ID: 956647087

View in Genome Browser
Species Human (GRCh38)
Location 3:71466766-71466788
Sequence AGAGCACTGCCTAGGGCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 269}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956647081_956647087 -5 Left 956647081 3:71466748-71466770 CCATCGGGAAGGTCACAAAGAGC 0: 1
1: 0
2: 0
3: 6
4: 98
Right 956647087 3:71466766-71466788 AGAGCACTGCCTAGGGCAGGGGG 0: 1
1: 0
2: 1
3: 23
4: 269
956647080_956647087 -1 Left 956647080 3:71466744-71466766 CCGACCATCGGGAAGGTCACAAA 0: 1
1: 0
2: 0
3: 16
4: 85
Right 956647087 3:71466766-71466788 AGAGCACTGCCTAGGGCAGGGGG 0: 1
1: 0
2: 1
3: 23
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956647087 Original CRISPR AGAGCACTGCCTAGGGCAGG GGG Intronic
900609412 1:3538171-3538193 AGAGCCCAGCCCAGAGCAGGAGG + Intronic
900741047 1:4330976-4330998 AGAGCCCTGACTAGCACAGGAGG + Intergenic
900778068 1:4599527-4599549 AAAGGGCTGCCTCGGGCAGGGGG + Intergenic
900780547 1:4614892-4614914 AGAGCAATGGGGAGGGCAGGAGG + Intergenic
901643485 1:10704793-10704815 ACAGCACTGCCTGGGGCCCGAGG + Intronic
902134327 1:14291857-14291879 AGAGAACTGCCAAGCACAGGGGG - Intergenic
902218752 1:14951252-14951274 AGCCCACTGCCCAGGGCAGAGGG - Intronic
902537753 1:17131064-17131086 AGGGCACTGCCTAGCACAGCTGG + Intergenic
903190558 1:21653435-21653457 ACAGCACTGCCCAGAGCAGAAGG - Intronic
904318944 1:29684166-29684188 AGAGCATTCCCCAAGGCAGGCGG + Intergenic
905473032 1:38207343-38207365 CGAGCAGTGCCTGAGGCAGGAGG + Intergenic
906073740 1:43036331-43036353 ACAGCCCAGCCTTGGGCAGGCGG + Intergenic
906117651 1:43366935-43366957 AGAGCAGGGCCCAGGGCAGCAGG + Intronic
906521238 1:46468318-46468340 CCATCACTGCCTAGGGCATGGGG - Intergenic
907409496 1:54274433-54274455 AGAGCACTGGCTGGGGTGGGTGG + Intronic
907806606 1:57826776-57826798 AGAGCACTTCCTATTCCAGGAGG - Intronic
909541260 1:76794034-76794056 GAAACACTGCCAAGGGCAGGAGG + Intergenic
910367232 1:86478879-86478901 ACAGCACTGCCCAGGACAGGAGG + Intronic
913695632 1:121322589-121322611 AGAGTGATGCCTGGGGCAGGGGG + Intronic
914141933 1:144957470-144957492 AGAGTGATGCCTGGGGCAGGGGG - Intronic
914681836 1:149944184-149944206 AGGGCACTGTCTGGGGAAGGTGG + Exonic
920087299 1:203426940-203426962 AGAGGACTGCCTGGTGCAAGTGG + Intergenic
920482961 1:206340971-206340993 AGAGTGATGCCTGGGGCAGGGGG + Intronic
923063447 1:230497569-230497591 AGAGCTCTCCCTGGGGGAGGAGG + Intergenic
1062766914 10:73351-73373 GGAGCACTGACCAGGCCAGGTGG + Intergenic
1062826399 10:571845-571867 AGAGCAAGGCCCAGGGCAGTAGG + Intronic
1065179599 10:23111430-23111452 AGAGCACTGCCTGGTGCCTGCGG - Intronic
1069048684 10:63769343-63769365 AGAGCACTGGCTGAAGCAGGTGG - Intergenic
1069635681 10:69923497-69923519 AGAGCCCAGCCCATGGCAGGTGG - Intronic
1069639477 10:69945492-69945514 CGAACACTGCCTTGGGGAGGGGG - Intronic
1070539930 10:77408767-77408789 AGGGAGCTGCCAAGGGCAGGGGG - Intronic
1070765559 10:79054167-79054189 AGAGCAGTGCGCAGGGCAGCTGG - Intergenic
1070844695 10:79512696-79512718 TGAGCACTGCATTGGGAAGGTGG - Exonic
1070929109 10:80247615-80247637 TGAGCACTGCATTGGGAAGGTGG + Intergenic
1071520972 10:86331290-86331312 ACAGCCCTGGCTGGGGCAGGAGG + Intronic
1073291101 10:102413785-102413807 AGAGGACAGCCTTGGGCTGGGGG - Exonic
1076154019 10:128188945-128188967 AGAGCTCTGCAGAAGGCAGGTGG + Intergenic
1076222420 10:128745300-128745322 AGAGCACTGCAGAGGGATGGTGG + Intergenic
1076482128 10:130791919-130791941 AGAGGACAGCGGAGGGCAGGAGG - Intergenic
1076640334 10:131911620-131911642 TGAGCAAAGCCAAGGGCAGGTGG - Intronic
1077399130 11:2344634-2344656 AGGGCAATGCCCAGGGCTGGGGG + Intergenic
1078370497 11:10740764-10740786 AGGGCACTGGTTTGGGCAGGAGG - Intergenic
1078431456 11:11291665-11291687 GGAGCATTTCCGAGGGCAGGTGG - Intronic
1078579000 11:12524594-12524616 AGAGCAAGGCCAAGAGCAGGTGG - Intronic
1079187809 11:18253246-18253268 AGAGTCCTGCTTTGGGCAGGTGG - Intergenic
1079498925 11:21079783-21079805 ATAGCACTGCCTAGAACAGAAGG + Intronic
1079878702 11:25894748-25894770 TGATCATTGCCTAGGGCTGGGGG - Intergenic
1081499596 11:43653065-43653087 AGAGTCCTGCCTTGGGCTGGTGG + Intronic
1081692277 11:45086608-45086630 ACAGCACAGACTAGAGCAGGAGG - Intergenic
1082631933 11:55553676-55553698 AGACCATTCCCTAGGGCAGTCGG + Intergenic
1082820450 11:57541265-57541287 ATGGTACTGCCAAGGGCAGGGGG + Intergenic
1084087358 11:66860675-66860697 AGAGCATGGGCTTGGGCAGGCGG + Intronic
1084422198 11:69066042-69066064 ACAGAACTCCCTAAGGCAGGTGG - Intronic
1084575006 11:69983440-69983462 AGTGCACTGGCTCGGGGAGGTGG - Intergenic
1085052121 11:73385206-73385228 AGGGCCCTGCCTAGGGGAGGGGG + Intronic
1088971276 11:114776461-114776483 AGAGCACTGCCTCGAGCCAGAGG - Intergenic
1089179953 11:116576620-116576642 CCAGCACTGCAGAGGGCAGGGGG + Intergenic
1089644165 11:119867087-119867109 AGAGCACTTCCCAGGGTAGCTGG - Intergenic
1091119727 11:133046878-133046900 AGAACAATGCCTAAGGCAGCAGG - Intronic
1091832457 12:3559704-3559726 AGACATCTGCCTGGGGCAGGAGG - Intronic
1092132827 12:6124490-6124512 AGAGCATGGCCTAGGGTGGGCGG - Exonic
1095947968 12:47764584-47764606 AGAGCACTGGCTGGGGCAGGGGG + Intronic
1096524826 12:52204197-52204219 AGGACTCTGCCTGGGGCAGGAGG + Intergenic
1097942494 12:65326981-65327003 AAAGCACTGCAGAGGGCAGGGGG - Intronic
1098817172 12:75182230-75182252 AAAGCACTGACTATGGCCGGGGG + Intronic
1099028377 12:77494092-77494114 AGAGTATTGCATAGGGCAGCAGG - Intergenic
1102230192 12:111256936-111256958 GGAGCTCAGCCTAGGGGAGGGGG + Intronic
1102725892 12:115064251-115064273 AGGCCACAGCCTGGGGCAGGAGG + Intergenic
1102868483 12:116393521-116393543 AGCGCACTGGCAGGGGCAGGAGG + Intergenic
1103536729 12:121638612-121638634 ACACCCCTACCTAGGGCAGGAGG + Intronic
1103869851 12:124083572-124083594 AGAGCACTGTGAAGAGCAGGCGG + Intronic
1104400417 12:128471485-128471507 AGAGCTATGCCTAGGGCCAGGGG - Intronic
1104761772 12:131301049-131301071 AGAGGACGGCCCAGAGCAGGAGG + Intergenic
1106487242 13:30182481-30182503 AAAGCACATCCTGGGGCAGGAGG + Intergenic
1107655733 13:42590565-42590587 AAAGCACTGCCAATGGAAGGTGG + Intronic
1111542646 13:89689156-89689178 ACTGCACTGCCTAGGGTTGGGGG - Intergenic
1112500637 13:99940488-99940510 AGAGCACGGCAGAGGGCAGATGG - Intergenic
1113426498 13:110212769-110212791 AGGGCACAGCCTAGGGCAGATGG + Intronic
1113468404 13:110527813-110527835 AAAGAACAGGCTAGGGCAGGAGG + Intronic
1114699976 14:24666870-24666892 TGAACACTGCCTAGAGAAGGAGG + Intergenic
1119029644 14:71181763-71181785 AGACCAAAGCCAAGGGCAGGCGG - Intergenic
1121320027 14:92986873-92986895 AGACCAGTGCCCTGGGCAGGAGG + Intronic
1121674414 14:95740907-95740929 AGAGCCTGGCCCAGGGCAGGTGG + Intergenic
1122099688 14:99397629-99397651 TTAGCACAGCCCAGGGCAGGAGG + Intergenic
1122288754 14:100668224-100668246 AGAGCCCTGTCCAGTGCAGGGGG + Intergenic
1122430119 14:101635135-101635157 GGAGGACTGCCTGGGGGAGGCGG - Intergenic
1122739292 14:103861963-103861985 AGAGCACAGGCAAGGCCAGGAGG + Intergenic
1123055207 14:105566235-105566257 AGAGGACTGCCTGGTGGAGGGGG - Intergenic
1123079656 14:105686079-105686101 AGAGGACTGCCTGGTGGAGGGGG - Intergenic
1124150055 15:27169323-27169345 AGAGCACTTCCTGGGGAGGGAGG + Intronic
1124500398 15:30223172-30223194 CGAGCACGGCCAAGGGCAGCCGG + Intergenic
1124743175 15:32315494-32315516 CGAGCACGGCCAAGGGCAGCCGG - Intergenic
1124827577 15:33114013-33114035 GGAGAACTGCCAAGGGGAGGAGG - Intronic
1128660744 15:69499348-69499370 AGAGCACAGCCTTGGACGGGGGG + Intergenic
1128688369 15:69704348-69704370 AGAGCTCTGCCAAGGCCAAGAGG - Intergenic
1128797867 15:70478291-70478313 AGAGGCCTGCCTTGAGCAGGTGG - Intergenic
1129148391 15:73670648-73670670 AGAGCAGCGACTAGGGCAGAGGG - Intergenic
1130351204 15:83093369-83093391 ACAGTCCTGCTTAGGGCAGGAGG - Intergenic
1130535800 15:84784166-84784188 AGTGCACGGCTTTGGGCAGGAGG - Exonic
1131573646 15:93564640-93564662 AGAACAGTGACTAGGGCATGAGG - Intergenic
1132969111 16:2676550-2676572 AGAGCACTGGCCAGGCCAGGTGG + Intergenic
1133395854 16:5446878-5446900 AGACCACTTCCTAGGGAAGCTGG - Intergenic
1136298805 16:29319632-29319654 AGAGCTCTCCGTAGCGCAGGTGG + Intergenic
1136373200 16:29848789-29848811 AGGACCCTGCCTAGGGCAGTAGG + Intergenic
1137851399 16:51748758-51748780 AGTTCACTCTCTAGGGCAGGAGG + Intergenic
1137858492 16:51821302-51821324 AGAACACTGCCTGGCGCAGAGGG - Intergenic
1138591759 16:58003135-58003157 GTAGCACTGGCTAGGCCAGGTGG + Intronic
1140479937 16:75257000-75257022 TCAGCACTGCCTGGGGGAGGGGG + Intronic
1140771457 16:78208103-78208125 AGAGCACTGCTGAGGCCAGATGG - Intronic
1141261369 16:82456773-82456795 AGGGCACTGCCTCAGTCAGGAGG - Intergenic
1141368436 16:83465350-83465372 ATAGCAACGCCTAGGGCAGGAGG + Intronic
1141802363 16:86319488-86319510 CCAGCTCTACCTAGGGCAGGAGG - Intergenic
1142060474 16:88026130-88026152 AGAGCTCTCCGTAGCGCAGGTGG + Intronic
1142177769 16:88652801-88652823 GAAGCAGTGCCCAGGGCAGGGGG - Intronic
1142744341 17:1948231-1948253 AGAGCACTGCCAGGACCAGGTGG - Intronic
1143090446 17:4446617-4446639 AGGGCCCAGCCTTGGGCAGGAGG + Intronic
1143490437 17:7282553-7282575 AGAGCCATGCCCAGGGGAGGAGG - Intronic
1143495455 17:7309682-7309704 TGAGCACTGCATTGGGAAGGTGG - Exonic
1143697402 17:8630605-8630627 AGTGCACGGCCCAGGGCTGGGGG - Intronic
1143857519 17:9863186-9863208 AGAGGACTGTGGAGGGCAGGAGG - Intronic
1143907419 17:10220303-10220325 AGAGCAGTGCCTAGGTCCAGAGG + Intergenic
1144658228 17:17051670-17051692 AGAGCTCTGGGTAGGGCATGGGG - Intronic
1145912271 17:28549638-28549660 AGAACACAGGCTAGGCCAGGAGG + Intronic
1147310760 17:39595063-39595085 GGAGCACTGCATGGGGCAGATGG - Intergenic
1147794078 17:43030291-43030313 GGAGAACTGGCTAGGGCTGGGGG - Intergenic
1147945026 17:44075980-44076002 TGTGCACTGCCCAGGGCACGAGG - Exonic
1148367478 17:47067300-47067322 TGAGCGCTGCCTAGGGGACGCGG + Intergenic
1149403478 17:56322983-56323005 TGAGCACTTACTAGGGCTGGAGG + Intronic
1151510076 17:74552835-74552857 AGACAAGTGCCCAGGGCAGGGGG + Intergenic
1151575174 17:74949562-74949584 AGGGCACTGCCTAGAGCCAGAGG + Exonic
1151805731 17:76404116-76404138 AGAGCAATGGCTGGCGCAGGGGG + Intronic
1151911884 17:77088845-77088867 AGAGCTCTGCCGGGGGCTGGAGG + Exonic
1152608707 17:81305353-81305375 GGATCTCGGCCTAGGGCAGGGGG + Intergenic
1152653596 17:81508868-81508890 TGAGCACTGGCCAGGGCATGGGG - Intergenic
1152661461 17:81544237-81544259 ATAGGACAGCCCAGGGCAGGGGG - Intronic
1152690045 17:81713829-81713851 AGAACACCGCCTGGGGGAGGCGG + Intronic
1153838202 18:8983174-8983196 AGGACAGTGCCTATGGCAGGAGG + Intergenic
1153952445 18:10068818-10068840 AGAGCACTGGATATGCCAGGAGG - Intergenic
1156205142 18:34877527-34877549 AAAACACTGCTTAGGGCAGTGGG - Intronic
1156848687 18:41700329-41700351 AGAGCCCTGTCTAGGTCAGGTGG - Intergenic
1157625508 18:49047606-49047628 AGAGCACTGTGCAGGGCAGGTGG - Intronic
1158271933 18:55726036-55726058 AGAGCAGTGCCTAGAGCCAGAGG + Intergenic
1158688126 18:59633076-59633098 AGAGCTGTGCCCAGGGAAGGAGG - Intronic
1161072511 19:2269911-2269933 AGAGCACTGCTAAGGCCGGGGGG - Intronic
1162784925 19:13028687-13028709 AGAGCACTGCCGTGGGGAGGAGG + Intronic
1163056772 19:14725909-14725931 AGGGCACTGCCTAGTGGAGCTGG - Intronic
1165062711 19:33212634-33212656 GGAGCACTGCGGAGGGAAGGCGG + Exonic
1165069860 19:33248985-33249007 AGAGGACTGCTTAGGGGAGAAGG - Intergenic
1165804500 19:38572335-38572357 GGAGCACTGGCTGGGGCTGGGGG + Intronic
1166041098 19:40203520-40203542 AGAGCACTGTCGTGGGCAGCAGG + Intronic
1166089197 19:40497387-40497409 TGAGCACTGCCCAGGGCAATGGG - Intronic
1166218809 19:41352810-41352832 CGAGCACGGCCTCGGGCAGCGGG + Exonic
1166381265 19:42356455-42356477 TGAGGACTGCCCTGGGCAGGTGG + Intronic
1166499710 19:43331527-43331549 GGAGCACTTCCTAGGGCCAGGGG + Intergenic
1166743468 19:45128614-45128636 TGAGCACTGCATTGGGAAGGAGG - Intronic
1167454717 19:49592081-49592103 AGAGCAGTGCCTGGGGCGCGGGG - Intronic
1168552186 19:57305607-57305629 GGAGGACTGCTTAGGCCAGGAGG - Intergenic
925925954 2:8670780-8670802 CCAGCACTGCCAATGGCAGGTGG - Intergenic
925970279 2:9101710-9101732 AGAGAAATGCCAAGGGCAAGGGG + Intergenic
926004842 2:9365681-9365703 AGAGCAGTCCCTTGGCCAGGAGG - Intronic
926109612 2:10173562-10173584 AGAGCCCTGCCCAGGGGTGGTGG - Intronic
926718338 2:15941649-15941671 AAGGCACTGCCTGGGGGAGGGGG - Intronic
927441993 2:23125453-23125475 AGTGAATTGCCTTGGGCAGGGGG - Intergenic
927521745 2:23703222-23703244 AGTGTACTGCCTTGGGCAGAGGG - Exonic
928132502 2:28662935-28662957 AGCACCGTGCCTAGGGCAGGAGG + Intergenic
928256054 2:29723490-29723512 ATAGCAGTGACTAGTGCAGGAGG - Intronic
928763583 2:34613870-34613892 ATAGCACTGGCTAGAGCAGGAGG + Intergenic
931455963 2:62410012-62410034 TGAGCCCTGCCCAGGGTAGGAGG + Intergenic
931828005 2:66021415-66021437 AGAACACTGGCTAAAGCAGGTGG - Intergenic
932565086 2:72901118-72901140 AGGGCACTGCTTAGGGGAGGTGG + Intergenic
932803251 2:74761522-74761544 AGACCACTTCCTTGGGCAGAAGG - Intergenic
933174071 2:79157217-79157239 AGTTCACTGACTAGTGCAGGAGG - Exonic
935351490 2:102154945-102154967 AGAGCCATGCCCAGGGCAGGAGG - Intronic
936017884 2:108973351-108973373 AGGGGGCTGGCTAGGGCAGGAGG + Intronic
937355631 2:121196469-121196491 TGAGCAATGCGTAAGGCAGGAGG - Intergenic
938560663 2:132469647-132469669 ATTGCACTGTCTGGGGCAGGTGG - Intronic
943378568 2:187114215-187114237 AATGCATTGCCTAGGGCAGATGG - Intergenic
945969388 2:216221219-216221241 GGAGCAGTGAGTAGGGCAGGTGG - Intergenic
946305679 2:218855781-218855803 AGAGCACGGGCTAGGGAAGGAGG - Intergenic
947370446 2:229440359-229440381 AGGGCACTGCCCAGGGCGTGAGG - Intronic
947589120 2:231374947-231374969 ATAGCACAGCCTGGGGCTGGTGG + Intergenic
948516784 2:238509207-238509229 GGAGCAGTGCCTGGGGCTGGAGG + Intergenic
1168787354 20:551404-551426 AGAGAACTTCTTGGGGCAGGGGG + Intergenic
1168957020 20:1841452-1841474 ACAGCACTGCCTGAGGCTGGGGG - Intergenic
1171210134 20:23310467-23310489 AGAGTCCGGCCCAGGGCAGGTGG - Intergenic
1172847453 20:37938393-37938415 AGGGCCCAGCCTGGGGCAGGAGG + Intronic
1173548106 20:43914697-43914719 CGGGCGCTGCCTAGGGCCGGGGG - Intergenic
1173860365 20:46278975-46278997 AGACCACTGCTTGGGGGAGGGGG + Intronic
1175191187 20:57213087-57213109 CGAGCTCTGTCTGGGGCAGGAGG - Intronic
1175410066 20:58761947-58761969 AGAGAACTGCCCAGGGCTGTTGG + Intergenic
1175473870 20:59254927-59254949 AGAGCACTCCCAAGGGGAGCTGG - Exonic
1175724357 20:61307601-61307623 AGATTCCTGCCTGGGGCAGGTGG - Intronic
1179100301 21:38350707-38350729 AGGGCATTGCCGAGGGCAAGAGG + Intergenic
1179533060 21:42033135-42033157 AGGGCACAGCCAGGGGCAGGTGG + Intergenic
1179791620 21:43759249-43759271 AGGGCACTGGCCAGGGAAGGTGG + Exonic
1180043218 21:45291170-45291192 AGAGCACTTCCTAGGGGATCTGG + Intergenic
1180696257 22:17753430-17753452 AGACCGTTGCCTAGGGGAGGCGG - Intronic
1181539721 22:23566719-23566741 TGAGCTCTGCCAAGGGCCGGGGG + Intergenic
1182093808 22:27613230-27613252 AAAGCTCTGCCCTGGGCAGGTGG + Intergenic
1183227290 22:36559194-36559216 AAACCACTGCTTAAGGCAGGAGG - Intergenic
1184491203 22:44810161-44810183 GGATCACAGCCTAGTGCAGGAGG - Intronic
1185264660 22:49894533-49894555 ACAGCACGGCCTCAGGCAGGAGG + Intergenic
953837858 3:46362669-46362691 AGGGCCCTGCCTAGAGGAGGGGG + Intergenic
954249271 3:49355626-49355648 AGATCACTGCTTAGGGCAAGAGG + Intergenic
954433206 3:50482300-50482322 AGAGGACTCCCCAGGGAAGGTGG - Intronic
954800563 3:53184818-53184840 AGAGCTCAGCCAAGGGCAGGGGG - Intronic
956647087 3:71466766-71466788 AGAGCACTGCCTAGGGCAGGGGG + Intronic
956923088 3:73951551-73951573 AGAGCAATGCATAGTGCAAGTGG + Intergenic
961563786 3:127749011-127749033 GGAGCACTCCCTGGGGAAGGGGG - Intronic
961717258 3:128866333-128866355 AGAACAATGCCAAGGGGAGGTGG - Intergenic
965664889 3:171082775-171082797 AGACCACTGCATAGGGGTGGGGG - Intronic
968454615 4:690597-690619 GGAGCACTGCCTCTGACAGGTGG + Intergenic
968697906 4:2041797-2041819 AGAGGACTGCCTGGAGGAGGCGG - Intronic
968900329 4:3428221-3428243 AGGGCACTGCGCAGGGCAGGCGG - Intronic
968984774 4:3869164-3869186 AGAGCAGTGTCAAGGGCAGTGGG + Intergenic
969292919 4:6252227-6252249 GGAGCTCTGCCTGGGGCAGGAGG - Intergenic
972565539 4:40265808-40265830 AGAGCAGAGCCTTAGGCAGGTGG + Intergenic
974966028 4:68761586-68761608 AGAGCACTGCCTAGTGGAGCTGG - Intergenic
974969620 4:68807792-68807814 AGAGCACTACCTAGTGGAGCTGG + Intergenic
976205040 4:82616528-82616550 AAATCACTGGCTAGGGAAGGGGG + Intergenic
976814627 4:89133223-89133245 AGAGCTGGGCCTAGGGCAAGGGG + Intergenic
985619084 5:944275-944297 AGAGAACTGCCTGGGGCCAGTGG + Intergenic
986385376 5:7228033-7228055 AAAGCTCTGCCCTGGGCAGGGGG + Intergenic
986632128 5:9784034-9784056 AGAACACTACCTAGGGCATCAGG + Intergenic
988898449 5:35703580-35703602 GGAGCACTGCCTGGGGCTTGGGG + Intronic
992663786 5:78985767-78985789 AGAGCCCAGCCTGTGGCAGGTGG + Exonic
997390319 5:133509830-133509852 TGGGCACTGCCCAGGGCAGCAGG - Intronic
999210777 5:149886518-149886540 AGAGGACTGCCCAGGGCTGAGGG + Intronic
999304252 5:150509491-150509513 AGGCCTCTGCCTGGGGCAGGAGG + Intronic
999808594 5:155107091-155107113 AGCCCACTGCCTAGGGAAAGAGG - Intergenic
1000293929 5:159896770-159896792 AGAGTACTGCCCAGCACAGGGGG + Intergenic
1001253802 5:170168600-170168622 AAAGCACTGCCTATTGCTGGAGG + Intergenic
1002295014 5:178225482-178225504 AGAGAAATGCTGAGGGCAGGAGG + Intronic
1002867228 6:1132174-1132196 AGAGATGTGTCTAGGGCAGGGGG + Intergenic
1005661551 6:28003592-28003614 GGAACACTGTCTAGGGCTGGGGG - Intergenic
1006897527 6:37480414-37480436 AGGTCAGTGCCTAGGGCACGTGG + Exonic
1006939935 6:37745012-37745034 AGAGGACTGCCCAGGCAAGGAGG + Intergenic
1007144812 6:39617775-39617797 AGAGCAATGTCAAGAGCAGGTGG + Intronic
1007230918 6:40347292-40347314 AGACCCCTGCCTAGAGCAGAGGG - Intergenic
1007719294 6:43875870-43875892 GAATCACTGCTTAGGGCAGGGGG - Intergenic
1008180206 6:48318892-48318914 AGAGCAGTGCGGTGGGCAGGAGG - Intergenic
1009413731 6:63394591-63394613 AGAGCAGCCCCTAGGGCTGGTGG - Intergenic
1010177944 6:73051373-73051395 AGAGCAGTGCCAAGAGCAAGTGG - Intronic
1012396707 6:98806522-98806544 AGGCCACTGCACAGGGCAGGAGG - Intergenic
1014799256 6:125759443-125759465 AGAGCAGAGCCGTGGGCAGGAGG - Exonic
1018935423 6:168271017-168271039 AGAGCAGTCCCTCGGGCACGTGG - Intergenic
1019264067 7:102549-102571 AGAGCACTGCTGAGGACAGCTGG - Intergenic
1019492350 7:1321376-1321398 ACAGCTTTGCCTAGGGCTGGTGG + Intergenic
1019923444 7:4177424-4177446 AGAGAACTCCTTAGGGCAGGGGG - Intronic
1020899706 7:13989830-13989852 CGAGCACCCCCTAGGGCAGAGGG - Exonic
1021762575 7:23915567-23915589 AGACCAATGCCCAGGACAGGAGG - Intergenic
1023145899 7:37151030-37151052 AGAGGGCTGACTTGGGCAGGTGG - Intronic
1029049564 7:97670337-97670359 AAAGCACACCATAGGGCAGGAGG + Intergenic
1032162656 7:129522698-129522720 AGAGCAGTGACTGGGGGAGGGGG + Intergenic
1033213073 7:139474924-139474946 AGAGTCCTGCCTTGGGCAGAAGG - Intronic
1035643157 8:1198822-1198844 AGACCAATGCCTAGCCCAGGAGG - Intergenic
1037660078 8:20918836-20918858 AGAGCTCTTCCTAGGGCAGAGGG + Intergenic
1037670514 8:21011532-21011554 AGAGCACAGCAAAGAGCAGGTGG - Intergenic
1037716954 8:21408817-21408839 GGGGCTCTGCCTGGGGCAGGAGG - Intergenic
1037961448 8:23101517-23101539 GGAGCACTGCCTAGGGCTAATGG - Intronic
1039547059 8:38417945-38417967 AGAGGGCTGCTTTGGGCAGGTGG - Exonic
1039785707 8:40832575-40832597 TCAGCACTGCCAAGGGCAGCTGG - Intronic
1040532382 8:48276317-48276339 AGACCACCGCCTAAGGCAGATGG + Intergenic
1042325011 8:67519185-67519207 AGAGCACTGGCTAAGGCACTGGG - Intronic
1046900212 8:119515800-119515822 ACAGCACTGACTAGGGCTGTTGG - Intergenic
1048283616 8:133123723-133123745 AGAGCACAGACCAGGGCTGGGGG - Intronic
1048375416 8:133818641-133818663 TCAGCACTGTATAGGGCAGGTGG + Intergenic
1049351063 8:142165073-142165095 AGAGCACTGGCTAGGGCGCAGGG + Intergenic
1049610430 8:143552653-143552675 AGAGCCCTGCTAAGGCCAGGGGG - Intergenic
1049810300 8:144565186-144565208 AGAGGACTGTCTGGGCCAGGAGG + Intronic
1055985827 9:82056104-82056126 ACAGCACTGCCCAGGGTGGGTGG - Intergenic
1056585513 9:87925014-87925036 ACAGCACTGCCCAGGGTGGGTGG + Intergenic
1056611368 9:88127929-88127951 ACAGCACTGCCCAGGGTGGGTGG - Intergenic
1059765183 9:117377254-117377276 AGGGCTCTGAATAGGGCAGGAGG + Intronic
1059941880 9:119367668-119367690 AAAATACTGCCAAGGGCAGGGGG - Intronic
1060194832 9:121616892-121616914 ACAGCAGTGCCTGGGGCAGCAGG - Intronic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1061275881 9:129569183-129569205 TGAGCTCTGCCAAGGGCCGGGGG + Intergenic
1061299630 9:129697323-129697345 GGGGCACGGCCTAGGGGAGGGGG - Intronic
1061382852 9:130268699-130268721 AGAGGACTCCCTGGGGCATGTGG + Intergenic
1062118867 9:134823207-134823229 GGAGCCCTTCCTAGGGCAGGCGG - Intronic
1062120529 9:134831644-134831666 AGGGCAGTGCCAAGCGCAGGCGG - Intronic
1062738337 9:138150966-138150988 GGAGCACTGACCAGGCCAGGTGG - Intergenic
1185683204 X:1906055-1906077 AGGGCTCTGGCCAGGGCAGGGGG + Intergenic
1186889397 X:13945403-13945425 AGACCACTGGCTAGGAGAGGAGG + Intergenic
1194288588 X:92040109-92040131 CAAGCACTGCCTGGGGCTGGGGG + Intronic
1194336982 X:92660181-92660203 AGAGTCCTGCCTTGGGCAGGTGG - Intergenic
1195003962 X:100668760-100668782 AGAGCACACGCTTGGGCAGGGGG + Intronic
1195650168 X:107275440-107275462 AGAACTCTGCCTAGGACAGCAGG + Intergenic
1196100881 X:111845915-111845937 GGAGCATGGCCTAGTGCAGGAGG + Intronic
1197264893 X:124358671-124358693 ACAGAACTGCCCTGGGCAGGTGG + Intronic
1199222754 X:145336195-145336217 AAGGCACAGCCTAGGGCATGTGG + Intergenic
1200606109 Y:5264674-5264696 CAAGCACTGCCTGGGGCTGGGGG + Intronic
1200645416 Y:5776916-5776938 AGAGTCCTGCCTTGGGCAGGTGG - Intergenic