ID: 956643852

View in Genome Browser
Species Human (GRCh38)
Location 3:71437571-71437593
Sequence GACCTGGGGTGTTCCTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 337}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956643852_956643856 4 Left 956643852 3:71437571-71437593 CCATCACAGGAACACCCCAGGTC 0: 1
1: 0
2: 1
3: 15
4: 337
Right 956643856 3:71437598-71437620 TGAGTGTTCCCCAAAGAAGAAGG 0: 1
1: 1
2: 1
3: 11
4: 193
956643852_956643860 26 Left 956643852 3:71437571-71437593 CCATCACAGGAACACCCCAGGTC 0: 1
1: 0
2: 1
3: 15
4: 337
Right 956643860 3:71437620-71437642 GTATCACAGACACTCAGCAATGG 0: 1
1: 0
2: 3
3: 14
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956643852 Original CRISPR GACCTGGGGTGTTCCTGTGA TGG (reversed) Intronic
900147672 1:1165526-1165548 GCCCTGTGGGGTTCCTGAGAAGG + Intergenic
900582209 1:3414853-3414875 TCCCTGGGGTGGCCCTGTGAGGG - Intronic
900814810 1:4835363-4835385 GATCCTGGGTGTGCCTGTGAGGG - Intergenic
901087892 1:6622792-6622814 GACCTGGGAGGCCCCTGTGAGGG + Exonic
901117238 1:6857004-6857026 AAACTAGGGTGTCCCTGTGAAGG + Intronic
901453747 1:9351904-9351926 GCCCTGGGGTGCCCTTGTGAAGG + Intronic
902333267 1:15741295-15741317 GACTTGGGGTGTGGCTGGGAGGG - Exonic
902606760 1:17573406-17573428 CATCAGGGGTGTCCCTGTGATGG - Intronic
905526393 1:38643289-38643311 GCCCTGGTGTGTTCTTGAGAAGG + Intergenic
906930613 1:50166200-50166222 GACAAGGGGTGGACCTGTGATGG - Intronic
907390481 1:54154936-54154958 GTCCCGGGGTCTTCGTGTGAAGG - Intronic
908025726 1:59949851-59949873 GTCCTGGGGTGGTACTGAGAGGG - Intergenic
908618386 1:65948630-65948652 GACCCTGGGTGTGTCTGTGAGGG - Intronic
909047635 1:70729175-70729197 GGCCTGGGGTATTACAGTGAGGG - Intergenic
909173070 1:72319059-72319081 GATCTTGGGTGTGTCTGTGATGG - Intergenic
909258466 1:73455131-73455153 GTCCTGGGGTGATCCTGTGGAGG + Intergenic
910655608 1:89615222-89615244 GAGATGGGGTTTTCCTGTGTTGG - Intergenic
910830783 1:91460986-91461008 GATCCTGGGTGTTTCTGTGAGGG - Intergenic
911543699 1:99189979-99190001 TAACTGAGGTGTTGCTGTGAAGG - Intergenic
911667257 1:100567633-100567655 GACCCTGGGTGTGTCTGTGAGGG + Intergenic
911686875 1:100787486-100787508 GACATGGGGTTTTGCTGTGTTGG - Intergenic
912487374 1:110039765-110039787 GGCCTGGGGTGCTCCTCAGAAGG + Intronic
913559468 1:120003022-120003044 GATCTTGGGTGTGTCTGTGAAGG + Intronic
913638392 1:120787518-120787540 GATCTTGGGTGTGTCTGTGAAGG - Intergenic
914280057 1:146162444-146162466 GATCTTGGGTGTGTCTGTGAAGG + Intronic
914541101 1:148613383-148613405 GATCTTGGGTGTGTCTGTGAAGG + Intronic
914625539 1:149457863-149457885 GATCTTGGGTGTGTCTGTGAAGG - Intergenic
915004124 1:152621193-152621215 GACCTTTGATGGTCCTGTGATGG - Intergenic
915893386 1:159792044-159792066 GACCTGGGGTGTTCCTCTGTGGG - Intergenic
916380553 1:164206245-164206267 TACCTTGGGTGTGTCTGTGAGGG + Intergenic
916527679 1:165627077-165627099 GATCCTGGGTGTGCCTGTGAGGG + Intergenic
917462270 1:175242309-175242331 GACCCTGGGTGTGTCTGTGAGGG + Intergenic
917463009 1:175248594-175248616 GACCCTGGGTGTTTCTGTGAGGG + Intergenic
918253287 1:182724033-182724055 GATCTTGGGTGTGTCTGTGAGGG + Intergenic
919044909 1:192439031-192439053 GACTTTGTTTGTTCCTGTGATGG - Intergenic
921620056 1:217315436-217315458 GACTTGGGGTGGACTTGTGATGG + Intergenic
921899840 1:220438569-220438591 GATCTTGGATGTTCCTGTGATGG + Intergenic
1063519801 10:6730903-6730925 GGCCAGGGGTGATTCTGTGAGGG + Intergenic
1064362629 10:14679706-14679728 GTCCCGGGGTGTGTCTGTGAGGG + Intronic
1064517283 10:16165416-16165438 GACAAGGGGTGGTCTTGTGATGG - Intergenic
1064580067 10:16785057-16785079 GATCCTAGGTGTTCCTGTGAGGG + Intronic
1067400415 10:45968382-45968404 AACCAGGAGTGTTCCAGTGATGG + Intergenic
1067465372 10:46494400-46494422 CTCCTGGTGTGGTCCTGTGAAGG - Intergenic
1067621815 10:47890201-47890223 CTCCTGGTGTGGTCCTGTGAAGG + Intergenic
1067868738 10:49937684-49937706 AACCAGGAGTGTTCCAGTGATGG + Intronic
1071306612 10:84304761-84304783 GAGGTGTGGTGCTCCTGTGAAGG - Intergenic
1072948301 10:99830500-99830522 TTCCTGGGCTTTTCCTGTGAGGG + Intronic
1075609312 10:123838896-123838918 CTCCAGGGGTGTTCCTGTGAGGG + Intronic
1076078578 10:127557373-127557395 GACCCTGGGTGTGTCTGTGAGGG + Intergenic
1076865974 10:133166396-133166418 AGCCTTGTGTGTTCCTGTGAGGG + Intronic
1077191320 11:1256984-1257006 GTCCTTGAGTGATCCTGTGATGG + Intronic
1078092794 11:8277766-8277788 GACCTGGAGTGATCCTGGGCTGG + Intergenic
1078734498 11:14007607-14007629 GACCCTGGGTGTGTCTGTGAGGG - Intronic
1079655935 11:22986855-22986877 GATCCTGGGTGTGCCTGTGAGGG - Intergenic
1079990938 11:27246227-27246249 GACCCTGGGTGTGTCTGTGAGGG - Intergenic
1081308098 11:41537880-41537902 GACCAGGGTTGTTGCAGTGAAGG + Intergenic
1081433106 11:42998068-42998090 GATCTTGGGTGTGTCTGTGAGGG - Intergenic
1081701267 11:45154419-45154441 GACCTGTGAGGTTCCTGGGATGG - Intronic
1084656023 11:70519095-70519117 GAGATGGGGTCTTCCTGTGTTGG + Intronic
1085619283 11:78025470-78025492 GATCCTGGGTGTGCCTGTGAGGG - Intronic
1086919863 11:92573988-92574010 TAACTGGCGTGTTCCTCTGAAGG + Intronic
1088105019 11:106197162-106197184 TACTTGGGGTCTACCTGTGAGGG + Intergenic
1088469541 11:110178005-110178027 GACCTGGGATGTCACTGTGTGGG - Intronic
1089366969 11:117926384-117926406 GAGCTGGGCAGTTCCTGAGATGG - Intronic
1089835249 11:121364828-121364850 GATTTGGGGTGTGTCTGTGAGGG - Intergenic
1089956144 11:122573262-122573284 GAGTTGGGGTGTGCCTGTGAGGG - Intergenic
1091342334 11:134825534-134825556 GATCTTGGGTGTGTCTGTGAGGG - Intergenic
1092006991 12:5078220-5078242 GACCTTGGGTGCTCCTCTGTGGG + Intergenic
1093031502 12:14293277-14293299 GACAAGGGGTGAACCTGTGATGG - Intergenic
1093645571 12:21582227-21582249 GATCTTGGGTGTGTCTGTGAGGG + Intronic
1094062078 12:26325225-26325247 GATCTTGGGTGTGTCTGTGAGGG + Intergenic
1094102082 12:26775592-26775614 GATCTTGGGTGTATCTGTGAGGG + Intronic
1094298491 12:28935121-28935143 GACCTGAGATTTTTCTGTGAGGG + Intergenic
1094762948 12:33556431-33556453 GATCCTGGGTGTGCCTGTGAGGG + Intergenic
1096185928 12:49580577-49580599 GAGCTGGTGAGTTCCTGGGAAGG - Intronic
1096953687 12:55503415-55503437 GATCTTGGGTGTGTCTGTGAGGG - Intergenic
1098367781 12:69723187-69723209 GACCCTGGGTGTGTCTGTGAGGG - Intergenic
1098659168 12:73071550-73071572 AACCTGATGGGTTCCTGTGATGG + Intergenic
1098718321 12:73860919-73860941 GACCCTGGGTGTGTCTGTGAGGG - Intergenic
1098806016 12:75020715-75020737 GACAAGGGGTGTACTTGTGATGG + Intergenic
1098937636 12:76498983-76499005 GATCCTGGGTGTTTCTGTGAGGG + Intronic
1099375184 12:81890330-81890352 GATCTTGGGTGTGTCTGTGAGGG + Intergenic
1099859850 12:88212318-88212340 GATCTTGGGTGTGTCTGTGAGGG - Intergenic
1100544905 12:95592381-95592403 GACCAGGGGTAGACCTGTGATGG + Intergenic
1102036466 12:109773174-109773196 GACCTGGGGTGATCTTCTAATGG - Intergenic
1104214842 12:126725586-126725608 GCCCTGGGGTGCTCCACTGAAGG + Intergenic
1104688948 12:130809999-130810021 GACCTGGGGTCTTGCTGTGCTGG - Intronic
1109058415 13:57581905-57581927 TTCCTGGTGTGTTCCTGTGGTGG + Intergenic
1110833833 13:80062206-80062228 GACCCTGGGTGTGTCTGTGAGGG - Intergenic
1112588650 13:100743463-100743485 GACCTGGGCTTTTCTTGTAATGG - Intergenic
1113427574 13:110222115-110222137 GCCCTGGGGTGCTGCTGTGTGGG - Intronic
1113841201 13:113362824-113362846 GTCCTGGGGGCTTCCTGAGAAGG - Intronic
1114258928 14:21024137-21024159 GACCTGGGGTCTTTCAGGGACGG + Exonic
1114323835 14:21569369-21569391 GATCCTGGGTGTGCCTGTGAGGG - Intergenic
1114540164 14:23449443-23449465 GACCTGGGGGGAGACTGTGAAGG - Intergenic
1114567586 14:23644003-23644025 GACCTGTGTTGCTTCTGTGAGGG + Intronic
1117002180 14:51382093-51382115 GCCCTGGGGTGTTCATGTGCTGG + Intergenic
1117171618 14:53106470-53106492 GAGCTGGGGTTTTGCTGTGTTGG - Intronic
1117634426 14:57726715-57726737 GACAAGGGGTGGACCTGTGATGG + Intronic
1117811385 14:59550886-59550908 GATCTTGGGTGTGTCTGTGAGGG - Intronic
1118440276 14:65805796-65805818 GATCTTGGGTGTGTCTGTGAGGG - Intergenic
1119146372 14:72318413-72318435 GATCTTGGGTGTGTCTGTGAGGG - Intronic
1119159186 14:72438976-72438998 GGCCTTGGCTGTTCCTCTGATGG + Intronic
1120989379 14:90361776-90361798 GAACTGGAGTGTTCCTGAGTTGG + Intergenic
1121446122 14:93980352-93980374 GTCCTGGGGCTTTCCTGTGGTGG - Intergenic
1123789615 15:23707734-23707756 GAACTGAAGTGTGCCTGTGATGG - Intergenic
1126283202 15:46980543-46980565 GATCTTGGGTGTGTCTGTGAGGG + Intergenic
1127896731 15:63306935-63306957 CACCTTGGGTATTCCTGTAAAGG - Exonic
1128324622 15:66716241-66716263 GGTCTGGGGTGATCCTGAGATGG + Intronic
1128663902 15:69524384-69524406 CACCTGTGGTGTTCTTGTCAGGG - Intergenic
1128861476 15:71077766-71077788 GGCCTGGGATGTTCCTATCAAGG - Intergenic
1129656615 15:77528994-77529016 CCCCTGGGCTGTTCCTGGGAAGG + Intergenic
1129834107 15:78691274-78691296 GACCTGGGAGGGTCCTGTGGGGG - Intronic
1130273134 15:82462779-82462801 GACCTGGACTCTGCCTGTGAGGG + Intergenic
1130273570 15:82464887-82464909 GACTTGGGCTGTACCTGTGGTGG + Intergenic
1130465486 15:84190150-84190172 GACCTGGACTCTACCTGTGAGGG + Intergenic
1130465921 15:84192258-84192280 GACTTGGGCTGTACCTGTGGTGG + Intergenic
1130486773 15:84402546-84402568 GACTTGGGTTGTGCCTGTGGTGG - Intergenic
1130487206 15:84404670-84404692 GACCTGGACTCTGCCTGTGAGGG - Intergenic
1130498344 15:84481278-84481300 GACTTGGGCTGTACCTGTGGTGG - Intergenic
1130498779 15:84483386-84483408 GACCTGGACTCTACCTGTGAGGG - Intergenic
1130587775 15:85194745-85194767 GACCTGGACTCTGCCTGTGAGGG + Intergenic
1130588210 15:85196854-85196876 GACTTGGGCTGTACCTGTGGTGG + Intergenic
1131735177 15:95324487-95324509 GACATAGAGTGTTCCCGTGAAGG - Intergenic
1132217913 15:100080955-100080977 GACTTGGGGTGGACTTGTGATGG + Intronic
1132985976 16:2767852-2767874 GACCTCGGCTGATCCTGTGCTGG - Exonic
1135889789 16:26346774-26346796 GACCTGGGGTTTCCCTTTTAAGG - Intergenic
1137010582 16:35316362-35316384 AACCTGTGATGTCCCTGTGATGG + Intergenic
1137570536 16:49563468-49563490 GACCTTGTGTGTTGCTGTGAAGG - Intronic
1137854022 16:51775153-51775175 GATCTTGGGTGTGTCTGTGAGGG - Intergenic
1138238055 16:55402289-55402311 GACCTGGGATTTTTCTCTGAGGG - Intronic
1139217840 16:65146502-65146524 TTCCTGGGGTGTGTCTGTGAGGG - Intergenic
1139424343 16:66869870-66869892 GAACTGGGTTGTTCAGGTGAAGG + Intronic
1146238334 17:31188629-31188651 GATCCTGGGTGTGCCTGTGAGGG + Intronic
1148111274 17:45145806-45145828 GTCCTGGGGTTTACCAGTGATGG + Intergenic
1148179714 17:45595522-45595544 GATCTTGGGTGTGTCTGTGAGGG - Intergenic
1149591545 17:57833373-57833395 GTCCTGGGGTGCTACTGGGATGG - Intergenic
1150142883 17:62744781-62744803 GACCTCAGGTGATCCTATGAAGG - Intronic
1150989177 17:70235938-70235960 GATCCTGGGTGTTTCTGTGAGGG + Intergenic
1151519417 17:74617557-74617579 GACCTGGGTGTTTCCTGGGAGGG + Intronic
1151880759 17:76893163-76893185 AACCTGGGGTGTGTCTGTGTGGG - Intronic
1152127602 17:78456639-78456661 GACCCGTGGTGTGCCTCTGAGGG - Intronic
1154085636 18:11302982-11303004 GGGCTGGGGTTTTCCTGTGGAGG - Intergenic
1156394150 18:36682766-36682788 GACATGGGGTTTTACTGTGTTGG + Intronic
1156554890 18:38056154-38056176 GATCTTGGGTGTGTCTGTGAGGG - Intergenic
1156576880 18:38327415-38327437 GATCTTGGGTGTGTCTGTGAGGG - Intergenic
1156990020 18:43398369-43398391 ACCCTGGGGTGTGTCTGTGAGGG - Intergenic
1158859472 18:61578402-61578424 GACCTGGAGTGTTACTGTAGAGG - Intergenic
1159292059 18:66435692-66435714 AACCCGGGGTGTTTCTGTGAGGG - Intergenic
1160100196 18:75913633-75913655 GACAAGGGGTGGACCTGTGATGG + Intergenic
1160829717 19:1098106-1098128 CACCTGGAGTGTTCCTGGCAGGG + Intergenic
1161042398 19:2117062-2117084 GACCTGGTGAGTCCGTGTGAGGG + Intronic
1161056189 19:2191674-2191696 GACCTGGGGTCTTCCTCCGCGGG - Intronic
1161059266 19:2206973-2206995 GACCAGGGGTGCTCCTGGCATGG - Intronic
1161621293 19:5298700-5298722 GAGCTGGGGCGTGCCTGTGGTGG - Intronic
1163677575 19:18662994-18663016 GACCTGGTGTTTGCCTGGGAGGG - Intronic
1164417815 19:28060951-28060973 CACCAGGGGTGTTCCTGATAAGG - Intergenic
1165097876 19:33419634-33419656 GACCTCGGGGCTTGCTGTGAAGG + Intronic
1165272797 19:34724895-34724917 GACCTGGGGTTTTTCAGAGAAGG - Intergenic
1165482486 19:36072917-36072939 GGCCTGGGGTCTCCCTATGAAGG - Intronic
1167592026 19:50409298-50409320 GCCCTGGGGTGTCCCAGTGAGGG - Intronic
1167899581 19:52609491-52609513 GAGATGGGGTTTTACTGTGATGG - Intronic
925498797 2:4481957-4481979 GACCCTGGGTGTGTCTGTGAGGG + Intergenic
926061543 2:9807955-9807977 GACCTGGGCAATGCCTGTGAGGG - Intergenic
926180307 2:10637013-10637035 GACATGGGGTTTTGCTGTGTTGG - Intronic
926468277 2:13218883-13218905 GATCCGGGGTGTGTCTGTGAGGG + Intergenic
926682959 2:15677815-15677837 GACCTGGGCTGTACCGGGGAGGG + Intergenic
926810092 2:16748313-16748335 GATCTTGGGTGTGTCTGTGAGGG - Intergenic
927518465 2:23685673-23685695 GACCTGAGGTGTCCATGAGATGG - Intronic
929993507 2:46810283-46810305 GACCTGGGGTGTTGCTGGTGGGG + Intergenic
931631391 2:64304309-64304331 GATGTGGGGTGTGGCTGTGAGGG - Intergenic
932883655 2:75527819-75527841 GCCCTGGTATGTTCCTGTGGTGG - Intronic
937206042 2:120237815-120237837 GACATGGGGCGTTTCTGAGAAGG - Intergenic
938825621 2:135002872-135002894 AACCTGGGGCCTTCCTGTTATGG + Intronic
939870234 2:147518733-147518755 GATCTTGGGTGTGTCTGTGAGGG + Intergenic
940234417 2:151494477-151494499 GACCTGTGGTGTTCCTCAAAAGG + Intronic
942404670 2:175641703-175641725 GACATGGGGTTTTGCTGTGTTGG + Intergenic
942830231 2:180231573-180231595 GATCTTGGGTGTGTCTGTGAGGG + Intergenic
945726244 2:213474889-213474911 AATCTGGGGTGTGTCTGTGAGGG - Intronic
947255944 2:228163948-228163970 GTTCTTGGGTGTGCCTGTGAGGG + Intronic
947848429 2:233264349-233264371 GAGCTGGTATGTTCCTGTGGTGG + Intronic
948053140 2:234993052-234993074 AGGCTGGGGAGTTCCTGTGAAGG + Intronic
948782744 2:240333224-240333246 GCTCTGAGGTCTTCCTGTGATGG - Intergenic
1170437897 20:16349402-16349424 GACCTTGGGATTTCCTGTCATGG - Intronic
1171308210 20:24124046-24124068 TACCTGGGGTGTTGCGGTAATGG + Intergenic
1172313326 20:33934431-33934453 GATCCTGGGTGTGCCTGTGAGGG + Intergenic
1172454675 20:35059471-35059493 GACATGGGGTCTTGCTGTGTTGG - Intronic
1173551775 20:43937649-43937671 GACCTGGGGTGTGGCTGGGGAGG - Intronic
1176148252 20:63574843-63574865 GGCCTGGGGTCTCCCTGAGATGG - Intergenic
1176345680 21:5744114-5744136 GAATTTGGGTGTTCCTGTGTTGG + Intergenic
1176352494 21:5864698-5864720 GAATTTGGGTGTTCCTGTGTTGG + Intergenic
1176499147 21:7580341-7580363 GAATTTGGGTGTTCCTGTGTTGG - Intergenic
1176540001 21:8142184-8142206 GAATTTGGGTGTTCCTGTGTTGG + Intergenic
1176558952 21:8325229-8325251 GAATTTGGGTGTTCCTGTGTTGG + Intergenic
1177126946 21:17206162-17206184 TTCCTGTGTTGTTCCTGTGATGG - Intergenic
1177408729 21:20702438-20702460 GACCTGCGGTGTGTCCGTGAGGG - Intergenic
1178370709 21:32024987-32025009 GATCTTGGGTGTGTCTGTGAAGG - Intronic
1178703524 21:34853998-34854020 GAGATGGGGTTTTCCTGTGTTGG + Intronic
1179004435 21:37498732-37498754 GAACTGGTGTTTTCTTGTGAAGG - Intronic
1179847445 21:44119337-44119359 GACCTGGGGTGGGCCTGAGCCGG + Intronic
1180693940 22:17739940-17739962 CAACTGGGGTTTTCCTGAGACGG - Intronic
1182051554 22:27316320-27316342 AACTTGGGGTTTTCCTCTGAGGG - Intergenic
1182193566 22:28490182-28490204 GATCTTGGGTGTGTCTGTGAGGG - Intronic
1184963783 22:47951578-47951600 GACCCTGGGTGTGTCTGTGAGGG - Intergenic
1185345306 22:50308109-50308131 GACCTGCGGGGTTCCTGTGGGGG - Intergenic
1203244948 22_KI270733v1_random:58542-58564 GAATTTGGGTGTTCCTGTGTTGG + Intergenic
949140005 3:620560-620582 ATCCTGGGGTGTGTCTGTGAGGG + Intergenic
949828982 3:8193964-8193986 GATCTGGGGTGTTCCAGTGTTGG + Intergenic
950448658 3:13053501-13053523 GACCTTGTGTGTTCCTGAGACGG + Intronic
951112975 3:18827638-18827660 GATCTTGGGTGTGTCTGTGAGGG - Intergenic
951970476 3:28439480-28439502 GATCTTGGGTGTGTCTGTGAGGG - Intronic
953225019 3:41010570-41010592 GATCTTGGGTGTGTCTGTGAGGG - Intergenic
954800405 3:53183824-53183846 GACCTAGAGAGTCCCTGTGAGGG + Intronic
956643852 3:71437571-71437593 GACCTGGGGTGTTCCTGTGATGG - Intronic
956836728 3:73101867-73101889 GACCTGTGGTGTACCTGTTCCGG + Intergenic
957277677 3:78109764-78109786 GATCCTGGGTGTGCCTGTGAGGG - Intergenic
958158922 3:89791077-89791099 GAGATGGGGTTTTCCTGTGTTGG - Intergenic
958499376 3:94886416-94886438 GATCTTGGGTGTGTCTGTGAGGG + Intergenic
959377173 3:105601468-105601490 GACCCTGGGTGTGTCTGTGAGGG - Intergenic
959915640 3:111814160-111814182 GATCTTGGGTGTGTCTGTGAGGG + Intronic
961749566 3:129087326-129087348 AACCTGGGGTGTCCCAGAGAAGG + Intergenic
962501777 3:136001767-136001789 GACCCTGGGTATGCCTGTGAAGG - Exonic
965299370 3:166990549-166990571 GATCTTGGGTGTGTCTGTGAGGG - Intergenic
965318800 3:167225775-167225797 CACCTGGGATCTTCCTCTGATGG + Intergenic
965995919 3:174883246-174883268 CTCCTGGTGTGTTTCTGTGAGGG - Intronic
966218973 3:177532090-177532112 GATCTTGGGTGTGTCTGTGAGGG + Intergenic
967832094 3:193928336-193928358 GACCAGGGGTGGACTTGTGATGG + Intergenic
968950023 4:3685760-3685782 GACCTGGGGTCTCCCTGTGCAGG - Intergenic
969625998 4:8306117-8306139 CACCTGAGGTGGTCATGTGAGGG + Exonic
970270500 4:14341357-14341379 GATTTGGGGTGTGTCTGTGAGGG - Intergenic
971816792 4:31501381-31501403 GATCTTGGGTGTGTCTGTGAGGG + Intergenic
972222433 4:36971012-36971034 GATCTTGGGTGTGTCTGTGAGGG - Intergenic
973795559 4:54422482-54422504 GATCTTGGGTGTGTCTGTGAGGG + Intergenic
974456173 4:62131317-62131339 GGCCAGTGGTGTTCCTGTGCTGG - Intergenic
977528760 4:98175177-98175199 GACCCTGGGTGTGTCTGTGAGGG + Intergenic
977976029 4:103268176-103268198 GACCTGGTGTGATCCTTTGGGGG + Intergenic
979075227 4:116262162-116262184 GTTCCTGGGTGTTCCTGTGAGGG - Intergenic
980075472 4:128288518-128288540 GAGCTGGGGTCTTCCTGGAACGG + Exonic
982770926 4:159396632-159396654 GATCTTGGGTGTGTCTGTGAGGG + Intergenic
982843631 4:160223241-160223263 GACCTAGTGTGATCCTTTGATGG + Intergenic
983266536 4:165513555-165513577 GAGCTGGGCTGTTCCTCTCAGGG + Intergenic
984326093 4:178252840-178252862 GATCCTGGGTGTGCCTGTGAGGG - Intergenic
984714890 4:182916918-182916940 GGCGTGGGGTGTGCCTGGGACGG - Intronic
985534087 5:453444-453466 GACCTGGAGTGCTCCCGGGACGG + Exonic
986028226 5:3871049-3871071 GCCCTGGGGTGGACCTGTGGAGG - Intergenic
986147343 5:5090919-5090941 GACAAGGGGTGTACTTGTGATGG - Intergenic
986333194 5:6733231-6733253 GACCTGGGAAGTGCCTGGGAGGG - Intronic
987578057 5:19756013-19756035 GACAAGGGGTGTACTTGTGATGG - Intronic
987777777 5:22391687-22391709 GTCCTGAGGTTTTCCTGTGCAGG + Intronic
987957366 5:24757818-24757840 GATCCTGGGTGTCCCTGTGAGGG + Intergenic
988041914 5:25900721-25900743 TACCTTGCGTGTTCTTGTGAGGG - Intergenic
988080259 5:26405080-26405102 GATCTTGGGTGTGTCTGTGAGGG - Intergenic
988107318 5:26768865-26768887 GATCTTGGGTGTGTCTGTGAGGG + Intergenic
988232718 5:28501738-28501760 GATCGTGGGTGTTTCTGTGAGGG - Intergenic
988670639 5:33377276-33377298 GATCTTGGGTGTGTCTGTGAGGG - Intergenic
988942647 5:36161640-36161662 TACCTGGGGTGTACCACTGAAGG + Intronic
989045765 5:37271911-37271933 GATCTTGGGTGTGGCTGTGAGGG - Intergenic
992739141 5:79755471-79755493 GACATGGGGTTTTGCTGTGTTGG + Intronic
992780453 5:80122486-80122508 GATCTTGGGTGTGTCTGTGAGGG - Intronic
993321069 5:86467836-86467858 GATCATGGGTGTACCTGTGAGGG + Intergenic
994291068 5:98029553-98029575 GATCTTGGGTGTGTCTGTGAGGG - Intergenic
994353318 5:98770023-98770045 GAGCTGAGGTTTTCATGTGAAGG + Intronic
995065691 5:107859351-107859373 CACCTTGAGTGGTCCTGTGATGG - Exonic
996559313 5:124811641-124811663 GCCCAGAGGTGTTCCTTTGATGG + Intergenic
998054097 5:139059231-139059253 TTCCTGTGCTGTTCCTGTGATGG + Intronic
1000102977 5:158034512-158034534 CCCCTATGGTGTTCCTGTGATGG + Intergenic
1001010765 5:168095918-168095940 GCCCTGAGGTGTTACTCTGAGGG - Intronic
1003077900 6:2999182-2999204 AACCCGGGGGGTGCCTGTGAAGG - Intronic
1003085153 6:3054582-3054604 AACCCGGGGGGTGCCTGTGAAGG + Intergenic
1005939037 6:30547132-30547154 CACCAGGGGTGTTCCGCTGAGGG + Exonic
1007686426 6:43669836-43669858 GAGCTGGGCTGCTCCTGTGTGGG + Intronic
1007960289 6:45952721-45952743 GACCAGGTGTGATCATGTGAAGG + Intronic
1009570920 6:65382898-65382920 GACCCTGGGTGTGTCTGTGAGGG - Intronic
1010326804 6:74573838-74573860 GAGCTTGGGTGGTCCTGTGTTGG - Intergenic
1010784821 6:79988614-79988636 GATCTTGGGTGTGTCTGTGAGGG + Intergenic
1011954003 6:93002539-93002561 GATCCTGGGTGTGCCTGTGAGGG + Intergenic
1012366366 6:98445582-98445604 GATCTTGGGTGTGTCTGTGAGGG + Intergenic
1015442967 6:133270137-133270159 GACCCTGGGTGTGTCTGTGAGGG - Intronic
1015852695 6:137590035-137590057 GACCTAGTGTGGTCCTTTGAGGG - Intergenic
1017227451 6:152038362-152038384 GTCCTTGGGTGTGTCTGTGAGGG - Intronic
1017811163 6:157984851-157984873 CAGCTGTGGTTTTCCTGTGATGG + Intronic
1017855001 6:158343062-158343084 GACAAAGGGGGTTCCTGTGATGG + Intronic
1018926380 6:168209648-168209670 AGCCTCGGGTGTGCCTGTGACGG + Intergenic
1023250795 7:38258836-38258858 GACCTGCGTTGTTGCAGTGATGG + Intergenic
1025263328 7:57437460-57437482 GAGCTGGGATGTGACTGTGATGG - Intergenic
1025740456 7:64192066-64192088 GAGCTGGGATGTGACTGTGATGG - Intronic
1026457264 7:70583566-70583588 TACCTGGGAAGTTTCTGTGAAGG - Intronic
1027234060 7:76287351-76287373 GGGCTGGGGTCTTCCTCTGAGGG + Intergenic
1028532518 7:91852972-91852994 GAGCTGGTGTGATCCTGTGGAGG - Intronic
1030524243 7:110634401-110634423 GACCCTGGGTGTGCCTGTGAGGG - Intergenic
1032085399 7:128880972-128880994 GAGCTGGGGTGGGCCTGGGAGGG - Intronic
1032764037 7:134974174-134974196 GATCTTGGGTGTATCTGTGAGGG - Intergenic
1033157137 7:138966725-138966747 GATCCTGGGTGTGCCTGTGAGGG - Intronic
1033540388 7:142350543-142350565 GATCTAGGGTGCTCCTGTTATGG - Intergenic
1034150153 7:148908932-148908954 GACTTGGGTGGTTCCTGTAAGGG - Intergenic
1035394406 7:158525905-158525927 GAGCTTGGGTCTTCCTGTCAGGG - Intronic
1035974687 8:4295918-4295940 GACATGCTGTGTTCCTGAGATGG - Intronic
1039376413 8:37038696-37038718 GATCTGGGGTTTCCCTTTGATGG - Intergenic
1040296687 8:46152526-46152548 CACCTGGGGGCTTCCGGTGAGGG + Intergenic
1040829493 8:51661502-51661524 GACCTGGGGCTTTCCTCTTAAGG - Intronic
1042001516 8:64127722-64127744 GATCCTGGGTGTGCCTGTGAGGG - Intergenic
1043948137 8:86277396-86277418 GATCTTGGGTGTGTCTGTGAGGG + Intronic
1044330632 8:90916052-90916074 GTCCTTGGGTGTGTCTGTGAGGG - Intronic
1045897131 8:107233163-107233185 GACCTGGTGATTTGCTGTGAAGG + Intergenic
1046128345 8:109938959-109938981 ATCCTGGGGTGTGTCTGTGAGGG - Intergenic
1047365307 8:124205901-124205923 GTCCCTGGGTGTTTCTGTGAGGG + Intergenic
1047711559 8:127557836-127557858 GATCCTGGGTGTGCCTGTGAGGG + Intergenic
1048753938 8:137713660-137713682 GACCCTGGGTGTGTCTGTGAGGG + Intergenic
1048835858 8:138518180-138518202 GATCTTGGGTGTGTCTGTGAGGG - Intergenic
1049446562 8:142634148-142634170 GACCTGGGGTGGCCATGGGAGGG + Intergenic
1052442346 9:28513009-28513031 GATCTTGGGTGTGTCTGTGAGGG - Intronic
1056313937 9:85370521-85370543 GATCTTGGGTGTGTCTGTGAGGG - Intergenic
1057218906 9:93245064-93245086 GACCAGGGCTGTTTCTGTTAGGG + Intronic
1058108125 9:100998913-100998935 GACAGAGGGTGTTCCTGTAAAGG - Intergenic
1058258975 9:102807274-102807296 GATCTTGGGTGTGTCTGTGAGGG - Intergenic
1058259677 9:102813390-102813412 GATCCTGGGTGTTTCTGTGAGGG - Intergenic
1058606329 9:106727428-106727450 GACCCTGGGTGTGTCTGTGAGGG - Intergenic
1058849350 9:108995606-108995628 GACCTTGGGTTTTCCTATTAAGG - Intronic
1059440089 9:114301749-114301771 CTCCTGGGGGGTTCCTTTGAAGG + Intronic
1061569802 9:131470207-131470229 GACCTACGGTGTTACAGTGAGGG - Intronic
1062365941 9:136209083-136209105 GACCAGGGGGATTCCAGTGAAGG - Exonic
1062427459 9:136512556-136512578 GACCTGAGGGATTCCTTTGATGG - Intronic
1062559724 9:137136136-137136158 GATCTGTGGGGATCCTGTGATGG + Intergenic
1203428963 Un_GL000195v1:71392-71414 GATCCTGGGTGTGCCTGTGAGGG + Intergenic
1203461282 Un_GL000220v1:41622-41644 GAATTTGGGTGTTCCTGTGTTGG + Intergenic
1186032470 X:5384716-5384738 GTTCTTGGGTGTTTCTGTGAGGG - Intergenic
1187517097 X:19982323-19982345 GACTTGGTGCGTTTCTGTGATGG - Intergenic
1188048798 X:25459280-25459302 GACCCTGGGTGTGTCTGTGAGGG + Intergenic
1188230478 X:27656919-27656941 GACCCTGGGTGTGTCTGTGAGGG + Intronic
1189074833 X:37905008-37905030 GACCTGGTGTGTTCTGGTAAAGG - Intronic
1189655578 X:43241052-43241074 GATGTGGGGGATTCCTGTGAAGG - Intergenic
1190082813 X:47370251-47370273 GACCTGGTGGGTGACTGTGAGGG - Intergenic
1190745983 X:53321710-53321732 GACCTGGGGACTGCCTGGGATGG - Intergenic
1190996445 X:55615074-55615096 GATCCTGGGTGTGCCTGTGAGGG - Intergenic
1191080088 X:56501104-56501126 TTCCTGTGGTGTTCCTGTGCGGG - Intergenic
1191629728 X:63310197-63310219 GACCCTGGGTGTATCTGTGAGGG - Intergenic
1192905368 X:75545170-75545192 TTCCTGGTGTGTTCCTGTGGTGG + Intergenic
1193557719 X:82976447-82976469 GACTCTGGGTGTTCCTGTGTTGG - Intergenic
1193904150 X:87222863-87222885 GATCTTGGGTGTGTCTGTGAGGG + Intergenic
1193923937 X:87463271-87463293 TTCCTGGTGTGTTCCTGTAATGG - Intergenic
1194032463 X:88833513-88833535 GATCCTGGGTGTGCCTGTGAGGG - Intergenic
1194513092 X:94819542-94819564 GATCTTGGGTGTGTCTGTGAGGG - Intergenic
1194564644 X:95469669-95469691 GATCTTGGGTGTGTCTGTGAGGG - Intergenic
1195748606 X:108142834-108142856 GATCCTGGGTGTGCCTGTGAGGG - Intronic
1197653183 X:129087156-129087178 GACCTGGGGTGTGTCTGCCAGGG - Intergenic
1198768467 X:140102872-140102894 GATATGGGGTTTTCCTGTTATGG + Intergenic
1198787602 X:140306125-140306147 GAACTGGGGTGCTCCAGTGTTGG - Intergenic
1199635189 X:149806857-149806879 GACATGGGGTGTTGGTGTAAAGG + Intergenic
1200150911 X:153951050-153951072 GACCTGCAGTGTTCCTGGGGTGG - Intronic
1202079991 Y:21074401-21074423 GATCCTGGGTGTTTCTGTGAAGG - Intergenic
1202369301 Y:24186406-24186428 GACTTGGGCTGTGCCTGTGGTGG - Intergenic
1202369740 Y:24188574-24188596 GACCTGGACTCTGCCTGTGAGGG - Intergenic
1202501045 Y:25481543-25481565 GACCTGGACTCTGCCTGTGAGGG + Intergenic
1202501484 Y:25483711-25483733 GACTTGGGCTGTGCCTGTGGTGG + Intergenic