ID: 956646352

View in Genome Browser
Species Human (GRCh38)
Location 3:71460985-71461007
Sequence CAGTTTTACAATAAAGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 5, 3: 31, 4: 367}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956646352 Original CRISPR CAGTTTTACAATAAAGAGAT GGG Intronic
900081073 1:857970-857992 CAGTTTTAGAATTGGGAGATAGG + Intergenic
901174055 1:7285710-7285732 CTGGTTTAGAATAAAGAGATAGG - Intronic
903446800 1:23427596-23427618 CATCTATACAATAAAGAGGTTGG - Intergenic
903998137 1:27321123-27321145 CATTTGTACAATGAAGGGATTGG + Intergenic
905586663 1:39125058-39125080 CATTTTTATAATAAGGAAATAGG - Intronic
905839692 1:41164138-41164160 ACGTTTGACAAAAAAGAGATGGG - Intronic
908129247 1:61058070-61058092 CAGTTTTAAAAGAAAAAAATTGG - Intronic
909847314 1:80411435-80411457 CAGTTTTAATATAAAGTGGTAGG - Intergenic
909955582 1:81774916-81774938 CAGTTTTATAGTAAACAAATTGG - Intronic
910666415 1:89729566-89729588 CATTTTTACAATAAAGCACTAGG + Intronic
910797246 1:91110062-91110084 CAGACTGAAAATAAAGAGATGGG + Intergenic
911391795 1:97254644-97254666 CACTTTTACATTAAACAGAGTGG + Intronic
911440206 1:97916835-97916857 CAGTTTTTTAAAATAGAGATGGG - Intronic
911505851 1:98750064-98750086 CAGTTTTAAAATAAATATATGGG + Intronic
911526928 1:98999334-98999356 CAATTTTACAATAGAGAAAACGG + Intronic
912652741 1:111454325-111454347 CAGTTTTAGGATAAAGAAACTGG - Exonic
913338583 1:117733797-117733819 CATTTTTCCAATAAAAAAATGGG + Intergenic
914454774 1:147825485-147825507 CATTTTTATAATAATGATATAGG - Intergenic
914729243 1:150356052-150356074 CATTTGTACAATAAAGAGGTAGG + Intergenic
915808453 1:158879712-158879734 CAGTTTTACAAGTAAATGATAGG + Intergenic
916120041 1:161521409-161521431 CCGTTTTAAAATGAAGAGATTGG - Intronic
916129801 1:161603058-161603080 CCGTTTTAAAATGAAGAGATTGG - Intronic
916205720 1:162314444-162314466 CAGTTCTACAACAAAATGATTGG + Intronic
917071781 1:171159416-171159438 AAGTTTTACAGGAAAGAAATGGG - Intronic
917400945 1:174649064-174649086 CAGGCTCAAAATAAAGAGATGGG - Intronic
917567427 1:176227111-176227133 GAGAATAACAATAAAGAGATAGG + Intergenic
917694081 1:177501998-177502020 CAGTTGCACTTTAAAGAGATGGG + Intergenic
918549552 1:185726571-185726593 CAATTTTACTATAAAGTCATAGG + Intergenic
918921598 1:190718559-190718581 CAGTTTTAAAACAAAAAGATGGG + Intergenic
919406507 1:197191011-197191033 CAGTTTATCTATAAAGAGCTAGG - Intronic
922088609 1:222374395-222374417 CAGTTTTACCATCTAGAGACTGG - Intergenic
922138416 1:222855711-222855733 ATGTTTTAAAATAAAGAGAAGGG - Intergenic
922159897 1:223071830-223071852 GATTTTTACAATAAAGAAATTGG + Intergenic
923044671 1:230346974-230346996 AAGTTTTACAATAAAGAGTTGGG - Intronic
923666931 1:236006854-236006876 TATTTTTACAATATAAAGATAGG + Intronic
1064678560 10:17786259-17786281 CAGTTTGACATTAAAGGCATAGG + Intronic
1064821127 10:19334382-19334404 CAGTTATACACAAAAGTGATAGG - Intronic
1064991637 10:21261792-21261814 TACCTTTAAAATAAAGAGATAGG + Intergenic
1065439105 10:25731068-25731090 CACATGTGCAATAAAGAGATGGG - Intergenic
1065897326 10:30175500-30175522 CAGTTTTTCAACTAAGAAATGGG - Intergenic
1068672797 10:59741096-59741118 AAGTTTCAGAATAAAGAAATAGG - Intergenic
1069985029 10:72277153-72277175 CAGTTCTACCAAAGAGAGATGGG - Intergenic
1070771811 10:79086830-79086852 TAGTTTTAAAAGAAAGAGATTGG - Intronic
1071881394 10:89902304-89902326 GAAATTTACAATAAAGAGAGTGG + Intergenic
1073437085 10:103524744-103524766 CAGTTTTGCTATAAATACATGGG + Intronic
1075098399 10:119488984-119489006 CACTTTTAAAATAAAGTGATGGG + Intergenic
1075142040 10:119847027-119847049 CATTTTTACAACATAGAGAAGGG - Intronic
1075322750 10:121505310-121505332 CAGTATTAAAATAAAGAAGTGGG + Intronic
1075901418 10:126045416-126045438 AAGTTTTAAAATAAAGAATTTGG + Intronic
1077876173 11:6308806-6308828 AATTTTTACCATAAAGAGTTAGG - Intergenic
1078346991 11:10558915-10558937 CAGGGTTACAATAAGGAGAAGGG + Exonic
1078688279 11:13553082-13553104 AAGTTTCACAATGAAGAGATGGG + Intergenic
1078693007 11:13600933-13600955 AAGTTTCACAATGAAGAGATGGG - Intergenic
1078858042 11:15222301-15222323 CACTTTTAAAAGAAAGAGGTGGG - Intronic
1079638281 11:22772952-22772974 CAGTCCTAGAATAAAGAGAGGGG + Intronic
1080434086 11:32223788-32223810 CAGTGATATAATACAGAGATTGG - Intergenic
1080587608 11:33695716-33695738 CTAGTTTACAGTAAAGAGATTGG - Intergenic
1081134633 11:39424431-39424453 TAGTTTAAGAATAAAGGGATGGG - Intergenic
1081287896 11:41294618-41294640 CATTTTAACATTAAAGAAATGGG - Intronic
1081320742 11:41689062-41689084 ATGTTTGACAATAAATAGATTGG - Intergenic
1081338623 11:41900124-41900146 CAGTTTAACAATAAAGATAAAGG - Intergenic
1081527860 11:43939078-43939100 AAATATTACAAGAAAGAGATTGG - Intronic
1081901870 11:46635469-46635491 CAATTTTTTAAAAAAGAGATGGG - Intronic
1082209997 11:49487909-49487931 CTGTTTTCCAAGAAAGGGATTGG + Intergenic
1083789126 11:64972643-64972665 TATTTTTACAAAATAGAGATGGG - Intergenic
1086343306 11:85869555-85869577 CATTTTAACAATATAGAGAGTGG + Intronic
1086568836 11:88259651-88259673 CAGATGTACAATGAAGAGCTGGG - Intergenic
1086639672 11:89137616-89137638 CTGTTTTCCAAGAAAGGGATTGG - Intergenic
1086750515 11:90488158-90488180 CAGCTTTTCAGTAAATAGATTGG + Intergenic
1088165932 11:106937210-106937232 CAGTTTAAAAATAAAGTAATAGG - Intronic
1090957161 11:131523875-131523897 CAGTTTGAAAATAGAGAAATGGG + Intronic
1090995617 11:131863352-131863374 CAGGTTTGCAATAAAGAAAAAGG - Intronic
1092097574 12:5856258-5856280 CAGTTTGAAAATAAAGACAAAGG - Intronic
1092842607 12:12557533-12557555 CAGTTTTTAAAAAAAGAAATGGG - Intronic
1094751206 12:33410865-33410887 CATTTTCACAATAAAAAGTTAGG + Intronic
1095277493 12:40305097-40305119 CAGATTTACAACAGAGAGAATGG - Intronic
1096372038 12:51076839-51076861 CACTCTTAGAATAATGAGATGGG + Intronic
1097462648 12:59881369-59881391 CAGTTTGACATTAAAGAGAATGG - Intergenic
1097484813 12:60182877-60182899 CAATTTTACAATATAGCTATAGG + Intergenic
1097506066 12:60472295-60472317 AATTTTCATAATAAAGAGATTGG - Intergenic
1097761986 12:63476951-63476973 CAGATTAATAATAAAAAGATAGG - Intergenic
1099040820 12:77652373-77652395 AAGTAGTACAATAAAGAGAAAGG - Intergenic
1099280331 12:80636554-80636576 CAGTTGTAGAATAAAGGGATGGG - Intronic
1100009182 12:89933484-89933506 CAGTATAAAAATAAAGAGCTCGG + Intergenic
1100143377 12:91646637-91646659 CAGTTTCACATTATAAAGATGGG - Intergenic
1100739375 12:97574616-97574638 CAGTTTTACACTGACTAGATTGG + Intergenic
1101796711 12:107981857-107981879 GAGCTTTTCACTAAAGAGATAGG - Intergenic
1104077149 12:125400180-125400202 CATTTTTACAAGAAAAAGAATGG - Intronic
1105003000 12:132703259-132703281 CATTTTTATAAAATAGAGATGGG - Intronic
1106272069 13:28164653-28164675 AAGTTGTACAGTAAAGAAATGGG + Intronic
1106504140 13:30356432-30356454 AAGTCTTACAATATGGAGATTGG - Intergenic
1109072283 13:57785409-57785431 TAGTCTCAAAATAAAGAGATGGG - Intergenic
1109076317 13:57840692-57840714 CATCTTTACAATAACAAGATAGG - Intergenic
1109637268 13:65137925-65137947 TTGTGTTACAATATAGAGATTGG - Intergenic
1110531054 13:76598719-76598741 CAGTTTTAAAAGAAAGAGATGGG - Intergenic
1111103592 13:83616582-83616604 CAGATTTACAATTTAGAAATAGG + Intergenic
1111346385 13:86960289-86960311 TAGTTTTAAAGTAAAGAAATTGG + Intergenic
1111806432 13:93044347-93044369 CTCTTTTACAAAAAAGAGAAGGG + Intergenic
1111834151 13:93366553-93366575 GAAATTTACAATAAAAAGATTGG - Intronic
1116690810 14:48103350-48103372 CAGTTATACTCTAAATAGATAGG - Intergenic
1116823439 14:49648057-49648079 CAGTTTTGCATTAGAGAGAGGGG - Intronic
1118902096 14:69994602-69994624 TAGCTATAAAATAAAGAGATTGG + Intronic
1119885907 14:78141897-78141919 CCCCTTTACAATCAAGAGATGGG - Intergenic
1119952699 14:78762093-78762115 TAGTTTAATAATAAAGAGAATGG - Intronic
1121263900 14:92586516-92586538 AAGTTTTACAATAAAGTTCTTGG - Intronic
1123504578 15:20927558-20927580 CAGGATTACAATAATGTGATAGG + Intergenic
1123561825 15:21501259-21501281 CAGGATTACAATAATGTGATAGG + Intergenic
1123598069 15:21938540-21938562 CAGGATTACAATAATGTGATAGG + Intergenic
1123726833 15:23111625-23111647 CAGTTCTACCATATAGAGTTAGG + Intergenic
1123770985 15:23528663-23528685 CAGCTTTATAATACAGATATAGG - Intergenic
1126172796 15:45708189-45708211 GAGTTTTCCAAGAAAGAGGTGGG + Intergenic
1126214956 15:46144057-46144079 CAGTAATCCAATTAAGAGATTGG + Intergenic
1126419863 15:48460116-48460138 CAGTGTTTCAATAAAGTGAAAGG + Intronic
1126690484 15:51285457-51285479 CGGTTTTACAAAAAAGAGAAGGG + Intronic
1127216199 15:56825253-56825275 CGGTTTTAGAATAAAGAGAGAGG + Intronic
1127461209 15:59200965-59200987 CAGTTTTACAATCAAAGGAATGG - Intronic
1127768636 15:62212133-62212155 CAGTTTTACAAAAAAGAAAAGGG - Intergenic
1128476091 15:67997888-67997910 AAGTTATACAACAAAAAGATGGG - Intergenic
1128888417 15:71309353-71309375 CACTTTAACAATAAAAAGACAGG - Intronic
1129531512 15:76269203-76269225 CGGTTTTACAAAAAAGAAAAGGG + Intronic
1130966153 15:88699460-88699482 CAGTTTTACAATGGACAGCTGGG + Intergenic
1131817883 15:96241262-96241284 CAGTTATAGCATGAAGAGATAGG - Intergenic
1131941335 15:97569504-97569526 CAGGTTTACAATAAATACAGAGG - Intergenic
1132419703 15:101654909-101654931 CAGGTGGACAATAGAGAGATGGG - Intronic
1202970170 15_KI270727v1_random:228385-228407 CAGGATTACAATAATGTGATAGG + Intergenic
1134087644 16:11369230-11369252 AATTTTTAAAATATAGAGATGGG - Intronic
1135007552 16:18840152-18840174 CAATTTTTCAATAAAGTGAATGG - Intronic
1135224953 16:20647709-20647731 CTCTTTTACAAAAAAGAGAAAGG + Intronic
1135978240 16:27125509-27125531 TATTTTTTTAATAAAGAGATGGG - Intergenic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1137979455 16:53057137-53057159 AATTTTTAAAATAAAGATATAGG - Intronic
1139104588 16:63812768-63812790 CAGACTTACAGTAAAGAAATTGG + Intergenic
1140156297 16:72430238-72430260 CATGTTTACAATAAATAGAGAGG + Intergenic
1140160471 16:72486502-72486524 CAGTATTAAAATCAAGAGAAAGG - Intergenic
1140426825 16:74868151-74868173 TATTTTTAAAATACAGAGATAGG + Intergenic
1141793733 16:86254466-86254488 GAGGTTAACAATAAAAAGATGGG - Intergenic
1142551005 17:739506-739528 TATTTTTTAAATAAAGAGATGGG + Intronic
1143434273 17:6911336-6911358 TAGTTTGAAAATTAAGAGATAGG + Intronic
1144031325 17:11325786-11325808 CAGTGGTACAATGAAGAGGTTGG + Intronic
1147014185 17:37477394-37477416 CAGATTTAAAATAAAGAGAAAGG + Exonic
1149260209 17:54872123-54872145 CACTTGTACAATGAAGAGTTTGG - Intergenic
1150540937 17:66098488-66098510 CAATTTGACAATAAAGATAACGG + Intronic
1151588882 17:75030146-75030168 CAGTTTTACAAAAAAGAGAAGGG + Intergenic
1152471848 17:80493863-80493885 CAAATTTAAAAAAAAGAGATGGG - Intergenic
1153141788 18:1980967-1980989 CAGTCTGACCATAAAGACATTGG - Intergenic
1155116202 18:22770359-22770381 CATTTTTACATTACTGAGATTGG + Intergenic
1155457300 18:26031794-26031816 AAGTTTTAATTTAAAGAGATGGG + Intronic
1156644190 18:39140272-39140294 CCGTTTTAGAATAAAGATCTTGG + Intergenic
1157015606 18:43708952-43708974 AAGATTTTCAATAAAGAGAGAGG - Intergenic
1157064946 18:44338166-44338188 CAGACTGAAAATAAAGAGATGGG - Intergenic
1158486150 18:57867628-57867650 CAGTTTTAAGAAAAAGAGAGAGG + Intergenic
1158551597 18:58440645-58440667 CAATTTTAAAATAAAGAAACAGG - Intergenic
1158788809 18:60749382-60749404 CAGTTTTAGAGTATAAAGATGGG + Intergenic
1158884317 18:61811223-61811245 AAGTTTTCAAATAAAGGGATGGG + Exonic
1158975467 18:62707584-62707606 CAATTTTACAACAGAGATATGGG + Intergenic
1161053735 19:2179501-2179523 CATTTTTATAAAAAAGACATGGG + Intronic
1162507027 19:11091559-11091581 CAGTTTTACAAAAGAAAGAGAGG + Intronic
1163679697 19:18673711-18673733 CAGTTTTGCAATACACACATTGG + Intergenic
1166308370 19:41948348-41948370 TAGTTTTACAGGACAGAGATGGG - Intergenic
1167193840 19:48012987-48013009 CATTTTAACAAAAAAGAGAGGGG - Intronic
1168222826 19:54973255-54973277 CAATTTTTAAATAAAAAGATAGG - Intronic
926244273 2:11111550-11111572 CAGATTTAAAATAAACTGATGGG + Intergenic
926578176 2:14605820-14605842 CAGTATTATAATTAAGAAATGGG + Intergenic
926828174 2:16930505-16930527 GACTTTTAAATTAAAGAGATTGG + Intergenic
927581544 2:24255001-24255023 CAGTTTTTAAATAAACAGAAGGG + Intronic
927976495 2:27342561-27342583 CAGTAAAACAATAAAGAGCTGGG + Intronic
929912381 2:46101166-46101188 CAGTTTTTTAAAAAAGAAATAGG - Intronic
930883339 2:56296634-56296656 CTGTTTTACAAAAGAGACATAGG + Intronic
931361598 2:61582688-61582710 CAGTCTTACATTAACTAGATGGG + Intergenic
931453061 2:62384863-62384885 CTGTTTCTCAACAAAGAGATGGG - Intergenic
932536136 2:72597720-72597742 TAGATTAAAAATAAAGAGATGGG + Intronic
932757819 2:74421082-74421104 CAATTTTAAAATAAAGAAAACGG - Intronic
934690873 2:96358103-96358125 CATTTTTAAAAAATAGAGATGGG - Intronic
936024045 2:109017630-109017652 AATTGTTACAAAAAAGAGATTGG - Intergenic
937166965 2:119828515-119828537 CAGTCTTACAATACATATATTGG + Intronic
937672683 2:124555561-124555583 AAGTTTTGCAATAAAAAGTTTGG + Intronic
938136601 2:128764078-128764100 CAGGCTTAAAATAAAAAGATGGG - Intergenic
938919152 2:135977415-135977437 CAGTCGTAAAATAAAGGGATGGG + Intronic
939815597 2:146892867-146892889 GAATGTTACAAAAAAGAGATGGG + Intergenic
940037335 2:149324490-149324512 GGTTTTTACAAAAAAGAGATGGG + Intergenic
940393357 2:153159128-153159150 CAGTTTTAGTATAAAGAAAATGG - Intergenic
941158992 2:162014066-162014088 CATTTTAACAAGCAAGAGATGGG - Intronic
941229198 2:162888050-162888072 TGGTTCCACAATAAAGAGATGGG - Intergenic
941585501 2:167353049-167353071 CATACTTACAATACAGAGATAGG - Intergenic
942894146 2:181030741-181030763 TGGTTATACAATATAGAGATGGG - Intronic
943054333 2:182957067-182957089 CTGTTTTATAATAATGACATTGG + Intronic
943192101 2:184691275-184691297 CACTTCTAGAAAAAAGAGATAGG - Intronic
943614263 2:190074166-190074188 CATTTATAAAATAAAGAGAAAGG - Intronic
944499209 2:200341088-200341110 CAGTTTTAGAATTAAGAAGTCGG - Intronic
944851969 2:203728870-203728892 CAGATTTATAATATACAGATAGG - Intronic
945796772 2:214374132-214374154 GAGTTATAGGATAAAGAGATTGG + Intronic
946012322 2:216575419-216575441 CATTTGTAGAATAAAGGGATGGG - Intronic
946954102 2:224909850-224909872 TAATTTTACATTTAAGAGATAGG + Intronic
1170303224 20:14909056-14909078 CTGTTTCACCATATAGAGATGGG + Intronic
1170400251 20:15975153-15975175 TATTTATATAATAAAGAGATAGG - Intronic
1170503656 20:17001339-17001361 CTGTTTTGTATTAAAGAGATGGG + Intergenic
1172040003 20:32037224-32037246 CCATTTTTCAATTAAGAGATTGG + Intergenic
1172860206 20:38043682-38043704 CAGTTTTACACTGGAGAGGTGGG - Intronic
1173635850 20:44556970-44556992 CAGTTTTAAAATAAACTGCTGGG + Intronic
1174738869 20:52992553-52992575 CAGTTTGACAGTAAACAGAAGGG - Intronic
1175223690 20:57432794-57432816 CAGTTTGAAAAAAAAGGGATTGG - Intergenic
1176519087 21:7811696-7811718 CAGTTTCACAGCAAGGAGATGGG - Intergenic
1177700014 21:24626337-24626359 CATTTTTGCAATAAAGAGATTGG - Intergenic
1177901160 21:26916806-26916828 GAGTTTTTCAAAAAAGAGTTTGG - Intergenic
1178626878 21:34225868-34225890 CTATTTTATAATAAAGTGATGGG - Intergenic
1178653115 21:34441709-34441731 CAGTTTCACAGCAAGGAGATGGG - Intergenic
1179101403 21:38358185-38358207 CATTTGTATAATAAAAAGATTGG + Intergenic
1182265131 22:29108673-29108695 CAGTTAGATAAAAAAGAGATGGG - Intronic
1182848414 22:33450699-33450721 CAGTTATACGATGAAAAGATTGG - Intronic
949273154 3:2244601-2244623 CAGTTAAAAAGTAAAGAGATAGG - Intronic
949281963 3:2356353-2356375 GAGTTTTCCAGTAAAGGGATGGG + Intronic
949495849 3:4631326-4631348 CAGATTAACCATAAAGAAATAGG - Intronic
949650678 3:6155529-6155551 CATTTTTAAAAGAAAGAGATTGG + Intergenic
951377296 3:21935405-21935427 CATTTTAACAATGAAGAAATTGG + Intronic
952914587 3:38224115-38224137 CAGTTTTAAAATGAAGAGTTTGG - Intronic
953040000 3:39247937-39247959 CATTTTTAAAATAAAAAGTTGGG + Intergenic
953298968 3:41752229-41752251 CAGTTCTACCATATAGAGTTAGG - Intronic
954056798 3:48033049-48033071 CACTTTTAAAATAAGGAGGTTGG - Intronic
954851449 3:53604413-53604435 CATGTGTTCAATAAAGAGATGGG + Intronic
955319220 3:57962231-57962253 CAGTTCAACAGTAGAGAGATAGG + Intergenic
956646352 3:71460985-71461007 CAGTTTTACAATAAAGAGATGGG + Intronic
956918621 3:73901842-73901864 CAGTTCTTAAATAAAAAGATAGG - Intergenic
958065105 3:88534766-88534788 CTCTTTTAGAATAAAGACATAGG + Intergenic
958087470 3:88829297-88829319 CAGTGCTACAATAAATACATGGG - Intergenic
958683238 3:97357541-97357563 CAATTCTCCAATAAAAAGATTGG - Intronic
958689223 3:97440572-97440594 AATTTTTAAAATAAATAGATTGG - Intronic
959001480 3:100969275-100969297 CAGCTTTAAAATGAAGAGCTTGG - Intronic
959376711 3:105596567-105596589 AATTTTTAGAGTAAAGAGATTGG + Intergenic
960023056 3:112977179-112977201 CAGTTTAAGAATCAAGTGATGGG + Intergenic
960041353 3:113152725-113152747 CAGTTTTAGAATTAAGAGTTGGG - Intergenic
960799194 3:121520992-121521014 TAGTTTTAAAATTAAGTGATGGG + Intronic
960886238 3:122398123-122398145 CAGTTTTAAAATGAACAAATTGG - Intronic
961725251 3:128924093-128924115 CGGTTTTACAAAAAAGAAAAGGG + Intronic
962176114 3:133157189-133157211 CAGTTTTCCAAAAAAGATGTTGG + Intronic
962567496 3:136677215-136677237 CAGTCTTACAATAAAAGTATGGG - Intronic
964706037 3:159619541-159619563 CAGTTTTCCTCAAAAGAGATGGG - Intronic
964958179 3:162388584-162388606 CAGTTCAAATATAAAGAGATTGG - Intergenic
964979294 3:162659610-162659632 TAGTTTCACAATAAAGAAGTTGG + Intergenic
966761279 3:183421123-183421145 CATTTTTACAATAATGTGTTTGG + Intronic
966978071 3:185103942-185103964 CAGTTATACAAACAAGAGAAAGG + Intronic
967631845 3:191752874-191752896 GATTTATTCAATAAAGAGATAGG - Intergenic
968823324 4:2873844-2873866 AAGGTTTACAATAAATAGATTGG + Intronic
971366400 4:25980996-25981018 CAGTTTTCTAATAAAGAAAATGG - Intergenic
971774317 4:30941893-30941915 AAGTTATAAAATAAAGAGCTTGG + Intronic
972309161 4:37863993-37864015 CATTTTTAAAATGAAGATATTGG + Intergenic
974776180 4:66484866-66484888 CAGTTTCACTATAAAGATAAGGG - Intergenic
975976097 4:80098377-80098399 CATTTTACCAATAAAGAAATAGG + Intronic
976647701 4:87402522-87402544 CTCTTTTACAAAAAAGAGAAGGG - Intergenic
976799800 4:88976174-88976196 CAGTTATTCATTAAAGAGAAAGG - Intronic
977537743 4:98275846-98275868 CATGTTTACAGTAAAGAGGTGGG - Intronic
978146114 4:105373603-105373625 AAGTATTACAGTAAAGAAATGGG + Intronic
978306509 4:107334315-107334337 CAGTTTTACAAAAAAGAGAAGGG + Intergenic
978513794 4:109550195-109550217 CACTATTGTAATAAAGAGATAGG - Intergenic
979014977 4:115420741-115420763 CAGTTTTACAATAGTGAGCCAGG + Intergenic
979118410 4:116859161-116859183 CAGTTTTGGAATAAAGTGTTAGG - Intergenic
981689705 4:147494197-147494219 CATTTATTCAATAAAGACATTGG + Intronic
982930901 4:161406557-161406579 CTGTTTTTTAATAAAGAAATAGG - Intronic
983250708 4:165343149-165343171 AAGTTGTACAATAAAAGGATTGG + Exonic
984541908 4:181049375-181049397 CACTATTACAATTAAGAGTTTGG + Intergenic
985080352 4:186258715-186258737 CACTTTTATAAGAAAGAGATGGG + Intergenic
987588849 5:19896054-19896076 AAATTTTAAAATAAAGAGCTTGG + Intronic
987876844 5:23690707-23690729 CTCTTTTACAAAAAAGAGAAGGG + Intergenic
988236112 5:28547581-28547603 CGGTTTTACAAAAAAGAAAAAGG + Intergenic
988456837 5:31394301-31394323 CTCTTTTACAAAAAAGAGAAGGG - Intergenic
989214238 5:38887671-38887693 CAGTTTTACATAAAAGAGTATGG - Intronic
989431683 5:41362543-41362565 CAATTGTAAAATGAAGAGATTGG - Intronic
989477147 5:41887642-41887664 CAGTTTAAAAAAAAAGTGATTGG + Intergenic
989513698 5:42317757-42317779 CAGTTTTATCATAAAGAGAATGG - Intergenic
989681357 5:44032811-44032833 CAGTATTAGAACAAAGAGAGAGG + Intergenic
990205154 5:53420681-53420703 CAGGTCTACTATAAACAGATGGG + Intergenic
991343172 5:65634315-65634337 TAGTTTTTCAAAAAAAAGATAGG - Intronic
991489553 5:67168975-67168997 CAGCTTCACAATATAGTGATGGG - Exonic
991596223 5:68308939-68308961 AAGTTTTAAATTTAAGAGATGGG - Intergenic
992293786 5:75306647-75306669 CAGTTTTAAAAGAAAAATATGGG - Intergenic
992901240 5:81299118-81299140 CAGTATTTCAATAAGTAGATGGG + Intergenic
993789051 5:92184621-92184643 AAGTCTTGCAATAAAGAAATAGG - Intergenic
993834663 5:92803681-92803703 CAGATGTGCAACAAAGAGATAGG - Intergenic
994244574 5:97465730-97465752 CAGTAATCCAATTAAGAGATTGG - Intergenic
996957664 5:129204050-129204072 AATTTTTACAATGCAGAGATGGG + Intergenic
997758154 5:136419860-136419882 CATTTTAAAAATGAAGAGATTGG + Intergenic
998988040 5:147783481-147783503 GAGTTTGACACTAAAAAGATTGG - Intergenic
1001113163 5:168915474-168915496 CAACTTTACAATAGAGGGATTGG - Intronic
1002855177 6:1030242-1030264 CATTTTTAAAATAAAAAGAAAGG + Intergenic
1003504983 6:6733568-6733590 CAGCTTTTCAATAAAGAGGCTGG + Intergenic
1004972875 6:20931378-20931400 CAATTTTACAAATAAGACATAGG + Intronic
1006132047 6:31875587-31875609 GAGTTTTACAGTTCAGAGATTGG - Intronic
1006650325 6:35545666-35545688 GGGTTTTACAATAAAGAGACGGG - Intergenic
1007806163 6:44449824-44449846 CATTTTTACATTAGTGAGATTGG + Exonic
1008286345 6:49656239-49656261 GAGTTTTACAATATGGAAATAGG - Intergenic
1010236891 6:73582559-73582581 CACTTTTTTAAAAAAGAGATGGG + Intergenic
1010684302 6:78833884-78833906 CAATTGAACAATAAAGACATGGG + Intergenic
1010686291 6:78858304-78858326 CTCTTTTACAAAAAAGAGAAGGG + Intergenic
1011149236 6:84251721-84251743 CAGTATAACAATATAAAGATAGG - Intergenic
1011760220 6:90556252-90556274 CAATTTTGCAATTAAGAAATTGG + Intronic
1011899899 6:92279552-92279574 CAGTTTTAAAATAAATTGTTTGG + Intergenic
1012487967 6:99743225-99743247 CATTTTAACAATAAAGGCATAGG + Intergenic
1013421567 6:109971755-109971777 AAGGTTGACAATAAAGAGCTGGG + Intergenic
1014005359 6:116411595-116411617 CAGTATTACAAGAAAAAAATTGG + Intronic
1014813590 6:125911361-125911383 CTCTTTTACAAAAAAGAGAAGGG - Intronic
1014941249 6:127441811-127441833 CAGTTTTACAATCAAGGAGTTGG + Exonic
1015169206 6:130232236-130232258 CAGTCTTACAATAGACTGATTGG + Intronic
1015193647 6:130501074-130501096 CAGTTCTTCACTAATGAGATTGG - Intergenic
1015873967 6:137803932-137803954 CAGTTTTACCAGAAATAGTTTGG + Intergenic
1016059489 6:139614991-139615013 CAGTTTTAGGATAAAGAAACTGG + Intergenic
1016500105 6:144711015-144711037 CTGTTTTAAAATAAATGGATAGG + Intronic
1017285397 6:152669187-152669209 TATTTTTACAAAATAGAGATAGG + Intergenic
1018436834 6:163767533-163767555 CTGTTATATAATAAAGAGGTGGG - Intergenic
1018506788 6:164480007-164480029 CATGATTACAATAAAGAGCTTGG - Intergenic
1018691176 6:166345336-166345358 CTCTTTTACAATAAAGAGAAGGG - Intergenic
1019007512 6:168812794-168812816 CAGTTTTAAAGTAAAGAGCAAGG - Intergenic
1021130076 7:16900653-16900675 CATGTTTAAAATAAAGAAATGGG - Intergenic
1022454380 7:30545745-30545767 CTCTTTTACAAAAAAGAGAAGGG + Intronic
1023431428 7:40095367-40095389 CAGTTTTACAACAATCAGAAAGG + Exonic
1023673454 7:42604468-42604490 CATTTTTAAAAATAAGAGATGGG + Intergenic
1024999988 7:55307837-55307859 CAGTTTTAAGATCAAAAGATTGG - Intergenic
1025223262 7:57134466-57134488 GAGTTTTACAAGAAAGGCATGGG - Intronic
1025264835 7:57448057-57448079 GAGTTTTACAAGAAAGGGGTGGG + Intergenic
1025634069 7:63306133-63306155 GAGTTTTACAAGAAAGACGTGGG - Intergenic
1025648629 7:63442034-63442056 GAGTTTTACAAGAAAGACGTGGG + Intergenic
1025741975 7:64205027-64205049 GAGTTTTACAAGAAAGGGGTGGG + Intronic
1025746443 7:64246960-64246982 GAGTTTTGCAAGAAAGGGATGGG + Intronic
1028212976 7:88098222-88098244 GTATTTTAAAATAAAGAGATAGG + Intronic
1028462035 7:91104834-91104856 TAGTTTTAAAAGAGAGAGATGGG + Intronic
1028480389 7:91298208-91298230 CATGTTGACAATAAAGAAATAGG - Intergenic
1028644778 7:93083340-93083362 CAGATTTACAAAGAAGAGCTGGG + Intergenic
1030542938 7:110855697-110855719 GAGTTTTAAAAGAAAGAGAAGGG - Intronic
1031395257 7:121265840-121265862 CATCTGTAAAATAAAGAGATTGG + Intronic
1032288751 7:130566916-130566938 CAGTTCTACCATAAAGACACAGG + Intronic
1032391466 7:131557599-131557621 GGGTTTTACAATTAATAGATTGG - Intronic
1032580752 7:133101156-133101178 CAGTTTTACTGTAAAGAAAAAGG + Intergenic
1032627705 7:133610469-133610491 CAGTATTAAAATAAACAGGTTGG - Intronic
1032847470 7:135763961-135763983 CAGTTTAAGAATAAAAGGATGGG + Intergenic
1032896842 7:136260967-136260989 CTCTTTTACAAAAAAGAGAAAGG - Intergenic
1034085563 7:148319322-148319344 CACTTTTATGATAAAGATATAGG - Intronic
1035524197 8:299492-299514 CAGTTTTAGAATTGGGAGATAGG - Intergenic
1037239808 8:16764094-16764116 CAGATTTACAAAAAAAAGAAAGG - Intergenic
1038696490 8:29811292-29811314 CCATCTTAAAATAAAGAGATTGG - Intergenic
1039259864 8:35759753-35759775 CAGTTTAACAATATAGAGCCAGG + Intronic
1039346017 8:36706504-36706526 AAGTTTAATAATAAAGGGATAGG - Intergenic
1039561318 8:38514407-38514429 CAGTTTTAAAATAAATACCTGGG + Intronic
1041330292 8:56716668-56716690 CTGCTTTACAATAAAGTGAGCGG - Intergenic
1042050666 8:64701930-64701952 CTGTTATAAAATAAAGAGAATGG - Intronic
1042362701 8:67900692-67900714 CAGGTTTACTGTAAAGAAATAGG + Intergenic
1043057638 8:75460212-75460234 CACTTTTTCAATATAGGGATAGG - Intronic
1043429586 8:80182088-80182110 TATTTTTAAAATATAGAGATGGG - Intronic
1043472423 8:80576138-80576160 AAGTTTTTAAATAAAGACATGGG - Intergenic
1045706472 8:104928976-104928998 AAGTTGTACATTAAAAAGATAGG + Intronic
1045964499 8:108009022-108009044 CATTTTGTCAATAATGAGATTGG - Intronic
1046042603 8:108924145-108924167 CAGTTTTGAAAAAAAGAGGTTGG + Intergenic
1046051536 8:109028789-109028811 CAGTTTAAGAATAAAGAGTTGGG + Intergenic
1046058440 8:109107081-109107103 CAGTTGTATAATAAAGAGAATGG + Intronic
1047318145 8:123753437-123753459 CATTTTTACATAAAAGTGATGGG - Intergenic
1047812631 8:128426973-128426995 CAGTTTTACAAAAGAAAGACCGG - Intergenic
1048585838 8:135773062-135773084 CAGTTTTAGAATAAGAAAATGGG + Intergenic
1048747863 8:137635360-137635382 AAGGTTAATAATAAAGAGATAGG - Intergenic
1049183088 8:141233357-141233379 CAGTTTATCAATAAAGATCTTGG + Intronic
1050214102 9:3302776-3302798 GTGTTTTACCATAAAGAAATTGG - Intronic
1050863853 9:10472357-10472379 AAGTTTCACATTACAGAGATGGG + Intronic
1051207179 9:14700370-14700392 TCATTTTACAATAAAGACATGGG - Intergenic
1051236147 9:15001277-15001299 CAATTTTAAAATAAAAGGATTGG + Intergenic
1052510238 9:29408550-29408572 CTGGTTTACAATAAAGTGACTGG - Intergenic
1052572971 9:30252672-30252694 CAATTTTAAAGTAAAGAAATAGG + Intergenic
1053265500 9:36710127-36710149 CATTCATACAATAAAGAGACTGG + Intergenic
1055602499 9:77934279-77934301 CTGTTTAACAATATAGAGAGAGG - Intronic
1056022384 9:82453170-82453192 TAGTTTTACAATAAAAAAAGTGG + Intergenic
1056033185 9:82574771-82574793 GAGAATTTCAATAAAGAGATAGG + Intergenic
1056046459 9:82722559-82722581 CAGTTTTACAATCATGAAACTGG - Intergenic
1056337759 9:85591824-85591846 CAATTTACCAATAAAGAAATTGG - Intronic
1057327466 9:94078835-94078857 CAGAATACCAATAAAGAGATGGG - Intronic
1058008660 9:99949102-99949124 CAATTTTACAATAAGGAAACTGG - Intronic
1058119584 9:101124017-101124039 CTGTTTTACAAAAAAGAGAAGGG - Intronic
1058602206 9:106682382-106682404 CAGGTGTACAATAAAGAGTCAGG - Intergenic
1059970460 9:119662385-119662407 CAACTATAAAATAAAGAGATTGG + Intergenic
1060770626 9:126329229-126329251 CACTTTTACATTACAGAAATGGG - Intronic
1061221027 9:129252261-129252283 CAGTTATTCAAAAAAGAGAGGGG + Intergenic
1061229733 9:129308200-129308222 CAATTTTTAAAAAAAGAGATGGG - Intergenic
1186584981 X:10863656-10863678 CAGTTTCAGAATTCAGAGATGGG - Intergenic
1186959166 X:14716261-14716283 CATCTTTAAAATGAAGAGATAGG - Intronic
1187515733 X:19968331-19968353 CAGTGTTGCAAGATAGAGATAGG + Intronic
1188804025 X:34565290-34565312 AAGTATTACAAGAATGAGATAGG - Intergenic
1189077489 X:37932336-37932358 CATCTTTACTTTAAAGAGATGGG + Intronic
1189501063 X:41559635-41559657 CAATTTTACAACAAAGATAACGG - Intronic
1189592341 X:42528002-42528024 AAGTTTTAAAATAAAAAGATGGG - Intergenic
1190031265 X:46975335-46975357 CAGTTTTAGAGTAAACATATAGG - Intronic
1190096906 X:47488766-47488788 CACATTTAAAATAAAGAGACTGG - Intergenic
1190555689 X:51632845-51632867 CACTATTACTATAAAGAAATAGG + Intergenic
1190572359 X:51796748-51796770 CAGATGTACAATAAGGAGAGAGG - Intergenic
1191070459 X:56395118-56395140 CAGTAATCCAATTAAGAGATTGG - Intergenic
1192076428 X:68002642-68002664 CAGTTTTAGAAAAAATAGAAAGG + Intergenic
1193574328 X:83181072-83181094 CAGTAATTCAATTAAGAGATTGG - Intergenic
1194033406 X:88842714-88842736 CTCTTTTACAAAAAAGAGAAGGG - Intergenic
1194093405 X:89604558-89604580 CTGTCTTAAAATAAAGAAATTGG - Intergenic
1194495381 X:94610770-94610792 CAGTTTGACTATAAAGACTTAGG - Intergenic
1195902142 X:109810405-109810427 ATCTTTTACAATAAAGAGATAGG - Intergenic
1196317019 X:114239146-114239168 CAGCTTCACAAGCAAGAGATTGG - Intergenic
1197237391 X:124082721-124082743 CAGTTTTAGAAGAAAGTGAAAGG - Intronic
1197661299 X:129176390-129176412 CAGACTGAAAATAAAGAGATGGG - Intergenic
1197830339 X:130635210-130635232 CCATTTTTCCATAAAGAGATTGG + Intronic
1199437941 X:147834761-147834783 GAATTTGAAAATAAAGAGATAGG - Intergenic
1199465434 X:148130401-148130423 CAGTTGTACAATAAAAACAAGGG + Intergenic
1199528224 X:148816561-148816583 CAGTATTAGAATAATGAGAATGG + Intronic
1200395523 X:155984427-155984449 CGGTTTTACAAAAAAGAAAAGGG - Intergenic
1200412323 Y:2872994-2873016 CAGTCTTACTAGAAAGAGGTTGG + Intronic
1200446035 Y:3260667-3260689 CTGTCTTAAAATAAAGAAATTGG - Intergenic