ID: 956643716

View in Genome Browser
Species Human (GRCh38)
Location 3:71436303-71436325
Sequence GAAAATCCTAAGATGCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 239}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956643714_956643716 16 Left 956643714 3:71436264-71436286 CCTCTGAGATCAACAAAGCACAT 0: 1
1: 0
2: 2
3: 16
4: 203
Right 956643716 3:71436303-71436325 GAAAATCCTAAGATGCAGCCTGG 0: 1
1: 0
2: 0
3: 17
4: 239
956643713_956643716 17 Left 956643713 3:71436263-71436285 CCCTCTGAGATCAACAAAGCACA 0: 1
1: 0
2: 0
3: 12
4: 185
Right 956643716 3:71436303-71436325 GAAAATCCTAAGATGCAGCCTGG 0: 1
1: 0
2: 0
3: 17
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956643716 Original CRISPR GAAAATCCTAAGATGCAGCC TGG Intronic
901746734 1:11378704-11378726 AAAAATCCTATGATGCGACCGGG + Intergenic
902057187 1:13611058-13611080 GAAAATACTAAAAATCAGCCGGG + Intronic
902277347 1:15349487-15349509 GAGAATCCTGAGTTTCAGCCAGG + Intronic
902517808 1:16999083-16999105 GAAACAGCTCAGATGCAGCCAGG + Intronic
903686462 1:25135754-25135776 GGTAATTCTGAGATGCAGCCAGG + Intergenic
904525762 1:31132716-31132738 AAAATTGCAAAGATGCAGCCAGG + Intergenic
905069114 1:35209902-35209924 AAAGATTCTAAAATGCAGCCAGG - Intergenic
906829976 1:49020810-49020832 GAAAATCCTAAAATACAGGAAGG + Intronic
908141021 1:61184797-61184819 GAAAATGGTAAAATGCAACCTGG + Intronic
908277888 1:62495240-62495262 GAAGATCCAAAGATGCCACCTGG + Intronic
909135189 1:71789853-71789875 GAAAATCCAAATATGCTACCTGG + Intronic
909626186 1:77718718-77718740 GAAAATGCAGAGATCCAGCCTGG + Intronic
910713835 1:90208913-90208935 GAAAAACGGAAGATGCAGACAGG + Intergenic
912167110 1:107055093-107055115 GAGAATTCTAATAAGCAGCCAGG + Intergenic
913691689 1:121285719-121285741 GGGAATTCTAATATGCAGCCAGG - Intronic
914145857 1:144994236-144994258 GGGAATTCTAATATGCAGCCAGG + Intronic
916555939 1:165894477-165894499 GATATTTCTAACATGCAGCCAGG - Intronic
918008545 1:180564783-180564805 GGCAATTCTAATATGCAGCCAGG - Intergenic
919058189 1:192597201-192597223 TACAATCCTAAGATGTAGGCTGG - Intergenic
920175606 1:204099707-204099729 GAAAAACCTGAGATGCCGACTGG - Intronic
920419202 1:205819049-205819071 GGAGATTCTAATATGCAGCCAGG - Intergenic
920479019 1:206304228-206304250 GGGAATTCTAATATGCAGCCAGG - Intronic
921154539 1:212428882-212428904 GAAAATGCTACAATCCAGCCAGG + Intergenic
921251586 1:213303325-213303347 GAAAATCCTACGATGAATCTTGG - Intergenic
921808357 1:219481101-219481123 TATAATCCTAACTTGCAGCCAGG - Intergenic
922008210 1:221553333-221553355 GTAAAGCCAAACATGCAGCCTGG + Intergenic
923396333 1:233568735-233568757 TAAAAGACAAAGATGCAGCCAGG - Intergenic
923959364 1:239059278-239059300 GACAATCCCTAGAGGCAGCCAGG - Intergenic
924078442 1:240366400-240366422 GAAAAAACTAAGTTGCAGCAGGG - Intronic
924473825 1:244366568-244366590 AAAATTCTTAAGATGTAGCCAGG - Intronic
924515155 1:244759916-244759938 GAAACTCCTGAGATGCAGGCTGG + Intergenic
1063495809 10:6506797-6506819 GAAAATCCTAAGTCACAGCATGG - Intronic
1064099548 10:12451485-12451507 GGAAATCCTCAAATGGAGCCAGG - Intronic
1064662940 10:17624380-17624402 GGAAATCCTCTGATCCAGCCAGG + Intergenic
1065904887 10:30241605-30241627 GGAAATCATAACTTGCAGCCTGG - Intergenic
1066324414 10:34342512-34342534 GAAAAGCCCATGATGCAGTCAGG + Intronic
1067789838 10:49279517-49279539 TAAGATCCTGAGATGCAGGCTGG - Intergenic
1069296989 10:66858615-66858637 GAAACTCCTAAGATTGAACCAGG - Intronic
1069338568 10:67383475-67383497 GAGAATCTTAATATGCAGCTAGG - Intronic
1069600735 10:69705182-69705204 GAAAATGTAAAGATCCAGCCTGG - Intergenic
1070584227 10:77748942-77748964 GAGAATCCTGTGAAGCAGCCAGG - Intergenic
1070716762 10:78728140-78728162 GAAAAGACTGAGATGCAGCGAGG - Intergenic
1071840622 10:89467118-89467140 GAAAAGCCTAAGAAGAAGCTAGG - Intronic
1072026420 10:91464052-91464074 GAAGATCATAAGACTCAGCCTGG - Intronic
1072091041 10:92127516-92127538 AAAAATCCTAAAAATCAGCCAGG + Intronic
1073242894 10:102069677-102069699 CAAAGTCCTGAGATGCAGCTGGG - Intergenic
1073365161 10:102934225-102934247 TAAACTCCTAAGCTCCAGCCAGG - Intronic
1074122866 10:110506093-110506115 GTTGATCCTAAGATGCACCCAGG - Intronic
1074666991 10:115738531-115738553 GAAAATTCCAAAATGCAGCTGGG - Intronic
1076568884 10:131418934-131418956 TAAAGTACTTAGATGCAGCCAGG + Intergenic
1076654673 10:132015780-132015802 AAAAGTTCTAAGTTGCAGCCGGG - Intergenic
1077822838 11:5767093-5767115 CAAAGTCCTCAGATGAAGCCAGG - Intronic
1079189831 11:18268209-18268231 AAAAATACTAAAATGTAGCCAGG + Intronic
1079417781 11:20255651-20255673 GAGCATCATAAGATGAAGCCAGG + Intergenic
1079700063 11:23534949-23534971 AAAAATCCAAAAATGTAGCCTGG - Intergenic
1081482172 11:43499716-43499738 GGAAATCCTAAATTGTAGCCTGG - Intergenic
1082882888 11:58055637-58055659 GAAAATACAAAAATGTAGCCAGG + Intronic
1084680845 11:70665433-70665455 GAAAATTCTCAGATGGAGCAGGG - Intronic
1084939588 11:72605370-72605392 GGTGATTCTAAGATGCAGCCAGG + Intronic
1085461028 11:76693280-76693302 CAAATTCCTAAGCTGAAGCCAGG - Intergenic
1086029913 11:82342023-82342045 GCAATTCCTCAGTTGCAGCCTGG - Intergenic
1087585498 11:100115177-100115199 GAAATTCTCAAGATGCAACCAGG - Intronic
1089554288 11:119306993-119307015 TTAAGTCCTAAAATGCAGCCTGG - Exonic
1089586828 11:119514972-119514994 GCAAATGCTAAGCTGCATCCTGG + Intergenic
1089647971 11:119892561-119892583 GAAAATCCTATTATCTAGCCAGG + Intergenic
1090962835 11:131572445-131572467 GAAAATGGTAACATCCAGCCTGG - Intronic
1094674313 12:32603860-32603882 AAAAATTCTAAGATTTAGCCAGG - Intronic
1096672075 12:53206020-53206042 GAAAAACCTATGCGGCAGCCGGG - Intronic
1096848133 12:54419011-54419033 GAGAATCCGAAGAAGGAGCCCGG + Exonic
1097073258 12:56372282-56372304 TAAAATCATAAGAAGTAGCCGGG - Intergenic
1097925781 12:65124767-65124789 GAAAATCCTTCGAGGCAGACTGG + Intergenic
1097926907 12:65139089-65139111 GGTAATTCTAATATGCAGCCAGG - Intergenic
1100409126 12:94297018-94297040 TAAGATCTTAAGATGCAGCAGGG + Intronic
1100795081 12:98173571-98173593 GTAAATACTAAAATGCAGACAGG + Intergenic
1101581433 12:106045292-106045314 TAAAATCCTAATTTCCAGCCGGG - Intergenic
1104998450 12:132673736-132673758 GATGATTCTAACATGCAGCCCGG + Intronic
1106743577 13:32674823-32674845 AAAGATTCTAATATGCAGCCAGG - Intronic
1107525072 13:41222407-41222429 GAGAATTCTAAGATGCCCCCTGG + Intronic
1108426725 13:50309922-50309944 GAAATTCCTCAGGTGCAGCACGG + Intronic
1108869308 13:54963039-54963061 GAAAAAACTCTGATGCAGCCGGG + Intergenic
1110246280 13:73327817-73327839 AGAAATGCTAATATGCAGCCAGG + Intergenic
1111299685 13:86331736-86331758 GAGAATCCTTAGAAGCAGCAAGG - Intergenic
1111912202 13:94325254-94325276 GAGAATTCTATGATGAAGCCTGG + Intronic
1112117306 13:96370063-96370085 GATGGTCCTAATATGCAGCCAGG - Intronic
1114479291 14:23022072-23022094 GAACAGCCTAAGATGGGGCCGGG + Intronic
1114496195 14:23134225-23134247 AAAAATCGCAAAATGCAGCCTGG + Intronic
1115402975 14:32984226-32984248 CAAAATTCTAAGATACAGCAGGG - Intronic
1116749851 14:48869480-48869502 GAAAATTCAAAGAAGCAGCAGGG + Intergenic
1117045013 14:51804579-51804601 GGCAATGCTAACATGCAGCCAGG - Intergenic
1119763037 14:77166952-77166974 AAAAATATTAAGATTCAGCCTGG + Intronic
1121294018 14:92802023-92802045 GCAAATCCTAAAATGCATACAGG - Intronic
1121908348 14:97767558-97767580 GAAAACCCCAAGACCCAGCCGGG - Intergenic
1125336384 15:38630635-38630657 AGAAGCCCTAAGATGCAGCCCGG + Intergenic
1127609392 15:60622314-60622336 TAAAATACCAAGATGCAGGCTGG + Intronic
1128143143 15:65316350-65316372 GCACATCCTAAAATGCAGGCTGG - Intergenic
1129123025 15:73414418-73414440 GCAAAGCCTCAGATGCACCCAGG - Intergenic
1131015966 15:89058148-89058170 GAAAATCCTAAAAGTCAACCTGG - Intergenic
1134890740 16:17839604-17839626 GACAATCCTAATATACTGCCAGG + Intergenic
1135801785 16:25504041-25504063 GCAAAACCTAAGATGGAGCTGGG - Intergenic
1135959246 16:26982138-26982160 GGTAATTCTAAGATGCAACCTGG - Intergenic
1137649909 16:50110864-50110886 GAAAATGCTAAGATGACGCTTGG + Intergenic
1138095228 16:54206158-54206180 GATGATTCTAATATGCAGCCAGG + Intergenic
1138106231 16:54288299-54288321 GAAACTACTCAGATGCAGTCTGG - Intergenic
1142158066 16:88541892-88541914 GAAAGTCCTAAGTAACAGCCGGG - Intergenic
1143568879 17:7741956-7741978 GAAATTCCTAAAATGAGGCCGGG - Intronic
1144217953 17:13073183-13073205 GAAAGTCCCTAGATGCAGTCAGG - Intergenic
1145089354 17:19973906-19973928 AAAAATCCAAAAATGCAGCCGGG + Intronic
1147285193 17:39397016-39397038 AAAAATCTTAAAATGCAGCATGG - Intronic
1147911728 17:43860030-43860052 AGAAATGCTAAGATGAAGCCTGG - Intronic
1149530376 17:57390332-57390354 GAACATTCTAATATGCAGCCAGG - Intronic
1149554715 17:57565163-57565185 AAAAATCCTTAGATGCAGATGGG - Intronic
1150905866 17:69336512-69336534 GAGAATCCTAAGAAAGAGCCAGG + Intergenic
1153311898 18:3685264-3685286 AAAAATCCAAAGATGGGGCCTGG + Intronic
1153822250 18:8842326-8842348 GATGATTCTAAGATGCAGCCAGG - Intergenic
1154986389 18:21555379-21555401 GAAAATCCTAATATGAAACATGG + Intronic
1155252396 18:23964953-23964975 GTAAAACCAAAGAGGCAGCCTGG + Intergenic
1155404208 18:25469746-25469768 TAAAATCCTAAAAAGGAGCCTGG + Intergenic
1158319921 18:56251322-56251344 CAAAATTCTAAGATCCTGCCAGG + Intergenic
1159532948 18:69678323-69678345 GAAAATGCTAAGGTACAACCCGG + Intronic
1161306306 19:3570728-3570750 CATTGTCCTAAGATGCAGCCCGG - Intronic
1162852876 19:13444840-13444862 TAAAATCCAATGATGCGGCCCGG + Intronic
1164437536 19:28244368-28244390 GAAAAGCCTAAGATGAAGCAAGG - Intergenic
1164890833 19:31821760-31821782 GAAAATTTTAAAATGTAGCCAGG + Intergenic
1168118380 19:54238959-54238981 GAAACCCCCAAGATGCAGCCGGG - Exonic
1168127490 19:54294037-54294059 GAAGCCCCTAAGATGCAGCTAGG - Intergenic
1202681766 1_KI270712v1_random:11817-11839 GAAACTCCCTTGATGCAGCCAGG - Intergenic
926206464 2:10837441-10837463 GAAAAAAATAAGATGAAGCCAGG + Intronic
927264565 2:21130378-21130400 GAAAATCCTAAGTTGAATCATGG - Intronic
931605620 2:64049431-64049453 AAAAATCCCAAATTGCAGCCGGG - Intergenic
931607872 2:64069952-64069974 GAAAAGCCTAAGTTTCAGGCCGG + Intergenic
935036307 2:99377820-99377842 GAAAATCATAATATGTAGCAAGG - Intronic
936694695 2:114931752-114931774 GAAGATCCTGACATGCAGCTTGG - Intronic
937613414 2:123891664-123891686 AAAAATCCTAAAAAGCAGCAAGG - Intergenic
938278426 2:130048537-130048559 TCATATCCTAAGAGGCAGCCAGG + Intergenic
938329402 2:130439396-130439418 TCATATCCTAAGAGGCAGCCAGG + Intergenic
938360546 2:130682107-130682129 TCATATCCTAAGAGGCAGCCAGG - Intergenic
938436949 2:131288815-131288837 TCATATCCTAAGAGGCAGCCAGG - Intronic
939124323 2:138157284-138157306 GTAAATTCTAAGATGCTTCCAGG + Intergenic
940107899 2:150118627-150118649 GAAACTCCTAGAGTGCAGCCAGG - Intergenic
940159405 2:150695261-150695283 CAAAATCATAAGATGAAGCTAGG - Intergenic
942161007 2:173187078-173187100 GAAAAAGCCAAGCTGCAGCCAGG + Intronic
943277878 2:185891264-185891286 TAAAATCCTCAGCTTCAGCCAGG - Intergenic
945230771 2:207587230-207587252 AAAAATCCAAAAATTCAGCCAGG + Intronic
947002925 2:225478021-225478043 GAAAACCCTGAGTTTCAGCCAGG + Intronic
947112187 2:226730584-226730606 GATCATGCTAATATGCAGCCAGG + Intergenic
948535405 2:238642808-238642830 GAAAATACTAAGAGGCATCCTGG + Intergenic
1169212747 20:3776971-3776993 GTAAATCCTGAGATCCAGCTGGG - Intergenic
1169548900 20:6681008-6681030 CAAAAGCCTCAGCTGCAGCCTGG - Intergenic
1172225284 20:33301447-33301469 GAAATTCCTATGATGTGGCCTGG - Intronic
1175442647 20:59002248-59002270 CTAAATCCCAAGGTGCAGCCAGG + Intronic
1177484355 21:21737582-21737604 GAAAGTCCTAAAATGCAGTGTGG - Intergenic
1177726092 21:24970319-24970341 GAAAAACCTAAGAGGCATCCTGG + Intergenic
1178484976 21:33013359-33013381 GAAGATGAGAAGATGCAGCCAGG - Intergenic
1179820320 21:43933497-43933519 GAAAATGTCAAGAAGCAGCCAGG - Intronic
1181473925 22:23157126-23157148 GAAAACCGGGAGATGCAGCCTGG - Intronic
1181910443 22:26234212-26234234 GAACTTCCCAAGATGCAGCAAGG - Intronic
1182489388 22:30660728-30660750 GAAAATCTTAAAAAGCAGCTGGG + Intronic
1182646180 22:31811363-31811385 GAAAAGCATAAGAACCAGCCAGG - Intronic
1183144884 22:35981345-35981367 AAAAATCCAAACATTCAGCCAGG + Intronic
1183718713 22:39549715-39549737 TCAAATCCTAAAAAGCAGCCAGG - Intergenic
1184808415 22:46811781-46811803 GAAAAGCCAAAAATGCAGCTGGG + Intronic
949934787 3:9108295-9108317 GAAGATTCTAATGTGCAGCCAGG + Intronic
952593515 3:34987640-34987662 GAAAACCCTAAAATGCCTCCTGG + Intergenic
953789578 3:45937110-45937132 GAAAACACTAAGTTGCAGTCAGG - Intronic
955015087 3:55062407-55062429 GAAAATGAGAAGATACAGCCAGG - Intronic
955600065 3:60635630-60635652 GAAAATACTAAGAGTCAGCCAGG - Intronic
956271224 3:67449329-67449351 GAAAATCTGAACATGCAGACAGG + Intronic
956643716 3:71436303-71436325 GAAAATCCTAAGATGCAGCCTGG + Intronic
958270599 3:91494335-91494357 GAGAATCCTAACAGGTAGCCAGG + Intergenic
960250520 3:115446785-115446807 TAAAATGCTAATATGCAGTCAGG + Intergenic
961051782 3:123752786-123752808 GATGATTCTAAAATGCAGCCGGG - Intronic
962662805 3:137621251-137621273 GTAAATCCTAAGATGTATCTAGG - Intergenic
963295061 3:143537285-143537307 AAAAATTCTAACATGCACCCAGG + Intronic
965413293 3:168359690-168359712 GAAAAATCTAACATGCATCCTGG + Intergenic
965798798 3:172469547-172469569 TAAAAACCTCTGATGCAGCCAGG + Intergenic
966611912 3:181875936-181875958 GAAAATTCTCAGCTGGAGCCTGG - Intergenic
968970500 4:3791211-3791233 GAAATCCCTAAGAGGGAGCCTGG - Intergenic
970913931 4:21310517-21310539 CTCAATCCTAAGATTCAGCCAGG - Intronic
971917588 4:32893196-32893218 AAAAGTGGTAAGATGCAGCCGGG + Intergenic
975214283 4:71736026-71736048 TATAATTCTAAGATGCAGCTAGG + Intergenic
975569888 4:75804512-75804534 GGAGATTCTAATATGCAGCCAGG - Intronic
976656084 4:87490010-87490032 GACAATTCTAATGTGCAGCCAGG - Intronic
978420635 4:108529055-108529077 GAAAATCCTAAGAGGCCCCTGGG + Intergenic
981375472 4:144010084-144010106 GAAAATTCTAACCTGCAGTCAGG + Intronic
982393378 4:154890524-154890546 GAAAATACTAATATGCACCAAGG + Intergenic
982855573 4:160378208-160378230 GAAAATCCTCAAATACAGACAGG - Intergenic
986499654 5:8385554-8385576 GATGAGTCTAAGATGCAGCCAGG - Intergenic
991481161 5:67081599-67081621 GATAATTCTAATGTGCAGCCAGG - Intronic
992199373 5:74368705-74368727 GGAAATCCTAATGTGCAGGCAGG - Intergenic
995422502 5:111982905-111982927 GATAATTCTAATATGCAACCAGG - Intronic
1002505489 5:179676595-179676617 GAAAATTTTAAAATCCAGCCGGG - Intergenic
1004177038 6:13349069-13349091 GGTGATCCTAAGATGCAGCCAGG + Intergenic
1004582637 6:16969346-16969368 TAAAAGCCTAAGAAGCAGCAAGG - Intergenic
1004999461 6:21226036-21226058 GAGAATCCTCAGATGGAGCTGGG + Intronic
1006453324 6:34117848-34117870 GGAAATACATAGATGCAGCCAGG + Intronic
1006505631 6:34486823-34486845 GAAAATTCTAATGTGCAGCCAGG - Intronic
1006756260 6:36418280-36418302 GATAATTCTAACATGCACCCAGG + Intronic
1006988168 6:38190871-38190893 GAAAAGGCTAAGAAGCAGCAAGG - Intronic
1008984544 6:57527009-57527031 GAGAATCCTAACAGGTAGCCAGG - Intronic
1009172592 6:60419900-60419922 GAGAATCCTAACAGGTAGCCAGG - Intergenic
1009192468 6:60645955-60645977 GAAGATCCTTAGATGGATCCAGG - Intergenic
1011030481 6:82917518-82917540 GAAATTCCTAAGAGGCATGCAGG + Intronic
1011684273 6:89811852-89811874 GAAAATACAAAGGTGTAGCCAGG - Intronic
1012954050 6:105549182-105549204 CAAAAATTTAAGATGCAGCCGGG - Intergenic
1013121199 6:107142860-107142882 GAAAATGGTAAAATACAGCCAGG + Intergenic
1018909429 6:168093510-168093532 TAAATTCCTAGGATGCTGCCCGG - Intergenic
1020122078 7:5510331-5510353 AAAAAACCCAAGTTGCAGCCTGG + Intronic
1020831376 7:13099942-13099964 GAAGATACTAAGATCCATCCAGG - Intergenic
1021317112 7:19161814-19161836 GGAAATTCTAATATGCAGCCAGG - Intergenic
1022671422 7:32459803-32459825 GAATATCCAAAGATGCAGCTGGG + Intergenic
1023248811 7:38235613-38235635 CATAATTCTAATATGCAGCCAGG - Intergenic
1024112089 7:46157796-46157818 GAAAGTCCTAACATGCATCTGGG + Intergenic
1025787040 7:64653036-64653058 GACAATCCTAACATTCAGCTGGG - Intergenic
1026371122 7:69700536-69700558 GAAAATCCCCAGAGGCAGCCAGG - Intronic
1028313581 7:89370539-89370561 GAAAATCCAAAAATTTAGCCGGG + Intergenic
1028794749 7:94890497-94890519 GGTAATCCTAATATGCAGCCAGG - Intergenic
1030265239 7:107614347-107614369 AAAAAACCTAGCATGCAGCCAGG - Intronic
1031884878 7:127235786-127235808 GGCAATGCTAACATGCAGCCAGG + Intronic
1032971685 7:137171918-137171940 GAAAATCATACAATGCAGGCTGG + Intergenic
1033110533 7:138570436-138570458 GAAAATACTAAGCTACAGACTGG - Intronic
1036204173 8:6793340-6793362 GAAAATAAAAAGATGCACCCTGG + Intergenic
1037928877 8:22865630-22865652 GAAAAGCCTCGGATGCTGCCCGG + Intronic
1038806962 8:30802944-30802966 GAGACTCCAAATATGCAGCCAGG + Intronic
1039182305 8:34880401-34880423 GAAAATCCCAGGACTCAGCCAGG - Intergenic
1040786587 8:51172818-51172840 GATAATCCCAAAATGCATCCAGG - Intergenic
1040846701 8:51850500-51850522 GATAATCCTAACATGCAACTGGG + Intronic
1043591969 8:81843146-81843168 GCAAATCCCAAGATTCAGACCGG + Intergenic
1046226074 8:111283048-111283070 GAAAATAGTAACATGAAGCCAGG - Intergenic
1047314969 8:123724446-123724468 GACAATTCTAACAAGCAGCCAGG + Intronic
1047786493 8:128158551-128158573 GAGAATCCTAAGTTGCATCAGGG - Intergenic
1048370322 8:133771343-133771365 GACAATCCTAGGATCCCGCCTGG - Intergenic
1050529418 9:6575333-6575355 GGTAATTCTAACATGCAGCCAGG + Intronic
1050725753 9:8646156-8646178 GAAAATTCCAACATGCAACCAGG + Intronic
1052104217 9:24492409-24492431 CAAAATCCAAAGATGGAGCGAGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1055022223 9:71682692-71682714 GATGATTCTAATATGCAGCCAGG - Intergenic
1056365287 9:85898767-85898789 GAAACTCTTAAAAAGCAGCCAGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1059171686 9:112130726-112130748 GAAAATCCTACAAAGTAGCCAGG + Intronic
1060297284 9:122351306-122351328 GGCAATTCTAAGAGGCAGCCTGG - Intergenic
1060476985 9:123994337-123994359 GAAAATCAGAAGATACATCCTGG - Intergenic
1062099518 9:134720939-134720961 TGAGATTCTAAGATGCAGCCAGG - Intronic
1187215358 X:17270644-17270666 GGTAATCCTGATATGCAGCCAGG - Intergenic
1187385479 X:18844624-18844646 GAAAGTTCTAAGTTGCAGGCCGG - Intergenic
1187498344 X:19815215-19815237 GATGAGACTAAGATGCAGCCTGG + Intronic
1187757617 X:22545048-22545070 GAGAATTCTGACATGCAGCCTGG - Intergenic
1189126894 X:38457835-38457857 GATAATTCTAATATGCAGCCAGG + Intronic
1189211687 X:39289265-39289287 GCCAATCCTAAGATGGAGACTGG + Intergenic
1189513959 X:41692352-41692374 GAGGATTCTAATATGCAGCCAGG + Intronic
1189534100 X:41918961-41918983 GATGATTCTAATATGCAGCCAGG + Intronic
1192068493 X:67911824-67911846 GAAAATTCCAATATGCAGCCAGG + Intergenic
1199431475 X:147765595-147765617 GGAAAACCTAAGAGGCATCCTGG - Intergenic
1200412025 Y:2870330-2870352 AAAAATCCAAAAATGGAGCCAGG + Intronic
1201716925 Y:17055130-17055152 AAAAATCCTAAGATGGAAACAGG + Intergenic