ID: 956646266

View in Genome Browser
Species Human (GRCh38)
Location 3:71460206-71460228
Sequence TAGCTGGTCTAGAGGAGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956646262_956646266 4 Left 956646262 3:71460179-71460201 CCATCTTCTTGATATTAGCAAAC 0: 1
1: 0
2: 1
3: 12
4: 224
Right 956646266 3:71460206-71460228 TAGCTGGTCTAGAGGAGTAAAGG 0: 1
1: 0
2: 1
3: 14
4: 155
956646260_956646266 22 Left 956646260 3:71460161-71460183 CCTGACCTCGTGATTCGTCCATC 0: 2
1: 31
2: 905
3: 10448
4: 42669
Right 956646266 3:71460206-71460228 TAGCTGGTCTAGAGGAGTAAAGG 0: 1
1: 0
2: 1
3: 14
4: 155
956646261_956646266 17 Left 956646261 3:71460166-71460188 CCTCGTGATTCGTCCATCTTCTT 0: 1
1: 0
2: 0
3: 4
4: 98
Right 956646266 3:71460206-71460228 TAGCTGGTCTAGAGGAGTAAAGG 0: 1
1: 0
2: 1
3: 14
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956646266 Original CRISPR TAGCTGGTCTAGAGGAGTAA AGG Intronic
900325021 1:2104481-2104503 TATGTGTTCTAGAGGAGTGAGGG + Intronic
903478670 1:23637795-23637817 AAGATGATCCAGAGGAGTAAAGG + Intronic
907861553 1:58358527-58358549 TAGCTGGGCTAGAGGGGGACCGG - Intronic
908530145 1:65026518-65026540 TTCCTGTTCTAGAGGAGGAAGGG - Intergenic
908737825 1:67294392-67294414 TAGCTGGGTTAGAGGAGTAGAGG + Intergenic
916723547 1:167503325-167503347 AAGCTGGGCTAGAGGATTAAAGG - Intronic
918184443 1:182114540-182114562 TAGTTGGCTTAGAGGAGAAAAGG + Intergenic
921741614 1:218691716-218691738 TAGCTGAGCCAGAGGAATAAGGG - Intergenic
1064895682 10:20233621-20233643 TAGCTGGTCTATAGCACCAAGGG + Intronic
1065770689 10:29075235-29075257 TAGTTGTTCTATAGGAGTTACGG + Intergenic
1068868974 10:61923432-61923454 TATCCGCTCTAGAGGAGTAGGGG + Intronic
1070874632 10:79791773-79791795 TGACTGGTCTCAAGGAGTAAGGG - Intergenic
1070999423 10:80816094-80816116 TGGCTGGTCTAGAGGGTTCAAGG - Intergenic
1071641556 10:87313936-87313958 TGACTGGTCTCAAGGAGTAAGGG - Intergenic
1073576769 10:104632462-104632484 TAACTGGGCTTGAGGATTAAAGG - Intergenic
1079852178 11:25548668-25548690 TAGCTGTTCTACAGGGGAAAAGG + Intergenic
1081117628 11:39223522-39223544 TAGCTGGACTACAGGACTACAGG - Intergenic
1092078437 12:5692726-5692748 TAGGTGGTCTGGAGGTGTGATGG + Intronic
1094407557 12:30134199-30134221 TAGCTGGACTACAGGTGTCAGGG + Intergenic
1097041925 12:56160981-56161003 TAGCTGGCATAGAGGGGTATGGG + Intronic
1100558696 12:95724577-95724599 TAGCTGTTATAAAGGAGAAAAGG - Intronic
1101444315 12:104726651-104726673 AGGCTGGTCTATAGGTGTAATGG + Intronic
1106058528 13:26263020-26263042 TAGGTTGTTTAGAGGACTAAAGG + Intronic
1108018144 13:46097366-46097388 TAGCTGGTCTCTATGAGGAATGG - Intronic
1112522864 13:100113377-100113399 AAGCTGGTCTGGATGAGTCAGGG + Intronic
1116562972 14:46405408-46405430 TAGCTGCAGTAGAAGAGTAATGG - Intergenic
1117006217 14:51423608-51423630 CAGCTTGTCTAGAAGAGTATGGG - Intergenic
1117438698 14:55741184-55741206 CCACTGGTCTACAGGAGTAAAGG + Intergenic
1128204337 15:65837454-65837476 TAACTGGACGAGAGGAGGAAAGG - Intronic
1130757761 15:86783957-86783979 CTGCTGGTTTAGAGGAGGAATGG + Intronic
1135174786 16:20218302-20218324 GAGCTGGGCTAGAGCAGGAAAGG - Intergenic
1137365075 16:47853319-47853341 CAGCTAGCCTTGAGGAGTAAAGG - Intergenic
1140521432 16:75585272-75585294 TGGCTGGGCTAGTGGAGTATGGG - Intergenic
1141355149 16:83338624-83338646 TAGCTGTTCTGGAGGAGTAAGGG + Intronic
1142051816 16:87963980-87964002 TAGCTGGTCATCAGGAGAAACGG - Intronic
1144120822 17:12150800-12150822 CAGATGGTCCAGATGAGTAAGGG + Intergenic
1153918004 18:9762809-9762831 GAGCTGGGCTAGAGGAGACATGG + Intronic
1157715360 18:49881931-49881953 TAGTTGGTATAGAGGAGGATGGG + Intronic
1165710320 19:38006158-38006180 TTGCTGGTCTAGGGGAGTGGTGG + Intronic
928847053 2:35688631-35688653 TTGATGGTCTCGAGGAGTACTGG - Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
934104738 2:88685417-88685439 TAGCTGGTTCACAGGAATAAGGG - Intergenic
935897144 2:107749724-107749746 TAGTTGGTTTAGAGGTTTAAAGG - Intergenic
935900217 2:107783699-107783721 CAGAGGCTCTAGAGGAGTAAAGG + Intergenic
936855377 2:116951958-116951980 TAGCTGCTATAGAGGAGAAAGGG + Intergenic
939858652 2:147391614-147391636 TCTCTGGTGTAGGGGAGTAAGGG - Intergenic
941352039 2:164449117-164449139 AAGCTGGTCTAGGGGAGATAAGG - Intergenic
1171198634 20:23223573-23223595 TAGCTTGTTAAGAGGAGTTATGG - Intergenic
1181184700 22:21094686-21094708 TAACTTGTCTAGAGAAGAAATGG + Intergenic
1182040575 22:27236177-27236199 TACCTGGTCTAGAGTAATAATGG + Intergenic
1183281805 22:36936260-36936282 TGGCTGGTGTGGAGGAGAAATGG + Intronic
1183620158 22:38967417-38967439 TATCTCCTCTAGAGGAGTAATGG + Intronic
949312168 3:2712396-2712418 TAGCTAGTATAGAGGAGAAAAGG + Intronic
950136969 3:10588326-10588348 TTGCTGGTCTAGAGGAGGAGAGG + Intronic
956646266 3:71460206-71460228 TAGCTGGTCTAGAGGAGTAAAGG + Intronic
958274094 3:91551117-91551139 TAGCTGCTCTATAGGAAGAAAGG + Intergenic
958275136 3:91568109-91568131 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958276003 3:91582222-91582244 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958277382 3:91604847-91604869 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958280254 3:91652132-91652154 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958283772 3:91710152-91710174 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958288017 3:91779218-91779240 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958288712 3:91790784-91790806 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958290137 3:91814250-91814272 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958290835 3:91825818-91825840 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958292201 3:91847937-91847959 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958292924 3:91859850-91859872 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958295080 3:91893935-91893957 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958295553 3:91901930-91901952 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958295959 3:91908572-91908594 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958299432 3:91965391-91965413 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958302573 3:92017102-92017124 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958303446 3:92031568-92031590 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958304767 3:92053344-92053366 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958305633 3:92067467-92067489 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958306299 3:92078361-92078383 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958310696 3:92151001-92151023 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958311584 3:92165460-92165482 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958311760 3:92168354-92168376 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958311946 3:92171244-92171266 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958313648 3:92198975-92198997 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958314381 3:92210885-92210907 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958317274 3:92257854-92257876 TAACTGCTCTACAGGAGGAAAGG - Intergenic
958318774 3:92282525-92282547 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958319318 3:92291544-92291566 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958321557 3:92328646-92328668 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958322943 3:92351449-92351471 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958325778 3:92397903-92397925 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958329984 3:92466975-92466997 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958330331 3:92472757-92472779 TAACTGCTCTACAGGAGGAAAGG - Intergenic
958330842 3:92481096-92481118 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958333866 3:92530250-92530272 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958334505 3:92540803-92540825 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958335030 3:92549482-92549504 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958335378 3:92555266-92555288 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958339248 3:92619079-92619101 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958341795 3:92660763-92660785 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958342134 3:92666211-92666233 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958342496 3:92671995-92672017 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958343903 3:92695132-92695154 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958348169 3:92764543-92764565 TAACTGCTCTACAGGAGGAAAGG - Intergenic
958351864 3:92825270-92825292 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958352041 3:92828163-92828185 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958354975 3:92876641-92876663 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958356502 3:92901979-92902001 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958356855 3:92907761-92907783 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958357384 3:92916444-92916466 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958365493 3:93048781-93048803 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958365672 3:93051673-93051695 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958366203 3:93060347-93060369 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958367244 3:93077361-93077383 TAACTGCTCTACAGGAGGAAAGG - Intergenic
958367421 3:93080255-93080277 TAACTGCTCTACAGGAGGAAAGG - Intergenic
958371133 3:93141161-93141183 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958373075 3:93172964-93172986 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958373777 3:93184531-93184553 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958379511 3:93277935-93277957 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958379670 3:93280490-93280512 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958381705 3:93313827-93313849 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958381888 3:93316719-93316741 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958385381 3:93374043-93374065 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958386610 3:93394278-93394300 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958387452 3:93408060-93408082 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958387984 3:93416730-93416752 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958390524 3:93458236-93458258 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958390702 3:93461128-93461150 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958391235 3:93469802-93469824 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958391606 3:93476010-93476032 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958392675 3:93493357-93493379 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958393205 3:93502032-93502054 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958393553 3:93507806-93507828 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958394439 3:93522264-93522286 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958394788 3:93528047-93528069 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958397093 3:93565643-93565665 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958397785 3:93577211-93577233 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958397966 3:93580104-93580126 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958401311 3:93635039-93635061 TAACTGCTCTATAGGAGGAAAGG - Intergenic
958610700 3:96421529-96421551 TAGTTGGTCATGAGGAGTCAAGG - Intergenic
961429016 3:126867123-126867145 GACCTGGTCCAGAGAAGTAAAGG + Intronic
969374500 4:6754274-6754296 GAGCTGGCCTAGAGAAGTCAGGG - Intergenic
981510917 4:145557533-145557555 TTGCTGGTCTTGAGGAATGAAGG - Intronic
982758229 4:159250383-159250405 TAGCTGGCCTAGGGGAGAAATGG + Intronic
991138797 5:63214882-63214904 TAGGTGTTTTAGAGTAGTAAAGG - Intergenic
992696410 5:79292729-79292751 TAGTTGGTCTAGAGTAGTAGAGG + Intronic
1000701907 5:164461623-164461645 GAGATGGTCTATAGGAGGAAGGG + Intergenic
1003344748 6:5256785-5256807 TAGCTGGTCTTGTGGAGAGAGGG - Intronic
1005737916 6:28766104-28766126 GAGCTGGACAAGAGGAGTAAAGG - Intergenic
1007478902 6:42137247-42137269 TAGCTGGTCTGTAGGGGTCAAGG + Intronic
1009714868 6:67378296-67378318 GATCTGGTTTATAGGAGTAAAGG + Intergenic
1020393818 7:7690123-7690145 TAGCTGGTCCAGATTAGTAAAGG - Intronic
1021811731 7:24409008-24409030 TAGCTGGTATACAGAAATAAGGG + Intergenic
1027431864 7:78122328-78122350 TATCTGGTCTATAGAAGGAAAGG + Intronic
1028537241 7:91903383-91903405 TAGCTGTTATAAAGGAGAAAAGG - Intergenic
1030198994 7:106882968-106882990 TACCTGGCCCAGAGGAGGAAAGG - Intronic
1033247022 7:139726270-139726292 AAGCTGGTCCAGAGGGGTAAGGG + Intronic
1034941147 7:155231250-155231272 TAGCTGTTCTAGAGCCGTGAAGG - Intergenic
1037827270 8:22166777-22166799 CAGCAGGTGTAGAGGGGTAAGGG - Intronic
1038499757 8:28033687-28033709 TTGATTGTCTAGAGGAGTAAAGG - Exonic
1040861398 8:52002818-52002840 AAGCTGGTCTAGAGGAGACAGGG - Intergenic
1042904389 8:73758246-73758268 AAGCTGGAGTAGAGGAGGAAAGG - Intronic
1043460370 8:80454137-80454159 TAACTAGTCTAGAGAATTAAAGG + Intergenic
1043883183 8:85568176-85568198 TTGCTGATCCAGAGGAGGAAGGG + Intergenic
1051557574 9:18402212-18402234 CAGCTGGTGTAGAAGAGGAATGG - Intergenic
1058934216 9:109752954-109752976 TAGCTGGTCAAGAAGAGGAGAGG + Intronic
1187058153 X:15760388-15760410 TAGATGGTCTAGTTTAGTAAAGG + Intronic
1188850181 X:35122558-35122580 AAGCTGGCCTAGAAGGGTAAAGG - Intergenic
1193492508 X:82166510-82166532 TAGCATGGCTAGAGGGGTAAGGG - Intergenic
1194187907 X:90796158-90796180 TGCCTGGTTTAGAGGATTAAAGG + Intergenic
1196673496 X:118394305-118394327 GAGCTGATCAAGAGAAGTAAGGG - Intronic
1197232951 X:124026070-124026092 TACCTGGTCTAGAAGACAAAAGG - Intronic
1197456872 X:126687750-126687772 TAGCTGTTTTATAGGAGTTATGG - Intergenic
1200534497 Y:4378105-4378127 TGCCTGGTTTAGAGGATTAAAGG + Intergenic