 GTCTGGGATCAGATGGTCCCCGG + Intronic
1170590220 20:17765861-17765883 GGCTGTGACCAGATGGAGCATGG + Intergenic
1170961756 20:21031474-21031496 GTGTGACACCTGGTGGACCATGG - Intergenic
1173746305 20:45440023-45440045 TCGAGGGACAAGATGGACCAGGG + Intergenic
1176070147 20:63222087-63222109 GTGTGGGCACAGAGGGATCAGGG - Intergenic
1179623633 21:42634600-42634622 GTGGGTGAGCAGATGGACAATGG - Intergenic
1180154267 21:45970618-45970640 GTGAGGGAGCAGCTGGAACAGGG - Intergenic
1181106062 22:20576417-20576439 GCTTGGGGCCACATGGACCAAGG - Intronic
1183345337 22:37304318-37304340 GGGTGGGGCCAGAGGGTCCAGGG + Intronic
1184600141 22:45538691-45538713 GTGTGGGAGCAGAGGACCCAGGG - Intronic
1184684863 22:46091661-46091683 CGGAGGGACCAGATGGGCCAAGG - Intronic
950465479 3:13150904-13150926 GTGTGAAAGCAGATGGTCCAGGG + Intergenic
950740894 3:15051145-15051167 GTGAAGGACCAGTTGGACCACGG - Exonic
950789493 3:15461262-15461284 CTGTGGGACCAGATGGTGCTGGG - Intronic
953631464 3:44621566-44621588 ATGTGGCAGCAGAAGGACCAAGG - Intronic
953929413 3:46998573-46998595 CAGTGGGGCCAGATGGGCCATGG + Intronic
954437805 3:50505113-50505135 AGGTGGGACCTGATGGACTATGG + Intergenic
956277043 3:67513568-67513590 GTGTGTGACCAGGTGTAACAGGG + Intronic
956642923 3:71431588-71431610 GTGTGGGACCAGATGGACCAGGG - Intronic
958833219 3:99114804-99114826 TTTTGGGGCCAGATGGACCTAGG + Intergenic
959495551 3:107046979-107047001 CTGTGGGACCACATTGAGCAAGG + Intergenic
970539299 4:17061113-17061135 GTCAGTGAGCAGATGGACCATGG + Intergenic
971640553 4:29126570-29126592 GTGTGGGAACAGATGAAAAATGG + Intergenic
973047570 4:45553549-45553571 CTGAGGGACTAGATGGACCCAGG + Intergenic
984929573 4:184834936-184834958 GTGGGGGATCAGAGAGACCACGG - Intergenic
989175268 5:38518443-38518465 ATGTGGGACCACATATACCATGG + Intronic
990648795 5:57875145-57875167 GTGTGTGACCAGATGGCTCTTGG + Intergenic
997472855 5:134126316-134126338 GTGTGGGGACAGATGAACCTGGG + Intronic
1003199340 6:3944557-3944579 GAGAGAGACCAGTTGGACCAAGG - Intergenic
1007413528 6:41678846-41678868 GTGAGGGACCAGACTGACAAGGG - Intergenic
1010021128 6:71161181-71161203 AAGTGGGACCTGAGGGACCATGG - Intergenic
1010792677 6:80082861-80082883 GTGTGAGAAAAGATGGCCCAAGG - Intergenic
1019518666 7:1450798-1450820 GTGTGGGACGAGGTGGATCCGGG - Intronic
1022281881 7:28919350-28919372 GAGTGGGCACACATGGACCAAGG - Intergenic
1024500646 7:50101776-50101798 GTCTGTGACAAGCTGGACCAAGG - Intronic
1026405842 7:70064665-70064687 ATGTGGTACCTGATGGACCATGG + Intronic
1027362380 7:77422663-77422685 GGGTGGGACCAGCTGATCCATGG - Intergenic
1028609507 7:92694079-92694101 GTATGTGACTAGATGGACTAAGG + Intronic
1029197391 7:98815091-98815113 TTTTTGGACCAGATGGGCCAAGG - Intergenic
1029389741 7:100267032-100267054 GGGTGGGTACAGATGGATCAGGG - Intronic
1029714737 7:102319806-102319828 CTGTGGGAACAGCTGGAACAGGG - Intronic
1030306200 7:108020975-108020997 GACTAGGACCAGAGGGACCATGG + Intergenic
1032263377 7:130353704-130353726 GTGAGGGACGAGATGGCGCATGG - Intronic
1034936632 7:155204338-155204360 GTGTGGCACCAGGTGAAGCAGGG + Intergenic
1036727393 8:11231919-11231941 GTGTGGGGCCACTGGGACCAAGG - Intergenic
1042852289 8:73227832-73227854 GGGTAGGACCAGATGGAAGAAGG - Intergenic
1049767442 8:144361466-144361488 GTGTGGGCCCAGAGAGCCCAGGG - Intergenic
1056901735 9:90606273-90606295 GGGTGGCACCAGCTGGTCCATGG + Intergenic
1058439644 9:104994906-104994928 GACATGGACCAGATGGACCAGGG - Intergenic
1059736113 9:117101504-117101526 CTGTGGTACCAGAAGAACCAAGG - Intronic
1060220740 9:121762867-121762889 GTGTGGGACCTGATGGGCCTGGG + Intronic
1061091310 9:128428152-128428174 CTGTGGGACCAGAGGGAGAAAGG - Intronic
1061242669 9:129383499-129383521 GTGGGGGACCCGATGGATCCTGG + Intergenic
1061635437 9:131905450-131905472 GGGTGGAACCAGCTGGCCCAGGG + Intronic
1062656689 9:137607254-137607276 GGATGGGAACAGAAGGACCATGG + Intronic
1197648035 X:129038372-129038394 GTGGAGGACCATATAGACCATGG + Intergenic
1197905136 X:131416714-131416736 GTGTGAGATTAGATGGAACAGGG + Intergenic
1199600675 X:149539752-149539774 GTGTGGGAGCAGATGGGGCGGGG - Intergenic