ID: 956647436

View in Genome Browser
Species Human (GRCh38)
Location 3:71470230-71470252
Sequence ATGAAGAAACAGGCTCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1184
Summary {0: 1, 1: 9, 2: 42, 3: 242, 4: 890}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956647436 Original CRISPR ATGAAGAAACAGGCTCAGGA AGG (reversed) Intronic
900864864 1:5261039-5261061 ATGAAGAAACTGACGCAGGGTGG + Intergenic
901006359 1:6173550-6173572 ATGAAGAGAGAGGCTCAGTGGGG - Intronic
901234150 1:7658587-7658609 AAGAAAACAGAGGCTCAGGAGGG - Intronic
901669793 1:10849564-10849586 GTGAGGAAACAGGCTCAGAGAGG - Intergenic
902357589 1:15916834-15916856 ATGAAGCAGCAGGCTGAGCATGG + Intronic
902405179 1:16178918-16178940 TTGAAGAAACAGGCTCAGGGAGG - Intergenic
902540341 1:17149838-17149860 GTGGAGTAACAGGCTCAGGGAGG + Intergenic
902737295 1:18409533-18409555 AGGAAGAAACAGGATCTGAAGGG - Intergenic
902767088 1:18624343-18624365 AGGAAGAAATAGACTCAGGGAGG - Intergenic
902914842 1:19631033-19631055 ATGAAGAAACAGTTTTTGGAAGG + Intronic
903024395 1:20417150-20417172 ATGAAGAAGCAGGCTGAGAGAGG - Intergenic
903221755 1:21873261-21873283 ATGAAGAAACAGGCTCGGACAGG + Intronic
903289439 1:22298665-22298687 GTGAAGAAACAGGTTCAGACAGG + Intergenic
903332002 1:22601223-22601245 CAGAAGAAGCAGGCTGAGGAAGG - Intronic
903469204 1:23573758-23573780 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
903610728 1:24610082-24610104 ATCAGGAAACAGGTTCAGCAAGG + Intergenic
903891905 1:26575339-26575361 ATGGGGAAACAGGCTCAAGTTGG + Intergenic
903992547 1:27283792-27283814 ATGAGCAAACAGGCTCAGACAGG - Intronic
904473590 1:30750748-30750770 ATGAGGAAACAGGCTCAGGAGGG - Intronic
904535519 1:31196939-31196961 ACCAAGAAACAGGCACAGGAAGG - Intronic
904562233 1:31406653-31406675 ATAGAGAAACAGGCCCAGAAAGG + Intergenic
904565289 1:31425028-31425050 ATGAAGAGTAAGGCTCAGAAAGG + Intronic
904597001 1:31653141-31653163 ATGAGGACACAGGCTCAGAGAGG + Intronic
904846349 1:33420919-33420941 ATGAAGAAACAGGCTCAAAGAGG - Intronic
904849182 1:33444317-33444339 ATGAATAAATAGGCTCAGTGAGG + Intergenic
904940091 1:34159623-34159645 ATGAAGAAACAGGTTCAGAGAGG - Intronic
905003322 1:34690623-34690645 ATGACGAAACAGGCACAGAGTGG - Intergenic
905291177 1:36922731-36922753 ATGAGGAAACAGGTTCCGGGAGG + Intronic
905295536 1:36952055-36952077 ATGCAGAAACAGGGTCAGCAAGG + Intronic
905476873 1:38235200-38235222 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
905652927 1:39668521-39668543 ATGGGGAAACAGGCCCAGAAAGG + Intronic
905833900 1:41099742-41099764 ATAAGGAAACGGGCTCAGAAAGG - Intronic
905884709 1:41485370-41485392 ACAAGGAAACAGGCCCAGGAAGG - Intergenic
905897351 1:41557538-41557560 ATGAAGGCGCAGGCTCTGGAAGG + Intronic
906166066 1:43687308-43687330 ATGAAGAAACAGGCACCTAATGG + Intronic
906383171 1:45345676-45345698 ATGAAGAAACAGACTCAGAGAGG + Intronic
906488657 1:46250518-46250540 ATGAGAAAACAGTCTCAGAAGGG + Intronic
906647211 1:47483786-47483808 ATGACCAAGCAGGCTGAGGATGG + Intergenic
906674216 1:47681517-47681539 ATGAGGAAACTGGCTCAGAAAGG - Intergenic
906689639 1:47784130-47784152 ATGAGGAAACAGGCTCAGTGAGG + Intronic
906750564 1:48255345-48255367 ATGAAGAAACAAACTCAGAGAGG + Intergenic
906808830 1:48805789-48805811 ATGAGGAAACAGGCTGAGAGAGG - Intronic
907076998 1:51587998-51588020 ATGAGGAAACAGGTTCAGAGAGG - Intronic
907399708 1:54217375-54217397 CTGAAGACACAGAGTCAGGAGGG - Intronic
907407397 1:54262069-54262091 ATGAAGAAATAGGGTTTGGAAGG + Intronic
907511895 1:54967609-54967631 AAGAAGAAACAGGCTCCGAGGGG - Intergenic
907747369 1:57226711-57226733 GTGAGGAAACAGGCTGAGAAAGG + Intronic
907782201 1:57577560-57577582 ATAAAGAAACAGGCTCAGAGAGG + Intronic
908028725 1:59977315-59977337 ATGAGGAAATAGGCACAGCATGG + Intergenic
908564345 1:65339228-65339250 ATGAAGGAACAGGCACTGAAAGG + Intronic
908797987 1:67850566-67850588 ATGAAGAAAGAGGCTCAGAGAGG - Intergenic
908916250 1:69129854-69129876 ATAACGAAACAGGGTAAGGAGGG + Intergenic
908918260 1:69158043-69158065 CAGAAGAAACAGCTTCAGGAAGG - Intergenic
909421827 1:75475844-75475866 ATGAAGAAATTGGCCCAGGGAGG - Intronic
909504542 1:76373286-76373308 ATGAGAAAACAGGCCCAGCAAGG - Intronic
909546228 1:76851321-76851343 CAGAAGAACCAGGCTCAGAAAGG + Intergenic
909661016 1:78082150-78082172 ATGTGGAAACAGGCTCAGGAAGG + Intronic
909986509 1:82167261-82167283 ATGAAAAAAAAGGCTCAGGCAGG - Intergenic
910262132 1:85303069-85303091 ATGAAGAAACTGGCCAAGCAGGG + Intergenic
910473035 1:87575962-87575984 ATGAGGAAATAGGCTTAGAATGG + Intergenic
910667207 1:89738766-89738788 ATGGAGGAAAAGGCTCATGAAGG + Intronic
910684209 1:89899813-89899835 ACAAAGAAACAAGCTCAGAAAGG - Intronic
910924108 1:92380743-92380765 ATTCAGAAACATTCTCAGGAAGG + Exonic
911052693 1:93684595-93684617 GGGAGGAAACAGACTCAGGAAGG + Intronic
911582020 1:99644931-99644953 ATGAGGGAACAGGCTCAGAGAGG - Intergenic
912107927 1:106304067-106304089 ATGAAAAAGCAGGTTCAGGAAGG - Intergenic
912310664 1:108617796-108617818 ATGAAGAAACGGCCTCAGAAAGG + Intronic
912448863 1:109757701-109757723 AAGAAGAAAAAGGCTTGGGATGG + Intronic
912587730 1:110782016-110782038 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
912597897 1:110897643-110897665 ATGAAGAAACAGGCATAAGGTGG - Intronic
913047588 1:115087702-115087724 ATGAGGAAACAGGCTCAAATTGG - Intronic
913445131 1:118943059-118943081 ATGAAGAAATTGGCTCAGAAAGG - Intronic
913539462 1:119804975-119804997 GTGAGGAAACAGGCTCAGGATGG + Intronic
914447147 1:147759727-147759749 ATGAAGAAACAGACTCAGTGAGG - Intronic
914854468 1:151341153-151341175 ATTAAGAAACAGGAAAAGGAAGG + Exonic
914902517 1:151718560-151718582 ACAAAAAAACAGGCTAAGGAAGG - Intronic
914965016 1:152248630-152248652 ATGAGGAAACAGACTCAGAAAGG - Intergenic
914973441 1:152333211-152333233 ATGAGGAAACAGACCCAGAAAGG - Intergenic
915068769 1:153248097-153248119 ATGAAGATATAGGATCAGAAAGG + Intergenic
915676777 1:157539240-157539262 ATGATGAAACTGGTACAGGATGG + Exonic
916211877 1:162366369-162366391 ATGAGGTAACAGACTCAGGGAGG + Intronic
916271015 1:162941429-162941451 ATGAAAAAGCAGGATAAGGAAGG - Intergenic
916880032 1:169011819-169011841 ATGAGGAAGCAGGCTTAGGGAGG - Intergenic
917013349 1:170500696-170500718 ATACAGAAACAGGTTCAGAAAGG - Intergenic
917347206 1:174040562-174040584 ATGAGGAAACAGGCACAGAAGGG + Intergenic
917470308 1:175320982-175321004 ATGAAGAAACTGGCCCAGAGAGG + Exonic
917965281 1:180174867-180174889 ATGAAGAAACAGGCTCGGCCAGG + Intronic
918001085 1:180496912-180496934 ATGAAGAGAGAAGCTCAGGAGGG + Intronic
918044325 1:180932352-180932374 ATGGAGAAAGAGGCCCACGAAGG - Intronic
918256174 1:182749953-182749975 ATGAAGAAACAGACTAAGAGAGG - Intergenic
918346571 1:183612633-183612655 ACGAAGAAACAGGCTCAGAAAGG + Intergenic
919357641 1:196545444-196545466 TTGAGGAAACAGGATCAGGCTGG + Intronic
919449784 1:197757217-197757239 ACAAAGAAACAGGCTCAGAGTGG + Intronic
919516853 1:198535757-198535779 CTGAGGAAACAGGCACAGCAAGG + Intronic
919561876 1:199131332-199131354 ATGAAGAAACATGCTCAGTGAGG + Intergenic
919682950 1:200454272-200454294 AGGAAGAATGAGGCTGAGGAGGG - Intergenic
919743868 1:200996524-200996546 ATGATGAAACAGGCTCAGAGAGG - Intronic
919765171 1:201122516-201122538 AAGAGGAAACAGGCTCAGAGAGG + Intronic
919766344 1:201129779-201129801 ATGAGGAAACCGGCTCAAAAGGG + Intergenic
919843078 1:201623269-201623291 AAGAAGAAAAAAGCCCAGGAAGG + Intronic
920124840 1:203685737-203685759 AAGAAGAAACAGACTCAGGGAGG - Intronic
920176804 1:204107209-204107231 ATGAGGAGACAGGCTAAGGGAGG + Intronic
920494232 1:206442873-206442895 ATGAAGAAAAAGGGTCCTGATGG - Intronic
920697374 1:208191627-208191649 ATGAAGAAACAGGCACAGAGAGG + Intronic
920729394 1:208468634-208468656 ATGAGGAAACAGATTCAGAATGG + Intergenic
921103525 1:211952455-211952477 ATAAGGAAACAGGCACAGAAAGG + Intronic
922057758 1:222057652-222057674 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
922321015 1:224486929-224486951 CTGACTAAACAGGCTCCGGATGG + Intronic
922495181 1:226051581-226051603 ATGAGGAAATAGGCTAAGGAAGG - Intergenic
922532585 1:226355800-226355822 ATGTGGAAACAGGCTCAGAGAGG - Intergenic
922564879 1:226595276-226595298 AGGAACAAACAGGCAGAGGAAGG - Intronic
923666566 1:236003519-236003541 ATGAAGAAAGTGTTTCAGGAAGG + Intronic
924074477 1:240319051-240319073 ATGAAAATACAGGCTTAGAAGGG + Intronic
924221199 1:241876906-241876928 ATAAACAAATAGGCTCAGGGAGG - Intronic
924299191 1:242619957-242619979 ATGAAAAGACAGGCTCCAGAAGG - Intergenic
924934756 1:248758505-248758527 ATAAGGAAACAGGCCCAGGGAGG + Intergenic
1063653403 10:7962987-7963009 ATTAGGAAACAGGCTCAGAGAGG + Intronic
1063676670 10:8146455-8146477 GTGAGATAACAGGCTCAGGATGG - Intergenic
1064110665 10:12535908-12535930 ATGAGGACACAGGCTCAGAGGGG + Intronic
1064681307 10:17813101-17813123 ATGAAGCACCAGGCTCAGGGAGG + Intronic
1064794125 10:18992061-18992083 TTGAAGAAACAGGCAAAGAAGGG + Intergenic
1064893354 10:20205806-20205828 ATGAGGAAACAGGCTTAGAAAGG + Intronic
1064944264 10:20770680-20770702 ATGAAGAAACAGAACAAGGAAGG - Intergenic
1065155267 10:22863001-22863023 ATGAGGAAACAGGGTCAGAGGGG + Intergenic
1066534703 10:36379033-36379055 ATGAATATACAGTTTCAGGAAGG - Intergenic
1066707583 10:38198184-38198206 ATGAAAATACAAACTCAGGAAGG - Intergenic
1066982116 10:42426545-42426567 ATGAAAATACAGACTCAGGCTGG + Intergenic
1067698499 10:48552374-48552396 GTGAACTAACAGGCGCAGGAAGG - Intronic
1068874304 10:61980189-61980211 ATGGAGGAAGGGGCTCAGGAGGG + Intronic
1069078270 10:64061581-64061603 ATGAAGAATTAGGTTCAAGAAGG + Intergenic
1069155223 10:65021214-65021236 ATGAAAAAACTGACTCAAGATGG + Intergenic
1069453527 10:68535994-68536016 ATGAAGACACCGTCACAGGATGG - Intergenic
1069518920 10:69102110-69102132 AGGAAGAAACAGGATAAGGCAGG - Intronic
1070261490 10:74860475-74860497 ATGAAGAAACAGGCCAAATAAGG + Intronic
1070371236 10:75784239-75784261 GTGAGGAAACAAGCTCAGGGAGG - Intronic
1070791592 10:79192730-79192752 ATGAGGATGCAGGCTCAGGAAGG + Intronic
1070828818 10:79406441-79406463 GTGAAGAAGCAGGGTCAGCAGGG - Intronic
1070931843 10:80266342-80266364 AGGAGGAAACAGGCTCTGGCAGG - Intergenic
1071701119 10:87937654-87937676 ATGATCAAACAGGCACAGGAAGG + Intronic
1071873073 10:89816172-89816194 GTGAGGACACAGCCTCAGGAAGG + Intergenic
1072157320 10:92735847-92735869 AACAAGACAGAGGCTCAGGAAGG + Intergenic
1072276005 10:93824223-93824245 ATGAAGACAAAGGGCCAGGAGGG + Intergenic
1072279743 10:93854867-93854889 GTGAAGAAATAGCCTCAGAAAGG - Intergenic
1072798879 10:98377964-98377986 ATGAAGAAAGAGGGTAAGGAAGG - Intergenic
1073082300 10:100867929-100867951 ATGAGGAAACGGGCTCAGTGAGG + Intergenic
1073276990 10:102320564-102320586 AATAAGAAACAAGCTCTGGAAGG - Intronic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1074438623 10:113455622-113455644 ATGGGGAAACAGACTCAGGATGG - Intergenic
1074525250 10:114257496-114257518 ATGAGGGAACAGGCTCAGAGAGG + Intronic
1074540150 10:114358428-114358450 ATGAAGAAACAGACTCAGGGAGG + Intronic
1074936677 10:118188674-118188696 ATGAGGAAAGATGATCAGGAGGG + Intergenic
1075667201 10:124239903-124239925 AGGAAGACACAGGGTCGGGAAGG - Intergenic
1075686301 10:124367463-124367485 ATCAGGAAACAGGCTCAGAGAGG + Intergenic
1075721608 10:124590765-124590787 ACAGAGAAGCAGGCTCAGGAAGG - Intronic
1075733248 10:124648690-124648712 ATGAGCAAACAGGCTCAGAAAGG + Intronic
1075922414 10:126224464-126224486 AGGGAGAAACAAGCACAGGAAGG + Intronic
1076113509 10:127879518-127879540 ATGAGGAATGAGGCTCAGAAAGG - Intronic
1076121387 10:127939729-127939751 AGGAAGAGATAGGCTCTGGAAGG + Intronic
1077146887 11:1050450-1050472 ATGAGGAAACAGGCACAGAGAGG + Intergenic
1077506370 11:2931635-2931657 AAGAGGAAACTGGTTCAGGATGG + Intergenic
1077615760 11:3672327-3672349 GTGAAAAAACAGGCTCAGATGGG - Intronic
1078178996 11:8994398-8994420 ATAAAGAAAAGGGCTAAGGATGG + Intronic
1078252260 11:9625931-9625953 AAGAAGGAACAGTCTCAGGCAGG - Intergenic
1078267496 11:9766017-9766039 ATGAGGAAATAGGCTCAGACAGG + Intergenic
1078713132 11:13814262-13814284 ATGAAGAAAGAGGCCCACGAAGG - Intergenic
1078746211 11:14117872-14117894 ATAAGGAAACAGGCTCAGGGAGG - Intronic
1079075573 11:17383583-17383605 ATGAGGACACAGGGTCAGAAAGG - Intergenic
1079138889 11:17794448-17794470 ATGAAGAACCAGGCTCAGAGAGG + Intronic
1079401999 11:20113179-20113201 ATGAGGAAATAGGCCCAGGGAGG - Intronic
1079504248 11:21135566-21135588 ATAAGGAAACAGGCTCAGATGGG - Intronic
1079504415 11:21137385-21137407 AGGATCATACAGGCTCAGGAGGG + Intronic
1080436597 11:32250366-32250388 ATGGAGAAGCAGGTTCAGGGAGG - Intergenic
1080566759 11:33516646-33516668 AGGAAGAAAAAGGCAGAGGAGGG - Intergenic
1080582788 11:33657485-33657507 ATGAGGAAACAGGCTTGGAAAGG + Intronic
1080691296 11:34560757-34560779 ATGAGGAAACAGACTCAGGCAGG + Intergenic
1080929931 11:36799395-36799417 ATGAAGCATCAGGATCAGAATGG - Intergenic
1081574919 11:44313065-44313087 CTCAAGGCACAGGCTCAGGAAGG - Intergenic
1081678048 11:44982442-44982464 AGGAAGAAAAAGGCTCTGGACGG - Intergenic
1082015709 11:47485074-47485096 ATGAGGAAACAGGCACAGAATGG - Intronic
1082740065 11:56901008-56901030 ATGAAGAAACAGACTCACAAAGG + Intergenic
1082806496 11:57454984-57455006 ATGGAGAAACAGGCTCAGAGAGG - Intergenic
1082997358 11:59264572-59264594 ATGAAGAAACAGGCTCAGGTGGG - Intergenic
1083160984 11:60853909-60853931 AGGCAGAAAAAGGCTCGGGAAGG - Intronic
1083315550 11:61812915-61812937 ATGAGATAACAGGCTCAGGGAGG - Intronic
1083423791 11:62572246-62572268 GTGAAGAAACATGCTAAGAATGG - Intronic
1083633121 11:64105840-64105862 TGGAAGAGACAGGCTCAGGGTGG - Intronic
1083658184 11:64240309-64240331 TTGAGGAAATAGGCTCAGAAAGG + Intergenic
1083902029 11:65647799-65647821 AGGAAGAGACAGGCTCAGACGGG - Intronic
1083935801 11:65869527-65869549 AAGAAGAAACAGGCTCAGAGAGG + Intronic
1084041234 11:66543828-66543850 ATGAAGCAGCAGGCACAGGAAGG + Exonic
1084057235 11:66643426-66643448 TTGAAGAAACAGACGCAAGAAGG - Intronic
1084079962 11:66815901-66815923 ATAGAGAAACAGGTTCAGGAGGG + Intronic
1084112389 11:67022698-67022720 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1084344758 11:68539278-68539300 ATGAGGAAACAGACCCAAGAAGG - Intronic
1084775597 11:71372616-71372638 AAGAAGAAACAGGCCCTGGAGGG + Intergenic
1084856230 11:71988908-71988930 AGGAATAAACAGGCTCCTGAAGG + Intronic
1084912354 11:72401037-72401059 ATGAAGAAACAGGCTGTCCATGG + Intronic
1084949477 11:72656826-72656848 ATGGGGAAACAGGCCCAGGGTGG - Intronic
1085025757 11:73235631-73235653 ATGGAGAAACAGGCCCAGAGAGG + Exonic
1085039254 11:73317375-73317397 ATAAAGAAGCAGGCTCAGAGTGG + Intronic
1085056001 11:73404306-73404328 ATGAGGAAACAGGTTATGGAAGG - Intronic
1085114120 11:73915110-73915132 ATGAGGAAGCAGGCTCAGAGAGG - Intronic
1085192990 11:74645200-74645222 AGAAAGAAACAGGCTGAGGTAGG + Intronic
1085218154 11:74850182-74850204 ATGAAGCAACAGACTCAGAGAGG - Intronic
1085520117 11:77132816-77132838 ATGATGAAACAGGCTCAGGAAGG + Intronic
1085811388 11:79685303-79685325 GTGAGGAAACAGGCTGAAGAAGG + Intergenic
1086527206 11:87741592-87741614 CTGTAGAAACAGGGTCAAGAGGG - Intergenic
1087152807 11:94873590-94873612 ATGAGGAAATGGGCTCAGAAAGG + Exonic
1087292747 11:96338374-96338396 ATGAAGAAACTGGCTGAGTAAGG + Intronic
1087321132 11:96660235-96660257 TTAAAGAAACAGACTCAGCAAGG - Intergenic
1087614675 11:100474294-100474316 ATGACGAAGCATGCACAGGAAGG + Intergenic
1087854595 11:103076585-103076607 ATGAGGAAACAGGCTGAAAACGG - Intronic
1088392162 11:109326492-109326514 ATGAAGAAACAGTCCCAGAAAGG - Intergenic
1088780929 11:113133115-113133137 AAGAAAAGACAAGCTCAGGAGGG + Intronic
1088971828 11:114780672-114780694 ATGCTGTAAGAGGCTCAGGAAGG + Intergenic
1089192436 11:116662702-116662724 TTGAAGAAACAGTCTCAGAGAGG - Intergenic
1089399322 11:118155353-118155375 ATGAAGAAAGAGGCTCAGAGAGG + Intergenic
1089710217 11:120309231-120309253 ATGACAAGACAGGCTCAGAAAGG + Intronic
1089830608 11:121324318-121324340 ATGAAGTAACAGGAGCAGGCAGG - Intergenic
1089854743 11:121533301-121533323 ATGAGAAAACAGGCTCAGCAAGG + Intronic
1089929512 11:122296105-122296127 ATGAAGAAATAGGTTCAGAGAGG - Intergenic
1089974665 11:122722154-122722176 ATGAAGACAGAGGCACAGGGAGG + Intronic
1090009989 11:123037700-123037722 AAGAAAAAACAAGCTCAGGTAGG + Intergenic
1090803616 11:130189414-130189436 GTCAGAAAACAGGCTCAGGAAGG + Intronic
1090843334 11:130511783-130511805 AAGAACAAAAAGGCTGAGGAAGG - Intergenic
1091064123 11:132492555-132492577 AGGAAGAAACAGGTTGAGAAGGG + Intronic
1091443661 12:530643-530665 ATGAAGAAACAGAAACAGAAAGG - Intronic
1091538316 12:1434811-1434833 ATGACGAAAGAGGCTCAGCATGG - Intronic
1091854424 12:3727939-3727961 ATGAGGAAACAGGCCCAAGAGGG + Intronic
1091998652 12:5015651-5015673 ATGAGAAAACAGGCACAGAAAGG - Intergenic
1092059754 12:5538761-5538783 ATGAAGAAAGTGTATCAGGAAGG + Intronic
1092145554 12:6212252-6212274 ATGAAGAAACAGGCTCCGAGAGG - Intronic
1092248141 12:6874942-6874964 AGGAAGAAACAGGCACAGGGAGG - Intronic
1092372789 12:7931090-7931112 CTGAAGAAGCAGGCTGAGGCCGG - Intronic
1092986511 12:13850880-13850902 ATGAAGAAAGAGAATCAGAAAGG - Intronic
1093483635 12:19629778-19629800 ATGAAGAAACAATCTCAGGGAGG + Intronic
1093936900 12:25011111-25011133 ATAAAGAAACAGGTTCAGAGAGG + Intergenic
1094279569 12:28720645-28720667 ATGAAGAAACATGATCAGACTGG + Intergenic
1094461426 12:30700582-30700604 ATGAGGAAACAGGCACAGAGAGG - Intergenic
1094528566 12:31250395-31250417 GTCAAGAAACAGTCTCAGAAAGG - Intergenic
1094697691 12:32837351-32837373 ATGAGGAAACAGCCTCAGAGAGG - Intronic
1095062354 12:37713064-37713086 ATGAAAAGAAAGGTTCAGGATGG - Intergenic
1095474015 12:42566567-42566589 ATGAAGAAACAGGTTCCAAATGG - Intronic
1095704995 12:45227477-45227499 CTGAAGAAACAGGCTCAGAGAGG - Intronic
1095817273 12:46438305-46438327 ATGAGGAAACTGGCTCAGAGAGG + Intergenic
1095900355 12:47321453-47321475 ATGAAGAAAAGTGGTCAGGAGGG - Intergenic
1095900724 12:47325398-47325420 ATGAAGAAAAATGTTCAGAAAGG + Intergenic
1096121681 12:49092789-49092811 AACAAGGGACAGGCTCAGGAGGG - Intronic
1096194198 12:49638770-49638792 ATGAGGAAACAGGGTCAGAAAGG - Exonic
1096291932 12:50351068-50351090 ATGAAGAAGCTCGCCCAGGAAGG + Exonic
1096410839 12:51376180-51376202 AAGAGGAAACAGGTTCAGGGAGG + Intronic
1096828409 12:54296550-54296572 ATGAAGATACAGGGGCAGGAGGG - Intronic
1097238215 12:57554258-57554280 ATGACGAAACAGGCTCAAAGAGG - Intronic
1097880409 12:64681403-64681425 ATGAGGGAACAGGCTCAGAAAGG + Intronic
1097954037 12:65464899-65464921 ATGAAGAAATAGGCACAGAGAGG - Exonic
1098860800 12:75707835-75707857 ATGAAGAACAAGTTTCAGGAAGG - Intergenic
1098862135 12:75722054-75722076 ATATAGAAACAGGCTCGGAAAGG + Intergenic
1099300812 12:80892321-80892343 TTGATGAGACTGGCTCAGGAAGG + Intronic
1099821675 12:87719329-87719351 ATGAAGAAACAGACTCAGAAAGG - Intergenic
1100012867 12:89974582-89974604 CTGTAAAAACAGTCTCAGGAAGG - Intergenic
1100150959 12:91737057-91737079 ATGAGGAAACAGGTTTAGGGAGG - Intergenic
1100208716 12:92378996-92379018 ATGAAGAAAAATATTCAGGAAGG + Intergenic
1100467486 12:94859712-94859734 AGGAAGAAAGAGGGTCAGGAAGG - Intergenic
1100657167 12:96659592-96659614 ATGGAGAAATAGACTCATGAAGG + Intronic
1100826398 12:98478759-98478781 ATGATGAAACAGGCTTACGAAGG + Intergenic
1101109080 12:101468191-101468213 ATGAAGAAACAGGCTCAGGGAGG - Intergenic
1101241114 12:102841100-102841122 ATGAGGAAACAGGCTTGGGAAGG + Intronic
1101314729 12:103618702-103618724 ATGAGGAAACAGGCACAGAGTGG - Intronic
1101406400 12:104432976-104432998 AGGAAGACACAAGCCCAGGATGG + Intergenic
1101625810 12:106440174-106440196 ATAGAGAAAAAGGGTCAGGACGG - Intronic
1101777487 12:107807504-107807526 ATGAGAAAACAGTCTCAGGGGGG + Intergenic
1101823235 12:108200308-108200330 ATGAAGAAACAGGCTCAGAGAGG + Intronic
1101846668 12:108368358-108368380 ATGGAGAAACAGGCCCAGAAGGG + Intergenic
1102098828 12:110261696-110261718 ATAAAGAAACATGGTCAGGCTGG - Intergenic
1102195717 12:111023877-111023899 CTGAAGAAACAGGTTCAGGCAGG + Intergenic
1102210579 12:111123894-111123916 ATAAGGAAACAGGCTCAGAGGGG + Intronic
1102477324 12:113196934-113196956 ATGCAGAAACGGGCTTGGGAAGG + Intronic
1102570555 12:113824736-113824758 TTGAAGAAACAGGCTCAGAGAGG - Intronic
1102602241 12:114040152-114040174 ATCAGGAAAAGGGCTCAGGAAGG + Intergenic
1102766883 12:115441065-115441087 ATGAAGAAATAGGCTTAGAGGGG + Intergenic
1102956243 12:117060938-117060960 ACGAGAAAACAGACTCAGGAAGG - Intronic
1103181408 12:118915117-118915139 AAGAAGAAACAGGCTCTGAAAGG + Intergenic
1103201000 12:119087896-119087918 ATGAGAAAACAGGCTCAGAGAGG - Intronic
1103381942 12:120500811-120500833 AGGAAGGAACAGGCACTGGAAGG - Intergenic
1103538382 12:121649347-121649369 AGGAGGAAACAGGTTCAGGGAGG - Intergenic
1103719974 12:122968308-122968330 ATGAGAAAACAGGCTCAGATAGG - Intronic
1103922209 12:124404925-124404947 AGGAGGAAACAGGCTCAGAGAGG + Intronic
1104360919 12:128132482-128132504 ATGGGGAAACAGGCTCAGAGAGG + Intergenic
1104793043 12:131495878-131495900 GAGAAGAAATAGACTCAGGAGGG - Intergenic
1104915031 12:132260167-132260189 ATGGAGAAACAGACACAGGGAGG + Intronic
1105260432 13:18775247-18775269 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1105262637 13:18791101-18791123 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1105311944 13:19219927-19219949 ATGAAGAAACGTGCTCAGAAAGG - Intergenic
1105363354 13:19741795-19741817 GTGAAGAAACGTGCTCAGAAAGG - Intronic
1105420347 13:20246793-20246815 AAGAAGCCACAGGTTCAGGATGG + Intergenic
1106193472 13:27474139-27474161 ATGAAGAAACAGGCCCAGACAGG + Intergenic
1106301246 13:28468156-28468178 ATGAGGAAACTGGTTCAGAAAGG - Intronic
1106373044 13:29155544-29155566 ATGAAGAGGCAGGCTCAGGATGG + Intronic
1106580954 13:31017887-31017909 AGGAACACACAGGCTGAGGATGG - Intergenic
1106999782 13:35529156-35529178 ATGAGGACACAGGCTCAGACAGG + Intronic
1107624345 13:42267705-42267727 CTGAAGAAACAGCCTGTGGAAGG + Intergenic
1107878744 13:44814654-44814676 ATGAAGCAAAAGGCCCAAGAAGG + Intergenic
1108000784 13:45904105-45904127 ATGAGGAAACAGGCTTAGAGAGG - Intergenic
1108143862 13:47455982-47456004 ATGAAGAAATAATCTCAGGGAGG - Intergenic
1108379773 13:49844635-49844657 ATGTAGAAACAGGCTCACAGAGG - Intergenic
1108486200 13:50928738-50928760 ATGTGGAAACAGCCACAGGAAGG + Intronic
1108739191 13:53317663-53317685 ATGAGGAAAAAGGCTCAGAGAGG + Intergenic
1109313642 13:60724472-60724494 TGGAAGAAACAGCCTCAGGAGGG + Intergenic
1110711656 13:78657088-78657110 ATAAGGAAACAGGCTCAAAAAGG - Intronic
1112008945 13:95277955-95277977 ATGAAGAAACTAGCTCAGATTGG + Intronic
1112086628 13:96038992-96039014 ATGGAGAGACAGGCATAGGATGG + Intronic
1112461594 13:99607633-99607655 ATGAAAAAACAGGGTCAGAAAGG + Intronic
1112826362 13:103397155-103397177 ATGGTGAAACAGGCACAGAATGG + Intergenic
1113252067 13:108464460-108464482 ATGAGGTAACAGTCTCAGAAAGG + Intergenic
1114196535 14:20482078-20482100 ATGAACAAACAAACTCAGAATGG - Intergenic
1114508978 14:23240953-23240975 ATGAAGAGACTGGCTCAGAGAGG + Intronic
1115149705 14:30270419-30270441 CTTAAGATACAGGCACAGGAAGG + Intergenic
1115631173 14:35247044-35247066 ATGATGAAACAGGCTCAGAGAGG + Intronic
1115976751 14:39005269-39005291 TTCTAGAAACAGGCTCAGGAGGG - Intergenic
1116001094 14:39243573-39243595 ATGAAGAACCAGGCTGGGGGTGG + Intronic
1116967428 14:51029224-51029246 CTGAAGTTACAGGCACAGGATGG + Intronic
1117019094 14:51550822-51550844 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1117313083 14:54547884-54547906 TTAAAGAACCAGGCTGAGGAAGG - Intergenic
1117528156 14:56632260-56632282 ATGCAGACACAGTCACAGGAAGG - Intronic
1117642320 14:57813063-57813085 ATGAGGAAACAGGCACAGAGAGG + Intronic
1118561214 14:67085571-67085593 CCAAAGAAACAGGCTCAGCATGG - Intronic
1118594182 14:67423359-67423381 ATGAAGAAGCTGGCTGTGGAGGG - Intergenic
1118613231 14:67557528-67557550 ATAAAAGAATAGGCTCAGGAGGG - Intronic
1118668423 14:68095992-68096014 AAAAAGAAACAGACTCAGAAAGG + Intronic
1118671405 14:68132009-68132031 AGGAAGAATCAGGCTCAGAAAGG + Intronic
1118815980 14:69314296-69314318 AAGAAGAAACATGTTCAGAAAGG + Intronic
1119440385 14:74624298-74624320 AAGAAGAATAAGGCTAAGGACGG + Intergenic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1119613807 14:76085132-76085154 ATGAGGAAACAGACTCAGAGAGG + Intergenic
1119726605 14:76925212-76925234 ATGAAGACACAGCCTCAGAAAGG - Intergenic
1120674391 14:87404057-87404079 ATAACGAAATAGGCTCAGAAAGG + Intergenic
1120785905 14:88535485-88535507 ATTAAGAAACAGACTCAGTGAGG - Intronic
1121171097 14:91855084-91855106 ATGAAGAAACAAGTTGAGCAGGG + Intronic
1121181727 14:91934280-91934302 ATGAGAAAACAGGCTCAGTGAGG - Intronic
1121419457 14:93802509-93802531 ATGAGGAAACAGGCCAAGGGAGG + Intergenic
1121456404 14:94041542-94041564 AAGAAGATGCAGGCTGAGGAGGG - Intronic
1121495480 14:94389047-94389069 ATGAGGAAACAGGCTCAGAGCGG + Intronic
1121525426 14:94616019-94616041 ATGAAAACCCAGGCCCAGGAGGG - Intronic
1121638326 14:95468630-95468652 AGGAAGGAGCAGGGTCAGGAGGG - Intronic
1121808272 14:96852433-96852455 AAGGAGAAACAGTCACAGGAAGG + Intronic
1121844677 14:97162322-97162344 ATACACAAACAGGCTCAGGCTGG - Intergenic
1122045205 14:99018009-99018031 ATGAGGAAACAGGCTCAGCAAGG - Intergenic
1122130380 14:99601833-99601855 TTGAACCCACAGGCTCAGGATGG + Intronic
1122666006 14:103330148-103330170 GTGAGGAAAGAGACTCAGGAAGG - Intergenic
1122862147 14:104587503-104587525 GTGAAGAGACGGGGTCAGGAGGG + Intronic
1123101857 14:105808868-105808890 AGGAAGAAAAAGGCTAAGGAAGG - Intergenic
1124625867 15:31307199-31307221 ATGGGGAAACAGGCTCAGAGAGG + Intergenic
1125421054 15:39504437-39504459 AGGAAGAAACAGGCACACAAAGG + Intergenic
1125553309 15:40564325-40564347 ATGAAAAAACAAGTTCAGAAGGG + Intronic
1125588840 15:40842262-40842284 ATGAGCAAACAGGCTCAGACAGG - Intergenic
1125982100 15:44011799-44011821 AGCAAGAAAGAGGCTCAAGAGGG + Intronic
1126136136 15:45393915-45393937 TTTAAGAATCAGGCTCAGAAAGG + Intronic
1126270449 15:46810915-46810937 GAGAAGAAAAAGGCACAGGAGGG - Intergenic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1126407619 15:48337433-48337455 ATGAGGAAACAGGCTCAGAAAGG - Intronic
1126499714 15:49332029-49332051 ATGAGGAAACAGGCTGAGATAGG + Intronic
1126644868 15:50865437-50865459 ATGAAGAAACAGCCTCATAAAGG + Intergenic
1126772207 15:52069706-52069728 ATGAAGAAACAGGCTTGGACTGG - Intergenic
1126922022 15:53537540-53537562 ATGAAGAAACAGAGACAGAAAGG - Intronic
1126953498 15:53909429-53909451 ATGAGGAGACAGGCTCAAGAAGG + Intergenic
1127112046 15:55684801-55684823 ATGAAGGAACAGGATGAGAAAGG + Intronic
1127764149 15:62168300-62168322 ATGCAGAAACAGGCTCACAAAGG + Intergenic
1128252489 15:66172802-66172824 ATGAGGAAACAGGCTCAGACAGG + Intronic
1128323932 15:66711400-66711422 CTGAGGAAACAGGCTCAGAGAGG + Intronic
1128325964 15:66724512-66724534 AAGAAGTAACAGGCTCAGAGAGG + Intronic
1128451707 15:67809699-67809721 ATGAGGAAACAGACTCAGACAGG - Intergenic
1128576879 15:68782360-68782382 ATGAAGAAATAGGCTCAGAAAGG + Intronic
1128761021 15:70216078-70216100 TTGAAGAAACAGGCCCAGAGAGG + Intergenic
1128937476 15:71759380-71759402 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1129230496 15:74194534-74194556 ATGGAGAAACGGTCTCAGAAAGG + Intronic
1129250438 15:74305888-74305910 ATGAAGAGACAGGATCAGAGAGG - Intronic
1129575731 15:76743075-76743097 ATGAACAAATAGGCTCAGAGAGG + Intronic
1129660428 15:77550063-77550085 ATGAGAAAACAGGCTCAGAGAGG + Intergenic
1129687324 15:77694337-77694359 ATGAGGAAACAGGCCCAGAGAGG + Intronic
1129713380 15:77832944-77832966 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
1129852061 15:78798996-78799018 ATGAGGAAACAGGCTCAGAGGGG - Intronic
1130250942 15:82300091-82300113 ATGAGGAAACAGGCTCAGAGGGG + Intergenic
1130287503 15:82568181-82568203 ATGAGGAAATAGGCTCATGGAGG - Intronic
1130358465 15:83157436-83157458 ATGAAAAAGCAGGCTCAAAACGG - Exonic
1130551894 15:84894796-84894818 ATGAGGAAACAGGCTCAGTGAGG + Intronic
1130649817 15:85756156-85756178 CTGAGGAAACATGCTCAGCATGG - Intergenic
1130660027 15:85824059-85824081 ATGAAGAAACAGGCTGATGGAGG + Intergenic
1130913985 15:88290626-88290648 CTGAAGAAACCTGCTCATGATGG - Intergenic
1130983664 15:88830286-88830308 ATAAAGAAACGGGCTGGGGAAGG - Intronic
1131301943 15:91207404-91207426 AGCAAAAAACTGGCTCAGGAAGG + Intronic
1131343633 15:91626507-91626529 ATTAAGAAAAAGGCTCACAATGG + Intergenic
1131864010 15:96687533-96687555 ATGAGGAAACAGGCTCAGGGAGG + Intergenic
1132153339 15:99477609-99477631 TTGAAGAAACAGGCTCAGGGAGG + Intergenic
1132259357 15:100408615-100408637 ATGATGAATCAAGCTCAGAAGGG + Intronic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133997120 16:10756902-10756924 GTGAAGAAAGAGGCACTGGATGG - Intronic
1134330401 16:13245616-13245638 AAGAAGAAACAGGCTCAAAGAGG + Intergenic
1134572425 16:15302668-15302690 GTGAAGAAACAGGCTCAGAGAGG - Intergenic
1134729957 16:16453373-16453395 GTGAAGAAACAGGCTCAGAGAGG + Intergenic
1134779559 16:16883483-16883505 AAGAGGAAACAAGCTCAGAAAGG + Intergenic
1134937476 16:18258527-18258549 GTGAAGAAACAGGCTCAGAGAGG - Intergenic
1135074763 16:19383639-19383661 ATGAGAAAACAGGCTCAGAAAGG - Intergenic
1135091726 16:19523007-19523029 ATGCAAAAACAGGCACTGGAAGG + Intergenic
1135184463 16:20303279-20303301 AGGAAGAAACATGCTCAGAGAGG - Intergenic
1135510063 16:23074939-23074961 ATGCTGGAACAGACTCAGGATGG + Intronic
1135627871 16:24011815-24011837 ATGAAGAAACAGGAACAGAGAGG - Intronic
1135675439 16:24411272-24411294 ATCAATAAACAGGCAAAGGAGGG + Intergenic
1135823817 16:25708421-25708443 ATGAAGAAATTGGTTCAGAATGG - Intronic
1135845210 16:25912526-25912548 ATGAAGAAATAACCTCAGAAAGG - Intronic
1135931629 16:26743014-26743036 AAGAAGAAACAGGTTCTAGAAGG - Intergenic
1136063452 16:27742614-27742636 AGGAGGAAACAGGCTCAGCAGGG - Intronic
1136071277 16:27788841-27788863 ATGAGGAAACAGGCACAGAAAGG + Exonic
1136369360 16:29826268-29826290 ATGAGGAAACAGGCACAGGGTGG + Intronic
1136372370 16:29844468-29844490 GTGAACAAACAGGCCCAGAATGG - Intronic
1136392953 16:29976923-29976945 ATAAAGAAACAGGCTCAGCAAGG - Intronic
1136546163 16:30956202-30956224 ATAAGGAAACAGGCCCAAGAAGG + Intronic
1136686319 16:31996777-31996799 AGGAGGAAACAGGCTCAGAGAGG + Intergenic
1136713510 16:32259033-32259055 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136754401 16:32670398-32670420 ATGAAAAAACAGTTTCAGGAAGG + Intergenic
1136786932 16:32940306-32940328 AGGAGGAAACAGGCTCAGAGAGG + Intergenic
1136813712 16:33199967-33199989 ATGAAAAAACAGTTTCAGGAAGG - Intronic
1136820188 16:33310047-33310069 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136826751 16:33366586-33366608 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136831817 16:33465357-33465379 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136882841 16:33913483-33913505 AGGAGGAAACAGGCTCAGAGAGG - Intergenic
1137010436 16:35315447-35315469 GTGAGGAAACAGTCTCAGGGAGG + Intergenic
1137024048 16:35455773-35455795 ATGAGGAAACAGTCTCAGGGAGG + Intergenic
1137491708 16:48938488-48938510 ATGAGGAAACAGGTTCAGAGAGG + Intergenic
1137640506 16:50024978-50025000 ATGAACGAACTGGCTCCGGAGGG + Exonic
1137812796 16:51368803-51368825 ATGAAGAAACAGATTCAGAGAGG + Intergenic
1137823252 16:51465459-51465481 ATGACCAAAGAGGCCCAGGATGG - Intergenic
1137950460 16:52778854-52778876 ATGACAAAACAGACTCAGAAAGG - Intergenic
1138005739 16:53335377-53335399 ATGAATAAACAAGCTTAGCAAGG + Intergenic
1138230714 16:55333864-55333886 ATGAGGAAATAGGCTCAGAGAGG + Intergenic
1138454131 16:57111668-57111690 ATGAGGAGACAGGTTCAGAAAGG - Intronic
1138488403 16:57361483-57361505 ATGGAGAAACAGGCTTAGCAAGG + Intronic
1138498161 16:57421316-57421338 ATGGAGAAATAGGCTCAGGCAGG - Intergenic
1138589032 16:57989632-57989654 ATGATGAAATGGACTCAGGAAGG + Intergenic
1138851286 16:60632858-60632880 CTGAAGCAAAGGGCTCAGGAAGG + Intergenic
1138879035 16:60988468-60988490 ATGAAGAACCAGGCCCGGCACGG + Intergenic
1139193917 16:64896505-64896527 TTTAAGAAACAGTTTCAGGATGG + Intergenic
1139278569 16:65750267-65750289 ATGAGGAAACAGGCCCAGCAAGG + Intergenic
1139338595 16:66251478-66251500 ATGAAAAAACAGGCTCACACAGG - Intergenic
1139387278 16:66580748-66580770 ATGAGGAAACAGGCTGGGAATGG - Intronic
1139528379 16:67529838-67529860 ATGCAGAAACAGGCCCAGAGAGG + Exonic
1140525747 16:75621454-75621476 ATGAGGAAACAGACCCAGCAAGG - Intronic
1141198144 16:81877000-81877022 AACAAGAAACAGGCCCAGGGAGG - Intronic
1141290759 16:82716287-82716309 ATGGAAAAGCAGGCTCGGGATGG - Intronic
1141760171 16:86023031-86023053 ATGAGGAAACAGGCTCAGATAGG + Intergenic
1141768625 16:86075039-86075061 ATGGAGAAACAGGCCCAGGGTGG - Intergenic
1141990526 16:87606597-87606619 ATGAAGAAACAAGCTCAGAGAGG - Intronic
1142001721 16:87668132-87668154 AAGGAGGAACAGGCTCAGGCAGG - Intronic
1142150290 16:88509658-88509680 GTGGAGAAACAGGCCCAGGGAGG + Intronic
1142158448 16:88544618-88544640 ATGAAGAGACAGGGGCCGGACGG + Intergenic
1202992288 16_KI270728v1_random:22941-22963 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1203051735 16_KI270728v1_random:881346-881368 ATTCAGGAAGAGGCTCAGGAAGG + Intergenic
1203056548 16_KI270728v1_random:930729-930751 ATGAAAAAACAGTTTCAGGAAGG + Intergenic
1203089168 16_KI270728v1_random:1201976-1201998 AGGAGGAAACAGGCTCAGAGAGG + Intergenic
1142858618 17:2747976-2747998 ATGAGGAGACAGGCTTAGAAAGG + Intergenic
1143139310 17:4732019-4732041 AGGAAGAAACCCGCTCTGGATGG - Intronic
1143367435 17:6417323-6417345 ATGGAGAAAGAGGCTGAGCAAGG + Intronic
1143392379 17:6567314-6567336 ATAAGGAAACAGGCTTAGAAAGG + Intergenic
1143554800 17:7653345-7653367 AGGAGGAAACAGGGTCAGCAGGG - Intronic
1143588327 17:7863628-7863650 ATTTAGAAACAGTTTCAGGATGG - Intronic
1143618892 17:8069881-8069903 ATGAGGAAACAGGCACAGAGAGG - Intergenic
1144395361 17:14837913-14837935 ATGAAGAAACAGACTAAGTGAGG - Intergenic
1144755783 17:17679999-17680021 ATGAGGAAACAGGCGCAGAGTGG - Intergenic
1144822078 17:18082292-18082314 ATGTAGAAACAGGCTCAGAGAGG + Intergenic
1144962195 17:19051078-19051100 ATGAAGAAACAGGCCAGGCATGG + Intergenic
1144966324 17:19078936-19078958 TTGAGGAAACAGACTCAGGGAGG + Intergenic
1144972966 17:19123442-19123464 ATGAAGAAACAGGCCAGGCATGG - Intergenic
1144981594 17:19173121-19173143 TTGAGGAAACAGACTCAGGGAGG - Intergenic
1144986630 17:19205118-19205140 TTGAGGAAACAGACTCAGGGAGG + Intergenic
1145008464 17:19352174-19352196 ATGAAAAAACAGGCTAAGTGGGG - Intronic
1145225640 17:21125939-21125961 ATGAATAAACTGGCTCTGGAAGG + Intronic
1145375444 17:22343421-22343443 CTGAAGAAACAGGGTGAGGGGGG - Intergenic
1145416044 17:22714927-22714949 GTGAGGAAACAGGCTGTGGATGG - Intergenic
1146204294 17:30888663-30888685 GTGAAAAAACAGGCTCAAAAAGG - Intronic
1146287168 17:31581796-31581818 ATGAGGCAACAGGCTCAGCAGGG - Intergenic
1146448643 17:32953939-32953961 AGGAGGAAACAGGCCTAGGAAGG + Intergenic
1146556212 17:33826562-33826584 ATGAGGAAACAGGCCCAGAGAGG + Intronic
1146610243 17:34298653-34298675 AGGAAGAAAAAGGCTGAGCATGG - Intergenic
1146937414 17:36820903-36820925 ATGAAGAAACTGGTGCAGGAGGG - Intergenic
1147000306 17:37358046-37358068 AAGTAGAAACAGAATCAGGAAGG + Intronic
1147119389 17:38326993-38327015 GGGAAGGCACAGGCTCAGGAGGG - Exonic
1147147278 17:38492445-38492467 AGGAGGAAACAGGCTCAGAGAGG + Intronic
1147406339 17:40215082-40215104 ATGAAGAAACAGACACAGCAAGG - Intergenic
1147846186 17:43405437-43405459 ATGAAGAAACTGGCTGGGCACGG + Intergenic
1147976746 17:44252371-44252393 ATGAGGAAACAGGCTCAGAGAGG + Intronic
1148049633 17:44763282-44763304 ATGGAGAAACAGGCACAGAGAGG + Intronic
1148355267 17:46971659-46971681 ATGAAGAAACAGGCCTTGGAAGG + Intronic
1149344767 17:55723600-55723622 ATGAGGAAACAGGCTCAGAGAGG + Intronic
1150004598 17:61462231-61462253 ATCATGAAACAGGCTCTGAAAGG - Intronic
1150218030 17:63481032-63481054 ATGAAGAAGCAGGCACAGCCAGG + Intergenic
1150453202 17:65286793-65286815 CTGAAGAAACATGCTCAGAGAGG + Intergenic
1150655962 17:67039843-67039865 AGCAAGAAACAGGCTCAGAAAGG + Intergenic
1151040880 17:70859889-70859911 ATGAAGAAACAGTCTCAAGCAGG - Intergenic
1151209810 17:72536083-72536105 ATGAAGAAACATGTTCAGAGAGG - Intergenic
1151395968 17:73823282-73823304 GTGAGAAAACAGGCTCAGAAAGG + Intergenic
1151916456 17:77121713-77121735 ATGAGGAAACGGGCTCAGAATGG + Intronic
1152036213 17:77874712-77874734 AAGAGGAAACAGGCTCAGGATGG - Intergenic
1152057556 17:78042387-78042409 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1152218381 17:79047580-79047602 ATGGCAAAACAGGCTCAGCAGGG + Exonic
1153187493 18:2501419-2501441 ATGAAGAAACAGATTCAGGTAGG - Intergenic
1153247711 18:3089737-3089759 ATGAAGAAATAGGCTTAGGAAGG + Intronic
1153273273 18:3344047-3344069 ATGAAGAAACAGATTCAAGAAGG - Intergenic
1153764680 18:8364291-8364313 ATGAGAAAACAGGCTCGGGGTGG + Intronic
1153923174 18:9809144-9809166 AGGTAAAAACAGGCTCAGGATGG - Intronic
1154052539 18:10974691-10974713 ATGAAGAAACGGGCTCTAGAGGG - Intronic
1154285722 18:13054605-13054627 ATGAAGAAACAGGTTGAGGGAGG - Intronic
1154425587 18:14269548-14269570 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154428321 18:14289133-14289155 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154428803 18:14292607-14292629 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154431083 18:14308952-14308974 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154433279 18:14324789-14324811 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154433753 18:14328261-14328283 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154982689 18:21516695-21516717 ATGAAGAAACATGTTCAGGTTGG + Exonic
1155639649 18:27998377-27998399 ATGAGGAAATGGGCTTAGGAAGG + Intronic
1156470297 18:37373608-37373630 ATTAAGAAACTGGCACAGGGAGG + Intronic
1156472007 18:37383264-37383286 GTGAAGCAGGAGGCTCAGGAAGG + Intronic
1157611295 18:48957747-48957769 AGGATGACACAGGCACAGGAAGG + Intergenic
1157655262 18:49380746-49380768 ATGAAGAGACAGGCTCAGAAAGG + Intronic
1157790298 18:50525182-50525204 GTGAGGAAAGAGGCTCAGGGTGG + Intergenic
1158318257 18:56235857-56235879 ATGAAAAAAGGGTCTCAGGAAGG - Intergenic
1158488251 18:57887495-57887517 ATGAAGAAACAAGTCCAGAAAGG + Intergenic
1158519997 18:58164024-58164046 AAAAAAAAAAAGGCTCAGGATGG - Intronic
1159478744 18:68959861-68959883 CTGAAGAGAGAGACTCAGGATGG - Intronic
1159663334 18:71126384-71126406 ATGAAGCAAGAGGCACAGAAAGG + Intergenic
1160578912 18:79872741-79872763 GTGAGGAAACAGGCTCAGAATGG - Intronic
1160928810 19:1560111-1560133 GTGAAGAAACAGGCATAGCAAGG - Intronic
1161737585 19:6001156-6001178 AGAAAGAAACAGGCTGGGGATGG - Intronic
1161837458 19:6657632-6657654 ATGAACCAACACGCACAGGAGGG + Intergenic
1162001074 19:7745421-7745443 ATGAGGAAACTTGCTCAGGCAGG + Intronic
1162034972 19:7933760-7933782 CTCAAGAAACGGACTCAGGAGGG + Intronic
1162102610 19:8349027-8349049 ATAAATAAACAGGCTTAGGCCGG - Intronic
1162464839 19:10833406-10833428 AAGAGGAAACAGGCTCAGATAGG - Intronic
1162531590 19:11239352-11239374 ATGGAGAAACAGGCTCAGCATGG + Intronic
1162612905 19:11769968-11769990 ATCAAGAAAGAGGCCCAGGCTGG - Intronic
1162757627 19:12869729-12869751 ATGAAGAAACAGTCTCGGCCAGG - Intronic
1162851704 19:13436123-13436145 CTGAAGAAACAGGCAAAGGCAGG - Intronic
1162858216 19:13485973-13485995 ATGAATAAACAAGATCATGAAGG + Intronic
1163288795 19:16365214-16365236 ATTAAGAAACAGGCTGAGGGGGG - Intronic
1163398704 19:17078852-17078874 ATACAGAAACAGGCCCAGGCAGG + Intronic
1163785187 19:19271295-19271317 AGGAAGAAACAGCCTGAGCAAGG - Intronic
1164145331 19:22509435-22509457 ATGAGGACACAGACTCAGAAAGG + Intronic
1165060351 19:33202100-33202122 GTGAGGAAACAGGCTCAGAGAGG - Intronic
1165412992 19:35673704-35673726 ATGAGTAAACAGGCCCAGAAAGG + Intronic
1165611161 19:37154589-37154611 ATCAAGAAAAAAGGTCAGGAAGG + Intronic
1165861787 19:38912811-38912833 GTGAGAAAACAGGCCCAGGAAGG - Intergenic
1166351738 19:42202050-42202072 ATGGGGAAACAGGCTCAGAGAGG - Intronic
1166443069 19:42833167-42833189 ATGAGGAAAGAGGCTGAGGGAGG + Intronic
1166468899 19:43060384-43060406 ATGAGGAAAGAGGCTGAGGGAGG + Intronic
1166710984 19:44937130-44937152 ATGAAGAAACAGGCCCACACAGG + Intergenic
1166770813 19:45280906-45280928 ATGCACAGCCAGGCTCAGGAAGG + Intronic
1167247296 19:48381330-48381352 ATGAGGAAACAGGTTCAGAGGGG - Intergenic
1167308685 19:48723608-48723630 ATGAGGAAACAGAATCAGGTAGG - Intronic
1167831963 19:52030971-52030993 ATGAAGAAAAAGGAACAGAAAGG + Intergenic
1168233359 19:55047030-55047052 ATGAAGAAACAGGCTCAGAGGGG + Intronic
1168292643 19:55364053-55364075 ATGGAGAAACAGGTTCAGTAAGG - Intergenic
1168679380 19:58303116-58303138 AAGAAGAAACAGGCTAGGCAAGG + Intronic
1168724164 19:58571539-58571561 ATGAGGAAACAGGCAAAGAAAGG + Intronic
925134374 2:1516140-1516162 ATGAAGACACAGGTCCAGGTGGG + Intronic
925663921 2:6232666-6232688 TTGAAAAAATAGGCTTAGGAAGG + Intergenic
925702234 2:6650402-6650424 ATGAAAAAAGAGGCTGAGAAGGG + Intergenic
925810381 2:7694362-7694384 ATGAGAAAACAGGCCCAGGAAGG + Intergenic
925881915 2:8359871-8359893 CTGGAGAATCAGGCACAGGATGG + Intergenic
925898713 2:8493534-8493556 CTGAACAAACAGGCTGATGAAGG + Intergenic
926088505 2:10035159-10035181 ATGAGAAAACAGGCTCAGAGAGG + Intergenic
926110662 2:10181224-10181246 ATGAGGAAACAGGCTTAGAGTGG + Intronic
926210727 2:10867703-10867725 AAGAGGAAACAGGCTCAGAGAGG - Intergenic
926390609 2:12387521-12387543 ATGATAAAACAGCCTCAGGCAGG - Intergenic
926986265 2:18627624-18627646 ATGAGGAAGCAGGCTCAAAAGGG - Intergenic
927272893 2:21232356-21232378 ATGAAGAGAGGGGCTCAGGGAGG + Intergenic
927415792 2:22879185-22879207 ATGAGATAACAGGCCCAGGAAGG - Intergenic
927475915 2:23414119-23414141 CAGAAGAAAGAGGCTGAGGAGGG + Intronic
928098059 2:28417576-28417598 AGAAGGAAACAGGATCAGGAGGG - Intergenic
928186148 2:29113135-29113157 ATGAAGAAGCAGACTCTGGGAGG - Intronic
928309478 2:30197625-30197647 CTGGAGAAACTGGCTCAGGCAGG + Intergenic
928435396 2:31251532-31251554 ATGAAGCAACTGAGTCAGGAGGG + Intronic
928564036 2:32524478-32524500 ATGAAGAAACAGCCTTAGAAAGG - Intronic
929033203 2:37667902-37667924 ATGAGAACACAGGCTCAGAAAGG - Intronic
929304393 2:40344350-40344372 ATGAAGGAACATGCTTTGGAGGG + Intronic
929429392 2:41874307-41874329 ATGAAGAAACAAACTCAGAGAGG + Intergenic
929597588 2:43186094-43186116 AAGAAGAAACAAACCCAGGAAGG - Intergenic
929848657 2:45559775-45559797 ATGAAGAAAAAGTTTCAGGCCGG + Intronic
929870166 2:45752549-45752571 ATGAGGAAACAGGCTCAGAGAGG - Intronic
929922590 2:46183009-46183031 ATGAGGAAACTGGCTCAGAGAGG - Intronic
929943034 2:46349275-46349297 ATGGACAGCCAGGCTCAGGAGGG - Intronic
930181197 2:48359582-48359604 AAGAAAAAACAGGCCGAGGATGG - Intronic
930675001 2:54191068-54191090 ATGATGACTCAGGCTGAGGAGGG - Intronic
930755826 2:54970996-54971018 AAGGGGAAAAAGGCTCAGGAAGG + Exonic
931144466 2:59502061-59502083 GTAAAGAAACAGGCTCAGAGAGG - Intergenic
931173227 2:59827110-59827132 ATGAGGAAACAGGTTCAGAAAGG + Intergenic
931182209 2:59914393-59914415 ATGAAAAAACAGGAGCAAGAAGG - Intergenic
931215513 2:60238823-60238845 ATCAAGATACAGGCCCAGCATGG - Intergenic
931474023 2:62570194-62570216 ATGAAGAAACTGGCTCTGAGGGG - Intergenic
931601345 2:64006467-64006489 ATTAGGAAACAGACTTAGGAAGG - Intronic
931636299 2:64343672-64343694 ATGAATACACAGTCCCAGGATGG + Intergenic
932498313 2:72158619-72158641 ACGCAGAAACAGGGACAGGAAGG - Intergenic
932823830 2:74922790-74922812 ATGAGGAAACAGGCTCAAAAAGG + Intergenic
932850933 2:75185770-75185792 ATGAAGCAAAAGGCTTAAGATGG + Intronic
933588975 2:84210668-84210690 ATGAAGAAACAGGCACAGAGAGG - Intergenic
933865143 2:86509337-86509359 AGGAAGGAACTGGGTCAGGAGGG - Intronic
934128564 2:88922830-88922852 ATGAAGAAAAAGGAGGAGGACGG + Intergenic
934789850 2:97049902-97049924 AGGAAGGAAGAGGCTCTGGAAGG - Intergenic
934816619 2:97332637-97332659 AGGAAGGAAGAGGCTCTGGAAGG + Intergenic
934821077 2:97375847-97375869 AGGAAGGAAGAGGCTCTGGAAGG - Intergenic
935058984 2:99592088-99592110 ATGAAGATACAGTAACAGGAGGG + Intronic
935763352 2:106341953-106341975 ATGAAGAAACAGACTCCGTCAGG - Intergenic
935800307 2:106689172-106689194 AATAAGCAACAGGATCAGGAGGG + Intergenic
935803450 2:106723260-106723282 AGGAAGAGAGAGGCTCAGGAAGG + Intergenic
936106588 2:109630263-109630285 AAGAAATAACAGGCTCAGGTTGG + Intergenic
936381837 2:111993217-111993239 ATTTAGAAACAGTCTCTGGATGG + Intronic
936824719 2:116567665-116567687 GTGAAGAAACAGCCACAGAATGG - Intergenic
936920505 2:117684056-117684078 ATAAAGGAACAGGATCAGGATGG - Intergenic
937962118 2:127468097-127468119 TTGAAGAAGCAGGCTCAGAAAGG - Intronic
938758405 2:134401397-134401419 ATGATGTAGCAGACTCAGGAAGG - Intronic
939464128 2:142535417-142535439 TTGAAAAAACAGCCTCAGGCAGG + Intergenic
939712155 2:145535840-145535862 AGCAAGAAACAGGCTCTGGAGGG - Intergenic
939807798 2:146794732-146794754 ATGAAGAATAAAGCTCAGAATGG - Intergenic
940470426 2:154090982-154091004 ATGAAAAAAAAACCTCAGGAAGG + Intronic
940949384 2:159655151-159655173 GTGAAGAAAGAGGCTGAGGCAGG + Intergenic
941284293 2:163589991-163590013 ATGAGGAAACAAGCGCAGAAAGG + Intergenic
941473983 2:165925443-165925465 ATAAAGAAACAGCCTTAGTAAGG - Intronic
941530845 2:166668889-166668911 ATGAGGAAACAGGTTCAGAAAGG + Intergenic
941635410 2:167930492-167930514 ATACAGAAACAGGGCCAGGAAGG + Intergenic
941848837 2:170158931-170158953 ATGAGAAAACTGGCTTAGGAAGG - Intergenic
942242471 2:173975691-173975713 ATCAAGAAGCAGGCTAAGCATGG + Intergenic
942894749 2:181038910-181038932 ATAAAAAAACAGGATGAGGAAGG + Intronic
942897789 2:181078807-181078829 ATGAAAACACAAGCTAAGGATGG - Intergenic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
943088164 2:183340592-183340614 ATGGAGAAGAAGGTTCAGGAGGG - Intergenic
943324928 2:186486389-186486411 CCCAAGAAACAGGCTCAGGCCGG + Exonic
944175471 2:196823860-196823882 ATGAAGACACAGACTCAGAGAGG + Intergenic
944341304 2:198603962-198603984 AAGAAGAACCAGTCTCAAGAAGG + Intergenic
944669235 2:201981457-201981479 ATGAAGAAACAGGCACACTGAGG + Intergenic
944669706 2:201984737-201984759 ATTAGGAAACAGGCCCAGCAAGG + Intergenic
945178120 2:207064262-207064284 CTGAAGAAACTGGCCCAGGGAGG + Intergenic
945464473 2:210151645-210151667 AAGAAGAAACAGACTCAGCATGG - Intronic
945906493 2:215599625-215599647 GTGAAGAAACAGGTTCAGTGGGG - Intergenic
946166457 2:217867052-217867074 ATGAAGAAACAAGCACAGAGAGG - Intronic
946389435 2:219406583-219406605 GTGAGGAAACAGGCTCAGAGAGG + Intergenic
947277806 2:228413815-228413837 ATGAGAACACAGGCTCAGGGTGG - Intergenic
947464379 2:230327902-230327924 AAGAAGAAAAAGGCCCAGGATGG + Intronic
947768409 2:232652035-232652057 ATGGAGAAACAGGCCCACCAAGG - Intronic
947835739 2:233173971-233173993 AGGCTGAAACAGGCTCAGGATGG + Intronic
948880891 2:240856616-240856638 ATGCAGCAGCAGGCTCAGCATGG + Intergenic
949081272 2:242101818-242101840 ATAAAGAAACAGGCTGGGCACGG - Intergenic
1168811403 20:706874-706896 ATGAGGAAACAGGCCCAGAGAGG - Intergenic
1168835958 20:877621-877643 ACCAAGAACCAGGCTGAGGAAGG + Intronic
1168862206 20:1053687-1053709 AGGAGGAAACAGGCTGAGGAGGG - Intergenic
1168960937 20:1869210-1869232 ATAAGGAAACAGGCTCAGAGAGG - Intergenic
1169165601 20:3420939-3420961 ATAAGGAAACAGCCTCAGAAAGG + Intergenic
1169801859 20:9518721-9518743 AAGAAGAAACGGGCCCAGAAAGG - Intronic
1170090216 20:12582492-12582514 ATCAAGAAACAGCCTCGGGGAGG + Intergenic
1170309416 20:14975952-14975974 CGGAATTAACAGGCTCAGGAAGG + Intronic
1170341932 20:15338668-15338690 ATGAAGAAACAGGCCTAGGGGGG + Intronic
1170543261 20:17410196-17410218 ATAAGGAAACAGGCTCAGAAGGG + Intronic
1170771529 20:19337009-19337031 ATGAAGAAACAGACTCAGAGAGG - Intronic
1171040631 20:21759186-21759208 AGAAGGAAACAGGCTCAGCATGG - Intergenic
1171519354 20:25764318-25764340 GTGAGGAAACAGGCTGCGGATGG - Intronic
1171557569 20:26092173-26092195 GTGAGGAAACAGGCTGCGGATGG + Intergenic
1172004145 20:31806171-31806193 AGGAAGAAACAGTCTCTGCAAGG - Intergenic
1172024062 20:31935983-31936005 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1172063772 20:32205645-32205667 ATGAGGAAACAGGCTAATAATGG - Intronic
1172273824 20:33669204-33669226 ATGAGGAAACAGGCCCAGAGAGG + Intronic
1172610701 20:36249725-36249747 ATGAGGAAGCAGGCTCAGGAAGG + Intronic
1172758412 20:37304725-37304747 GTGAAGGAACAGGCTTAGGGTGG + Intronic
1172848945 20:37946885-37946907 TTGAGGAAACAGGCTCAGAGAGG + Intergenic
1172963148 20:38812916-38812938 ATGCAGAAACTGACTCAGTAGGG + Intronic
1172969436 20:38862692-38862714 ATGAAGAAGAATGTTCAGGAGGG + Intronic
1173542387 20:43863860-43863882 ATGAGGAAACAAGCTCAGAAAGG - Intergenic
1173613861 20:44390215-44390237 ATGGAGAAACACGCTCAGAAAGG + Intronic
1173671186 20:44800006-44800028 ATGAGGAAACAGGCTCAGGGAGG + Intronic
1173846449 20:46191631-46191653 ATGAGGAAACGGGCTCAGAGGGG + Intronic
1173868087 20:46325529-46325551 ATGAAGAAACATGCTCAGAGAGG - Intergenic
1173916995 20:46715044-46715066 AGGAAGCAACAGGATCAGGATGG - Intronic
1173934779 20:46851840-46851862 ATGAGAAAACAGGCTCAGAGAGG + Intergenic
1173943281 20:46930375-46930397 ATGAGGAAACAGGCTCAGAAAGG + Intronic
1174053454 20:47783040-47783062 ATGAGGAAACAGGCACAGAGAGG - Intronic
1174057614 20:47809549-47809571 CTGGGGAAACAGGCTCAGGGAGG + Intergenic
1174145994 20:48453043-48453065 ACGCAGAAACAGGCCCAGAAAGG + Intergenic
1174298469 20:49565734-49565756 AGGAGGAAACAGGCTCAGAAAGG - Intronic
1174307280 20:49622649-49622671 ATGAGGAAACATGCTCAGCAAGG - Intergenic
1174406091 20:50304374-50304396 CAGATGAAACAGGCTCAGGGAGG - Intergenic
1174459968 20:50675618-50675640 TTGAGGAAACAGGTTCAGGCAGG + Intronic
1174462686 20:50694010-50694032 AGAAAGAAACAGGCTGAGCATGG + Intergenic
1174466371 20:50720742-50720764 ATGAAGAAACTGAGTCAGGAAGG + Intergenic
1174519768 20:51120445-51120467 ATGAGGAAACAGGCACAGAGTGG + Intergenic
1175477162 20:59284964-59284986 ATGAGGACACTGGCTCAGAAGGG - Intergenic
1175838853 20:62014204-62014226 ATGAGGGGACAGGCACAGGAAGG + Intronic
1175915773 20:62425057-62425079 GTGAGGAAACAGGCTCAGAGAGG - Intronic
1176652463 21:9563459-9563481 AGGAAGAAACAGACACAGGCAGG + Intergenic
1176653496 21:9570599-9570621 GTGAGGAAACAGGCTGCGGATGG - Intergenic
1176843280 21:13857483-13857505 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176843768 21:13860968-13860990 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176846444 21:13880288-13880310 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176848699 21:13896360-13896382 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1177196307 21:17907102-17907124 ATGAAAAAGCAGGCTCAGAGTGG + Intronic
1178582964 21:33851277-33851299 ATGGAGACCCAGCCTCAGGAGGG + Intronic
1179298132 21:40081506-40081528 AGGAACACAAAGGCTCAGGAAGG - Intronic
1179330117 21:40392006-40392028 ATGAAGACTCAGCCTCAGGTGGG - Intronic
1179367951 21:40775992-40776014 ATAAAGAAACAGGCTAAAAAGGG - Intronic
1179576280 21:42310415-42310437 AGGAAGGCACAGGCTCAGGCTGG + Intergenic
1180635560 22:17260501-17260523 ATGAGAAGACAGGCTCAGGGAGG - Intergenic
1181360008 22:22327206-22327228 ATGAAAACACAGGCATAGGAAGG - Intergenic
1181370029 22:22408654-22408676 ATGAAAACACAGGCATAGGAAGG - Intergenic
1181560351 22:23696420-23696442 AAGAGGAAACAGTCTCAGGGAGG + Intronic
1181631731 22:24155259-24155281 GATGAGAAACAGGCTCAGGAGGG - Intronic
1181783701 22:25210469-25210491 ATGAAGAAACAGGCTCAGGGAGG + Intergenic
1181937282 22:26447997-26448019 ATGAGGAAACAGGCTCAGAGCGG + Intronic
1182078496 22:27511733-27511755 ATGGAGAAACAGGTTCAGGGAGG - Intergenic
1182111857 22:27729396-27729418 ATGGGGAAACAGACTCAGAAAGG - Intergenic
1182438145 22:30344499-30344521 AAGCAGAAACAGGCTCAGAAAGG - Intronic
1182448264 22:30402491-30402513 ATGAGAAAACAGGCTCAGAGAGG + Intronic
1182553062 22:31111929-31111951 GTTAGGAAACAGGCTCAGAAAGG + Intronic
1182554271 22:31120520-31120542 ATGCTGAAACAGGCTGAGGGTGG - Intergenic
1183207661 22:36430848-36430870 TTGAAGAAACTGGCTGAGCACGG - Intergenic
1183313480 22:37124386-37124408 ATTAGGAAACAGGCCCAGGGAGG - Intergenic
1183321628 22:37168521-37168543 ATGCAGAAACAGGCTCAGAGAGG - Intronic
1183370567 22:37429406-37429428 AGGAGGAAACAGGCTCAGAGAGG - Intergenic
1183421091 22:37711878-37711900 AAGAAGTCACAGGCTCAAGAAGG - Intronic
1183591117 22:38779833-38779855 AAGAAGAAACTGGCTGAGGCGGG + Intronic
1183650200 22:39149257-39149279 GTGAGGAAACAGGCTCAGAGAGG - Intronic
1184064602 22:42110518-42110540 TTGAAGAAACAGAGTCAGGAAGG - Intergenic
1184088390 22:42279693-42279715 ATGAGCAAACAGGCTCAGGGAGG + Intronic
1184095470 22:42314081-42314103 AGGCAGATACAGGCTCAGCAGGG + Intronic
1184391100 22:44204133-44204155 AAGAAGAAACAGGCTAGGCACGG - Intronic
1184410612 22:44323982-44324004 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
1184444117 22:44537259-44537281 ATGAGGAAACAGGCTCAGAGGGG + Intergenic
1184473489 22:44708654-44708676 ATGAGCAAACAGGCTCGGAATGG + Intronic
1184517546 22:44971929-44971951 ATAAGAAAACAGGCTCAGGGAGG + Intronic
1184574703 22:45353736-45353758 ATGAAGAAACAGACCCAGAGAGG + Intronic
1185236561 22:49716828-49716850 ACGAAGACCCAGGGTCAGGAAGG + Intergenic
949211795 3:1511842-1511864 ATTAAGAAACAGTCTCTGTAGGG + Intergenic
949535595 3:4993770-4993792 ATAAGGAAACAGATTCAGGAAGG - Intergenic
950185650 3:10943829-10943851 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
950347099 3:12306424-12306446 ATGAAGAAACAGGAACAGAGAGG + Intronic
950454565 3:13084946-13084968 AAGAAGAAACAGCCTCGGGGTGG + Intergenic
950458591 3:13107481-13107503 ATGGAGAAACAGGCTCAGAGCGG + Intergenic
950665042 3:14490214-14490236 ATGAGGAAACAGGCACAGAGAGG - Exonic
951024043 3:17811666-17811688 AGAAAGAAACAAGATCAGGAAGG + Intronic
951051159 3:18095710-18095732 ATGAAGAAACAGGCACAGAAAGG - Intronic
951717154 3:25662191-25662213 ATAAAAAAACAGGCTTAGAAAGG + Intronic
951845961 3:27084840-27084862 ATGAGAAAACAGGCTCAGAGAGG - Intergenic
952140494 3:30473567-30473589 ATGAGGAAACAGGCTAAGGGAGG - Intergenic
952515728 3:34103361-34103383 ATGAGGAAACAGCCTCAGAAAGG - Intergenic
952521619 3:34164920-34164942 ATGAGAAAACAGGCTCAGAGAGG + Intergenic
952528777 3:34241878-34241900 ATGAAGAAACATGATCAGAGAGG - Intergenic
952557345 3:34547839-34547861 AGGAATAAACAGGTTCATGAAGG - Intergenic
952845963 3:37688574-37688596 AGGCAGGACCAGGCTCAGGACGG - Intronic
952865014 3:37849312-37849334 ATTAAGACACAGGCCCAGGCCGG - Intergenic
953465677 3:43117344-43117366 AAGAAGAAACAGCCTCTAGACGG + Intergenic
953470905 3:43165196-43165218 ATGAAGAAACAGATTTATGAAGG - Intergenic
953563961 3:44015242-44015264 ATTAAGAAACTGGCTCAGAGAGG + Intergenic
953598765 3:44343206-44343228 ATGAGGAAACAGACTCCAGAAGG + Intronic
953621528 3:44536891-44536913 AAGAACAAAAAGGCACAGGAAGG - Intergenic
953678381 3:45021073-45021095 ATGGAGAACCACGCTGAGGAGGG - Intronic
953706125 3:45231875-45231897 ATGAGAAAACAGGTGCAGGAAGG + Intergenic
953957646 3:47244145-47244167 ATGCAGAAACAGGCACAGAGCGG + Intronic
953961948 3:47273312-47273334 ATGAGGAAACAGGCTCAGTGTGG + Intronic
953987043 3:47452094-47452116 AAGAAGAAATAGGCTCTGTAAGG - Intronic
954460973 3:50626746-50626768 ATGCAGAGACAGGTTCAGAAAGG + Intronic
954556565 3:51521870-51521892 ATGAAGAACCTAGCTCAGGGAGG + Intergenic
954792351 3:53142776-53142798 ATGGGGAAACAGGCTCTGCAGGG - Intergenic
955008477 3:54991765-54991787 ATGAAGAAACAGGCTCAGAGAGG - Intronic
955209250 3:56925661-56925683 ATGAGGAAAGAGGCTCAGAAGGG + Intronic
955244775 3:57214532-57214554 CAGAAGAAACAGGCTCAAAAAGG - Intronic
955362589 3:58288393-58288415 ATGCAGAAACCCTCTCAGGAAGG - Intronic
955393512 3:58537861-58537883 GTAAGGAAACAGGCTCAGGGAGG + Intergenic
955614022 3:60786508-60786530 ATGAAGTAACAGACTCAGGTAGG - Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956170587 3:66430731-66430753 ATGAAAAACCAGGCTCAAGTTGG + Intronic
956302239 3:67784831-67784853 ATGAGGAAACAGGCTTAGAAAGG + Intergenic
956442630 3:69295164-69295186 GTGATGAAACAGGCCCAAGAGGG + Intronic
956647436 3:71470230-71470252 ATGAAGAAACAGGCTCAGGAAGG - Intronic
956743786 3:72295469-72295491 GTGAGGAAACAGGCTCAGAGAGG - Intergenic
957264927 3:77950761-77950783 ATGAAGAAAAAGCATCAGAAAGG - Intergenic
957866490 3:86031086-86031108 ATGAATAAACAGACTTAGGAAGG + Intronic
958484535 3:94687190-94687212 ATGAAGAATAAGGCTAGGGAGGG - Intergenic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
958927418 3:100173890-100173912 ACAAAGAAACAGGCTGAGAAGGG - Intronic
959384485 3:105685025-105685047 ATGAAGAAAAATTCTAAGGAAGG + Intronic
959510191 3:107202110-107202132 ATGATGAAACAGGAGCAGGGAGG + Intergenic
959751002 3:109834962-109834984 ATGAAGAAACAGGCTTAGAGAGG + Intergenic
960515758 3:118600662-118600684 CTGAGGAAACATGCTCAGAAAGG + Intergenic
960579556 3:119264582-119264604 AAGAAGAAATAGGCTGAGCACGG + Intergenic
960701288 3:120441854-120441876 ATGGGGAAACAGGCTCAGAGAGG + Intronic
960715236 3:120568681-120568703 AGGAAGAAACAGGCTGGGGGAGG + Intergenic
961115698 3:124327923-124327945 AAGAGGAAACAAGCTCAGAATGG - Intronic
961141960 3:124563303-124563325 AAGATGAAACTGACTCAGGAAGG - Intronic
961321490 3:126079494-126079516 ATGGAGAAACTGACACAGGATGG + Intronic
961359571 3:126358333-126358355 ATGAAGAAACCGACTCAGAGAGG + Intergenic
961410259 3:126715289-126715311 ATGAAGAAACTGAGTCAGGGAGG - Intronic
961457131 3:127029803-127029825 ATGGGGAAACAGGCTCGGGCGGG + Intronic
961474774 3:127139883-127139905 ATTAAGAAAGAGGATCAAGAGGG - Intergenic
961827020 3:129604443-129604465 ATGAAGAAACAGGCACAGAGAGG - Intronic
961983873 3:131111648-131111670 ATGAGGAAACAGGTTCAGAGAGG - Intronic
962479203 3:135783956-135783978 ATGAGGAAACAGGCACAGGGAGG - Intergenic
962859112 3:139381163-139381185 ATAAATAAAGAGGCTCAGCATGG + Intronic
962932875 3:140053755-140053777 ATAATGAAACAGGCTTATGAAGG - Intronic
962970490 3:140396579-140396601 ATGAGGAAACAGGCACAGAGAGG + Intronic
963025592 3:140915959-140915981 ATGAAGGAACAAGCTCAGAGAGG + Intergenic
963043397 3:141085140-141085162 AGGAAGGTACAGGCACAGGATGG + Intronic
963129760 3:141847322-141847344 CTGAAGAAAGAGGCTCAAAATGG + Intergenic
963918206 3:150880153-150880175 GTGAGGAAACAGGCTCAGAGAGG + Intronic
964478913 3:157122744-157122766 ATGAGAAAACAGGCTCAGAAGGG + Intergenic
964623713 3:158739314-158739336 CTCAGGAAAGAGGCTCAGGATGG + Intronic
964837341 3:160954111-160954133 ATGAAGAAACAGACTCAGAGAGG - Intronic
964961718 3:162436190-162436212 TTGGAGAAACAGGGCCAGGAAGG + Intergenic
965373054 3:167888870-167888892 ATTAAAAAGCAGGCTAAGGAAGG - Intergenic
965648091 3:170905800-170905822 ATGAGAAAACAGGCTCAGAAAGG + Intronic
965815238 3:172629379-172629401 GCGAAGAAACACACTCAGGAAGG + Intergenic
965983547 3:174723213-174723235 ATTAGGAAATAGGCTCAGAAAGG - Intronic
966138667 3:176730174-176730196 ATGAGGAAATAGGTTCAGGAAGG + Intergenic
966363544 3:179155951-179155973 GTGAAGAAACAAGCTCTGAAAGG - Intronic
966378054 3:179317188-179317210 ATGAAGAAACAGATTTAGGCTGG - Intergenic
966586265 3:181629025-181629047 ATGAAGAAACAGGCTCAGAGAGG - Intergenic
966945989 3:184777424-184777446 ATGAGGAAACAGGCCCAGGGAGG + Intergenic
966952525 3:184835237-184835259 ATGAGAAGATAGGCTCAGGAAGG + Intronic
967059505 3:185859557-185859579 AGGAAGAAGCTGGCCCAGGAAGG - Intergenic
967080564 3:186045789-186045811 ATAACGAAAAAAGCTCAGGAAGG - Intergenic
967980773 3:195063896-195063918 ATGAAGAAACAGGCCCAGAGAGG + Intergenic
968580370 4:1388344-1388366 ATGAATAAACAAGTTCAGCAAGG - Intergenic
969377107 4:6770131-6770153 ATGAGGTAACAGGCTCAGAGGGG + Intergenic
969420535 4:7092145-7092167 ATTTAGAGACAGGCACAGGAGGG - Intergenic
969438241 4:7200740-7200762 ATGAGGAAAAAGGCTCAGAGAGG - Intronic
969625827 4:8305111-8305133 ATGAAGACCGAGGCTAAGGAGGG - Intronic
969906800 4:10404732-10404754 ATGAGGAAACAGGCACAGAGAGG + Intergenic
969966699 4:11003864-11003886 ATGGAGAAACAGGCTCAGGGAGG + Intergenic
970074097 4:12197598-12197620 ATGAGGAAGGAGGCACAGGAAGG + Intergenic
970138730 4:12956447-12956469 ATGAAGAAACAGGCTCAGCAAGG - Intergenic
970296501 4:14636464-14636486 ATAAAGAGACAAGCTCAGGTTGG - Intergenic
970304523 4:14717988-14718010 ATGCAGAAACAGGCTGGGCACGG - Intergenic
970477817 4:16441519-16441541 AAAAAGGAAAAGGCTCAGGAAGG + Intergenic
971259447 4:25043111-25043133 GAGAAGGAACAGGCTGAGGATGG + Intergenic
971761883 4:30776607-30776629 CTGAAGAAACGGTCTCAGGAAGG - Intronic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972167742 4:36308011-36308033 ATCAAGAAACCAGCTCAGGCTGG - Intronic
972243611 4:37221238-37221260 GTGAAGAAATAGGCTCAGAGAGG - Intergenic
972495828 4:39633573-39633595 CTGTAGAGACAGGCTCAGGTTGG - Intronic
972594162 4:40515699-40515721 ATGAGGAGACGGGCTCAGGGAGG - Intronic
972982875 4:44726581-44726603 ATGCAGATAAAGGCGCAGGAAGG + Exonic
973570967 4:52239310-52239332 ATGAAGAAACCAGCACAGCAAGG + Intergenic
973646188 4:52953475-52953497 ATAAAGAAACAAGCTCAGGGAGG + Intronic
973876299 4:55223093-55223115 ATGAGGAAACAGGTTCAGAGAGG - Intergenic
973972293 4:56225496-56225518 AAGAAGAAACGGGTTCAGGGAGG - Intronic
974034619 4:56807033-56807055 AAGAAGAAACAGGCTGGGCACGG + Intergenic
975691815 4:76972910-76972932 ATGAGAAAACAGGCTCAGAAAGG + Intronic
975765387 4:77662227-77662249 ATGAAGAAACAGGATTCGCAAGG - Intergenic
975969998 4:80022029-80022051 ATGAAGAAACAAGCTTATAAAGG + Intronic
976703385 4:87995510-87995532 ATCAAGAAACAGGAGGAGGAGGG + Intergenic
977052197 4:92142591-92142613 ATAAAAAAAAAGGCTGAGGAAGG + Intergenic
977191996 4:94012540-94012562 ATGAGGACACAGGCTCAGCATGG + Intergenic
977831360 4:101597466-101597488 AGGAAGAAACAAACTGAGGATGG - Intronic
978021244 4:103815511-103815533 ATGAAGAAAAAGGAGAAGGAAGG - Intergenic
978093186 4:104742838-104742860 GGGCAGAAACAGGATCAGGAAGG - Intergenic
978323209 4:107521269-107521291 ATAAGGAAACAGTCTCAGGGAGG - Intergenic
978545269 4:109865184-109865206 ATGAGAAAACAGGCTCAGCAAGG + Intronic
978884459 4:113750443-113750465 ATGCAGAAACAGGCTTGGGGAGG - Intronic
979121088 4:116902670-116902692 ATAAAGAAACAGGTTCAACAAGG + Intergenic
979333245 4:119440113-119440135 AGGAAGAAGCAGGCCCAGGCTGG + Intergenic
980204264 4:129697556-129697578 AGGAAGAAAAAGATTCAGGAAGG - Intergenic
981394339 4:144229525-144229547 ATGAAGCAACAAGCTGGGGAGGG - Intergenic
981688905 4:147484318-147484340 ATGAAGCAATAGACTCAGGAGGG - Intronic
982256706 4:153458101-153458123 ATGAAGAAAAAGGCTAGGTATGG + Intergenic
982257338 4:153463739-153463761 ATGAAGAAAAAGGCTAGGTATGG + Intergenic
983241885 4:165242977-165242999 TTGAAGAAATAGGCTTAAGAAGG + Intronic
983637856 4:169916510-169916532 ATGAAGAAAAAGGCTTATGAAGG - Intergenic
984005387 4:174299879-174299901 ATGAAGAAACAGAATTATGAAGG - Intronic
984103548 4:175516267-175516289 TTGAAGAAACAGGCTTAGGTTGG - Intergenic
984227204 4:177050069-177050091 TTGAAGAAAAAGGCTAAGAAGGG - Intergenic
984380182 4:178982892-178982914 ATGAAGAAAGAAGATAAGGATGG - Intergenic
984580296 4:181502882-181502904 GTGAACAAACAGCCTCAAGAGGG + Intergenic
984776887 4:183489514-183489536 AGGAAGGAAGAGGCTCAGAAAGG - Intergenic
984891973 4:184502335-184502357 ATGAGGAAATAGGCTCAGAGTGG - Intergenic
984914594 4:184710692-184710714 TTGAGGAAACAGCCTCTGGAAGG - Intronic
986199230 5:5566485-5566507 ATGAAGAAACGGCATCAGAAAGG + Intergenic
986409743 5:7465308-7465330 ATGAGAAAAAAGACTCAGGAGGG - Intronic
986681829 5:10240541-10240563 ATGAGAAAACAGGCTCAGCAAGG - Intronic
986722873 5:10572499-10572521 ATGAAGTTACAGGTTCAGGGAGG + Intronic
987112212 5:14698954-14698976 ATGAAGAAACAGATTTAGGGAGG - Exonic
987172023 5:15269125-15269147 ATGAAGAAACAGGCTAAGCAGGG + Intergenic
987448819 5:18055765-18055787 ATGAAGAAATAGTTTCTGGAAGG - Intergenic
987587472 5:19874860-19874882 ATTTAGAAAAATGCTCAGGATGG + Intronic
987909479 5:24123055-24123077 ATGAAAAACCAGGCTGAGGTGGG - Intronic
988288942 5:29259575-29259597 ATAAAGACACAGGCACAGAAAGG + Intergenic
988650497 5:33143899-33143921 ATGAAGAAACAAGTTGAGAAAGG + Intergenic
988949760 5:36244284-36244306 ATGCAGAAGTAGTCTCAGGAAGG - Intergenic
990220850 5:53586811-53586833 AGGAAGAAACAGGCTGGGCACGG - Intronic
990446324 5:55897138-55897160 ATAAAGAAACAGGCTGGGCATGG - Intronic
991368283 5:65891787-65891809 ATAAAGAATCAGGCATAGGAGGG + Intergenic
991640406 5:68746113-68746135 ATGATGAATTAGGCTCAGGTTGG - Intergenic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
992510241 5:77425633-77425655 ATGAAGAAATAGGCTCAGCAAGG - Intronic
992884829 5:81148161-81148183 TTGAAGGAACAGGCTCAGTGAGG + Intronic
992947758 5:81826100-81826122 ATGAGGACACAGGCTCAGGAGGG + Intergenic
993189349 5:84661525-84661547 ATGTAGAAACAGGCTCAGAAAGG + Intergenic
993198017 5:84775364-84775386 ATGAAGAAACAAGTTTAGAATGG + Intergenic
993830694 5:92753877-92753899 ATGAAGAAACAGGGAGAAGATGG + Intergenic
993846815 5:92954123-92954145 ATAAAGAAAGGGGCTCAAGATGG - Intergenic
994516724 5:100781854-100781876 ATGTAGAAATTGGCTCATGATGG + Intergenic
995798463 5:115965048-115965070 ATGAGGAAACAGACTCAGAGAGG - Intronic
997235307 5:132269072-132269094 ATAAAGAAACAGGTTCAGAGAGG + Intronic
997639636 5:135440207-135440229 ATGAGGAAACAGGATCAGAGAGG - Intergenic
997712177 5:136015187-136015209 AGGCAGAGACAGGCTCAGGGAGG - Intergenic
997716006 5:136043613-136043635 ATGATGAAATTGGCTGAGGATGG + Intronic
997732199 5:136190004-136190026 ATGAGGAAATAGGCTCAGATAGG + Intergenic
997851603 5:137337962-137337984 ATAGAGAAACAGACTCAGGGAGG - Intronic
998147740 5:139739843-139739865 ATGAAGAAACAGGTCCTGGGAGG + Intergenic
998229929 5:140354589-140354611 ATGAGGAAACAGGCTCAGAGAGG - Intergenic
998296251 5:140971871-140971893 ATGAGGAAATAAGCTCAGGGAGG + Intronic
998368053 5:141643938-141643960 GTGAAGAAACAAGCTCAGAGAGG + Intronic
998422349 5:141999163-141999185 AGGAAAACACAGACTCAGGAAGG + Intronic
998892963 5:146766640-146766662 ATGAGAAAACAGGCTCAGAGAGG + Intronic
998930361 5:147174562-147174584 AAGAAGAAACAGGCTTAGAAAGG + Intergenic
999139963 5:149353900-149353922 ATAAAGAAACAGGCTCAGAAGGG - Exonic
999407412 5:151319042-151319064 CTGAGGAAACAAGCTGAGGAAGG - Intronic
999665024 5:153904039-153904061 ATGGGGAAACAGGCTCAGAGAGG + Intergenic
999730445 5:154473345-154473367 ATGGAGAAACAGACTCAGGGAGG - Intergenic
999754090 5:154651780-154651802 ATGAGGAAACAGGCTCTGTCCGG - Intergenic
999800467 5:155028874-155028896 ATAAATAACCAGGCACAGGAAGG + Intergenic
999805480 5:155077225-155077247 ATGAGAAAACAGGCTCAGGGAGG + Intergenic
1000040528 5:157481499-157481521 ATGAGGAAACAGACTCAAGAGGG + Intronic
1000116584 5:158159702-158159724 ATGAAGAAACTGCCCAAGGAAGG - Intergenic
1000178184 5:158779043-158779065 AAGAAGAAAGAGGCTCTGAAGGG + Intronic
1000380199 5:160622213-160622235 ATGAGGAAACAGACCCAGGGAGG + Intronic
1000383350 5:160648712-160648734 ATGTGGAAACAGGCTCAGAGAGG + Intronic
1001279420 5:170375867-170375889 ACGAGGAAACAGGCACAGAAAGG + Exonic
1001370800 5:171198829-171198851 CTGAAGAAACAGGCAGAGAAAGG - Intronic
1001399872 5:171440099-171440121 AAGAGGAAACAGGATCAGAAAGG - Intronic
1001553855 5:172623069-172623091 ATTAAGAAACAGGCTCAGAGAGG - Intergenic
1001741022 5:174052725-174052747 GTGCAGAAACAGGCTCAGACAGG + Intronic
1001897571 5:175394525-175394547 ATGAACAAAGAGGATAAGGAAGG - Intergenic
1002033996 5:176451581-176451603 ATGAAGAAACAGGTTCTGAGAGG + Intronic
1002101741 5:176861321-176861343 GTGAGGAAACAGGTTCAGGATGG + Intronic
1002570666 5:180137730-180137752 AAGAGGGCACAGGCTCAGGAGGG + Intronic
1003263489 6:4546472-4546494 CTGAGCAAGCAGGCTCAGGATGG - Intergenic
1003959930 6:11199372-11199394 ATGAGAAAACAGGCTTAGAATGG - Intronic
1004278056 6:14255506-14255528 ATGAAGAAACGGGCCCAGAGAGG - Intergenic
1004444124 6:15682165-15682187 TTGAAGAAACAGGCTCAGAATGG - Intergenic
1005025431 6:21458599-21458621 ATGAAAAAACAGTCTCCAGAAGG - Intergenic
1006099578 6:31678087-31678109 ATGAGGAAACAGGTGCAGAAAGG - Intronic
1006352122 6:33528685-33528707 AAGAAGCCACAGGCTGAGGATGG + Intergenic
1006428651 6:33981942-33981964 ATAAAGAAACAGGCTCAGAGAGG - Intergenic
1006520772 6:34569878-34569900 ATGAGGAAACAGGCCCAGAGAGG + Intergenic
1006671216 6:35730960-35730982 ACGAAGAAACTGGCTCAGAGAGG - Intergenic
1006811632 6:36824028-36824050 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1007110780 6:39312533-39312555 GTGAAGAAACAGGCTCAGAGAGG - Intronic
1007227182 6:40323169-40323191 AGGAAGAAGCAGGATCAGGGTGG + Intergenic
1007367941 6:41407670-41407692 ATGAAAAGACAGACTCAGTAGGG - Intergenic
1007428679 6:41763778-41763800 ATGAGGAAACAGGTTCAGAGAGG + Intergenic
1007431298 6:41779035-41779057 AGGAAGAAGCAGGCTCAGGGAGG + Intronic
1007531827 6:42549523-42549545 AAAAAGAAACAGGATCAGGCTGG - Intergenic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1007744745 6:44036648-44036670 ATGAAGAAACAGACTCTAGATGG + Intergenic
1008725201 6:54409069-54409091 ATGAAGAAACAGGCTCAACATGG + Intergenic
1008900627 6:56611264-56611286 ATAAGGAAACAGGCTCAGAGAGG - Intronic
1009313701 6:62190403-62190425 ATTTAGAAAAAGGTTCAGGAAGG - Intronic
1009360842 6:62810696-62810718 ATGAAGAAACAGTCAAGGGAAGG + Intergenic
1010041781 6:71393166-71393188 AGGAAATAACAGTCTCAGGAAGG - Intergenic
1010093785 6:72015389-72015411 ATTAATAAACAAGCTCAGCAAGG - Intronic
1010388340 6:75308397-75308419 ATGAGGAAACAGGCTCAGATGGG + Exonic
1010509200 6:76697046-76697068 ATGCAGAAATAGGGTCAGGGAGG + Intergenic
1012003369 6:93682241-93682263 AAGAATAAACAGGATCAGAAAGG - Intergenic
1012181065 6:96153307-96153329 ATGAAGCAGCTGGCTCAGGGAGG - Intronic
1012247744 6:96944866-96944888 AAGAATAAACAGTCTTAGGAAGG + Intronic
1012347342 6:98207151-98207173 ATGAGAAAACAGGTTCAGAATGG + Intergenic
1012413784 6:98990066-98990088 ATGAATAGACAGGCTTAGGGAGG - Intergenic
1012627289 6:101419671-101419693 AGGAAGAAACAGGCTGAGAGAGG + Intronic
1012840636 6:104324994-104325016 ATGTAGAAACAGCCTCTGGATGG - Intergenic
1012919151 6:105203398-105203420 ATGGAGAAACAGGCTTAGAGTGG - Intergenic
1013425620 6:110009995-110010017 AGGAAGAAATAGGCTCAGAGAGG + Intergenic
1013609399 6:111779939-111779961 AAGAAGAAACAGGCTCAGAGAGG + Intronic
1014377709 6:120696667-120696689 ATGAAAACTCAGTCTCAGGAAGG + Intergenic
1014743130 6:125169240-125169262 AAGAAGAAGCAGGCCAAGGACGG - Intronic
1015073199 6:129122825-129122847 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1015170195 6:130243552-130243574 GTTAAGAAACAGGCTTAGCAAGG + Intronic
1015774375 6:136798780-136798802 ATGAAGAAACAGGTCCAGAAAGG - Intergenic
1015879590 6:137857757-137857779 ATGAAGAAACGGCCTCAGTGAGG - Intergenic
1016422133 6:143896562-143896584 ATAAGGAAACAGGTTCAGCAAGG - Intronic
1017993529 6:159510588-159510610 GTGAGGAAATGGGCTCAGGAAGG - Intergenic
1018467765 6:164066989-164067011 TTTCAGAGACAGGCTCAGGAAGG + Intergenic
1019052357 6:169192848-169192870 AGGAAGAAGCAGGCACTGGAAGG - Intergenic
1019509159 7:1408645-1408667 ATGAGGAAACAGGCTCAGAGAGG - Intergenic
1019668791 7:2267094-2267116 ATGGAGAAACAGGCTCAGGGAGG - Intronic
1020070414 7:5223571-5223593 GGGCAGAAACAGGCACAGGAGGG - Intronic
1020978468 7:15038004-15038026 ATGGATTAAAAGGCTCAGGAAGG - Intergenic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1021601372 7:22367302-22367324 ATAAAGAAACAGGCTCAGAGAGG - Intergenic
1021800443 7:24300186-24300208 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
1022525791 7:31036347-31036369 ATGAAGAAACAGGCTCAGAAAGG + Intergenic
1022587558 7:31628750-31628772 ATCAAGAATCACGCTCAGGCCGG - Intronic
1023132623 7:37017987-37018009 ATGAGGAAACAGGTTCAGGGGGG - Intronic
1023186096 7:37534695-37534717 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
1023573281 7:41595120-41595142 TTGAGGAATAAGGCTCAGGAAGG + Intergenic
1025279835 7:57619258-57619280 GTGAGGAAACAGGCTGCGGATGG - Intergenic
1025304897 7:57846243-57846265 GTGAGGAAACAGGCTGCGGATGG + Intergenic
1025610610 7:63072982-63073004 ATGAAAAAATAGTCTCAGGGAGG - Intergenic
1025805637 7:64830611-64830633 ATGAAGATACAGGCTGGGCATGG - Intronic
1026836933 7:73645852-73645874 ATGAGGAAACAGGCTCAGAGAGG - Intergenic
1026990526 7:74582617-74582639 ATGTGGAAACAGGCTCAGAGAGG + Intronic
1027538676 7:79439819-79439841 AAGAAGAAACATGGTTAGGAGGG - Intronic
1027894152 7:84019294-84019316 ATGAATAAAAAAGCTTAGGAAGG + Intronic
1028385512 7:90248850-90248872 ATGAGGAAACAGACACAGAAAGG - Intronic
1028390262 7:90308147-90308169 ATGAATAAGCAGGTTCAGAATGG - Intronic
1028426652 7:90696906-90696928 GTGAAGAAAGAGTTTCAGGAAGG + Intronic
1028912076 7:96219526-96219548 ATGAGGAAACAGGCCCAGAGGGG - Intronic
1029115003 7:98232223-98232245 ATGGGGAGACAGGCTCGGGAGGG + Intronic
1029260355 7:99298109-99298131 ATGAGGAAACATGTTCAGCAAGG - Intergenic
1029371402 7:100153344-100153366 ATTACGGCACAGGCTCAGGAAGG - Intronic
1029649146 7:101879055-101879077 AAGAACAGACAGGGTCAGGATGG - Intronic
1029843202 7:103387588-103387610 ATGCAGAAACAGGCTCTGAGAGG + Intronic
1030078896 7:105760359-105760381 ATGAGGAAACAGGCTCTGAGAGG + Intronic
1030224644 7:107136374-107136396 ATGAAAAGACAGGCTCAGACTGG + Intronic
1030296532 7:107934467-107934489 AGGAAGAAACAGGCTCAGTTAGG + Intronic
1031339596 7:120582597-120582619 ATGGAGAAAGAGGCAGAGGAGGG - Intronic
1031589878 7:123577755-123577777 ATGAAGAAACATGAGCTGGATGG - Intronic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1032001934 7:128271322-128271344 CTGAGGAAACAGGCCCAGAATGG - Intergenic
1032596806 7:133249502-133249524 GTGAAAAGACAGGCACAGGATGG - Intergenic
1033179742 7:139164320-139164342 ATGAGGAAACAGGCTCAGAAAGG + Intronic
1033242655 7:139693167-139693189 ATGAGGAAACAAGCTCAAGGAGG - Intronic
1033244921 7:139709763-139709785 ATAAAGAAATAGGCTCTGAAAGG - Intronic
1033734778 7:144211059-144211081 ACTAAAAAACAGACTCAGGATGG - Intergenic
1034077631 7:148247942-148247964 CTGAAGAAAGAGGCTGAGCATGG - Intronic
1034892986 7:154857089-154857111 ATGCAGAAACAGGCTAGGGCGGG - Intronic
1035050236 7:155994533-155994555 AGGCAGACAGAGGCTCAGGAGGG - Intergenic
1035050762 7:155997967-155997989 AAGAGGAACCAGGCTCAGGGAGG - Intergenic
1035234748 7:157489037-157489059 GTGAAGACACAGACCCAGGAGGG + Intergenic
1035632316 8:1117437-1117459 GAGAAGAAACAGGCTCACGGTGG + Intergenic
1035632334 8:1117557-1117579 GAGAAGAAACAGGCTCATGGTGG + Intergenic
1036414214 8:8531704-8531726 ATCAAAAAACAGGCTGAGGCTGG + Intergenic
1036652090 8:10651092-10651114 ATCAGGAAGCAGGCTCAGAAGGG + Intronic
1036770197 8:11573410-11573432 GTGAGGAAACAGGCTTAGGGAGG - Intergenic
1036990334 8:13585271-13585293 ATGAAGAAATAGGCCTAGCATGG + Intergenic
1037122524 8:15306053-15306075 TGGAAGGAACAGGCTCAGGAGGG - Intergenic
1037918228 8:22785680-22785702 ATGAGGACTCAGGCTCAGGGAGG - Intronic
1037923091 8:22821683-22821705 AGGGAGAAAGAGGCTGAGGAGGG + Intronic
1038290415 8:26244273-26244295 GTGAGGAAACAGACTCAGAAAGG - Intergenic
1038564788 8:28610677-28610699 ATGAAGAAATGGGCTCAGGTTGG + Intronic
1039635430 8:39159560-39159582 AGGAAGAAAGAGGCTGAGGAAGG - Intronic
1039894711 8:41708601-41708623 ATGAATAAACAGAGTCAGAAAGG - Intronic
1039911380 8:41829412-41829434 ATGCAGAAAGAGGCTCAGAGAGG + Intronic
1041053661 8:53961010-53961032 ATGAGGAAGCAGGCCCAGAAAGG - Intergenic
1041489209 8:58412749-58412771 ATGAAGACACAGGATCAGACAGG - Intronic
1041794261 8:61729536-61729558 ATGGAGAAACATGCTCAGAGAGG + Intergenic
1042038665 8:64566861-64566883 AAAAAGAAACAGGCTCAGAGAGG + Intergenic
1042187617 8:66152633-66152655 CTGTAGAAAGAGACTCAGGAGGG - Intronic
1042219563 8:66460252-66460274 AGGAAGAAACGGGCTCTGGGTGG - Intronic
1043442641 8:80289833-80289855 ATGAGAAAACAGGCTCAGAGAGG + Intergenic
1043448913 8:80347049-80347071 AAGAAGAAAGAGGCTCAGAGAGG - Intergenic
1044134531 8:88569881-88569903 ATGAAGGCTCAGGCTCAGTAAGG + Intergenic
1044481206 8:92691052-92691074 ATTATGAAACAGGCTAAGCAAGG - Intergenic
1044490555 8:92809242-92809264 CTGAAGGCACAGGCACAGGATGG + Intergenic
1044584577 8:93857582-93857604 ATGAGGAAACAGCTTCAAGAAGG - Intergenic
1044803160 8:95977724-95977746 AGGAAGAAACAGGCTCAGAGAGG - Intergenic
1044857701 8:96493670-96493692 CCGGAGAAGCAGGCTCAGGAGGG + Exonic
1044911917 8:97068786-97068808 ATGAAGAAACAGACTCATAAGGG + Intronic
1044938821 8:97319592-97319614 ATGAAGAAACAGGCCCAGTGAGG - Intergenic
1045051460 8:98330904-98330926 ATGAGGAAACTGGCTCAGAGAGG + Intergenic
1045434795 8:102151540-102151562 ATGAAGATAGAGGCTTAGGGAGG + Intergenic
1046031525 8:108787962-108787984 ATGTGGAAACAGGCTCAGAGAGG + Intergenic
1046136542 8:110034573-110034595 ATGAAGACACATTTTCAGGAGGG + Intergenic
1046634893 8:116663314-116663336 ATGAAGAAACAGGCACTGATTGG + Intronic
1047154486 8:122301653-122301675 ATGAGAAAAAAGGCTCAGAAAGG + Intergenic
1047713839 8:127577381-127577403 ATGAGAAAACAGGCTCAGACAGG - Intergenic
1048018478 8:130518356-130518378 ATGAGGAAACTGGCTCAGAGAGG - Intergenic
1048140794 8:131792226-131792248 TTGAGGAAACAGGCTCAGAGAGG + Intergenic
1048470383 8:134699452-134699474 ATTAGGAAACGGGCTCAGCAGGG - Intronic
1048511973 8:135071290-135071312 ATGAAGAAATAGGATCAGAAAGG - Intergenic
1048675833 8:136778799-136778821 GTGAGGAAACAGGATCTGGATGG + Intergenic
1049223770 8:141440065-141440087 ATGAGGAAACAGGCCCAGAGAGG + Intergenic
1050068838 9:1789327-1789349 ATGAGGACACAGGACCAGGAAGG - Intergenic
1050791827 9:9481659-9481681 ATGAAGAAAGAGGTCCATGAAGG + Intronic
1051189878 9:14500160-14500182 ATGAGGAAACAGGCACAGAGAGG + Intergenic
1051477332 9:17522448-17522470 GTGAAGAATCAAGGTCAGGATGG - Intergenic
1051901301 9:22044702-22044724 ATGGGGATACAGGCACAGGAAGG - Intergenic
1052236499 9:26217459-26217481 ATGCAGAAGCAGGCACAGGAAGG + Intergenic
1052412256 9:28136908-28136930 ATGAACAAAAAGGCTGAGTAAGG + Intronic
1052623674 9:30945485-30945507 TTGAAAAAACAGGCCCAGGTAGG - Intergenic
1052820062 9:33131276-33131298 GTGAGGAAACAGGCTCAGAGAGG - Intronic
1053153087 9:35755175-35755197 ATGAGGAAACAGGCTCAGAGAGG - Exonic
1053471994 9:38353192-38353214 ATGTGGAAACAGGCTCAGAGGGG - Intergenic
1053496110 9:38549293-38549315 ATGTAGAAGCAGGTTCAGAAGGG - Intronic
1053665650 9:40315683-40315705 ATGTAGAAGCAGGTTCAGAAGGG + Intronic
1053915233 9:42940730-42940752 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1054376806 9:64455713-64455735 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1054518964 9:66060601-66060623 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1054519394 9:66063548-66063570 ATGCAGGAACAGGTTCAGAAGGG - Intergenic
1054858847 9:69929302-69929324 TTGAAGAAATAGAGTCAGGAAGG - Intergenic
1055081036 9:72267733-72267755 ATCAGGAAACAGGTTCAGAAAGG + Intergenic
1055553710 9:77454632-77454654 CTAAAGAAACAGTCTCAGAATGG - Intronic
1055602243 9:77931763-77931785 ATGAAGAAGCAGGCTTAGAGAGG - Intronic
1055700038 9:78934130-78934152 GAGAAGAAAAAGTCTCAGGAAGG + Intergenic
1056069436 9:82970531-82970553 ATAAAGAAACAGGCTTAGCCGGG - Intergenic
1056606832 9:88092927-88092949 AGGAGGAAGCTGGCTCAGGAAGG + Intergenic
1057479366 9:95432504-95432526 ATGGGGAAACAAGCTCAGGGGGG - Intergenic
1057529544 9:95831909-95831931 CTGAGAAAACAGCCTCAGGAAGG - Intergenic
1057676033 9:97136811-97136833 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1057928068 9:99170573-99170595 ATGGGGAAACAGGCTGAGAAAGG + Intergenic
1058479786 9:105380154-105380176 ATGGAAAAACAGGCTCAGAATGG + Intronic
1058581129 9:106458883-106458905 GTGAGGAAACAGGCTCAGAGAGG - Intergenic
1058581821 9:106466910-106466932 ATGAAGAAACAGATTAAGTAAGG + Intergenic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1058665492 9:107310822-107310844 ATGAAGAAACAGGCTTAGAAAGG + Intronic
1058774250 9:108268294-108268316 GTGAAGAGAAAGGCTGAGGATGG + Intergenic
1059206331 9:112469782-112469804 ATGAGGAAACAGACTCAAAAAGG - Intronic
1059256826 9:112938513-112938535 ATGGAGAAACAGTCTTAGAAGGG - Intergenic
1059431908 9:114255431-114255453 ATGGGGAGACAGGCCCAGGACGG - Intronic
1059433179 9:114261843-114261865 GGACAGAAACAGGCTCAGGATGG - Intronic
1059439599 9:114299570-114299592 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1059672790 9:116507347-116507369 ATGGAGAAACAGGCACAGAAGGG + Intronic
1059757785 9:117309999-117310021 ATGAAGAAACAGGCTCAGAAAGG - Intronic
1059796112 9:117698654-117698676 ATGAATAAATAGGCAAAGGATGG - Intergenic
1059825240 9:118020799-118020821 ATGAGGAAACAGGTTCAAAATGG - Intergenic
1059939006 9:119339695-119339717 ATGAGGAAACAAGCTCAGAGAGG + Intronic
1060060727 9:120457149-120457171 ATGAAGAAATGGGCTCATAAAGG + Intronic
1060066045 9:120501971-120501993 ATGAGGAAACAGGCTGAGACAGG + Intronic
1060069968 9:120537663-120537685 ATGATGAAACAGGCACAGTGTGG - Intronic
1060128862 9:121075674-121075696 ATGAGGAAACATGATCAGGAAGG - Intronic
1060165157 9:121407114-121407136 AGAAAGACAGAGGCTCAGGAGGG - Intergenic
1060173147 9:121478061-121478083 ATGAAAACAGAGGCTCAGAAAGG + Intergenic
1060276128 9:122184159-122184181 ATGAGGAAACAGGCTCAGTGGGG + Intronic
1060279260 9:122204951-122204973 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1060451365 9:123743832-123743854 TTAAGGAAACAGGCTCAGAAAGG + Intronic
1060458469 9:123824170-123824192 CAGAAGAAACAGGCTCAGAGAGG + Intronic
1060575150 9:124685111-124685133 ATGAAGAAACAGATTTAGAAGGG - Intronic
1060649807 9:125315726-125315748 ATGAAGGAAGAGGCTTGGGAAGG + Intronic
1060872700 9:127055599-127055621 ATGAGGAAACAGACACAGAAAGG + Intronic
1060900977 9:127258012-127258034 ATGAGGAAACAGGCTCAGAGAGG + Intronic
1060916532 9:127395166-127395188 ATAAGGAAATAGGCTTAGGAAGG + Intergenic
1060920511 9:127417500-127417522 ATGAAGAAACAGGCCGAGAGGGG - Intergenic
1061047900 9:128177211-128177233 AAGAGGAAACAGGCACAGGGTGG + Intronic
1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG + Intronic
1061106282 9:128533131-128533153 ATGATGAAACAGGCTGGGCATGG + Intronic
1061147536 9:128808676-128808698 ATGAGGAGACTGGCTCAGCAAGG + Exonic
1061492641 9:130954538-130954560 ATGAAGGCAGAGGCTCAAGATGG - Intergenic
1061510434 9:131057656-131057678 AAGAGGAAGCAGGCTCAGGGAGG - Intronic
1061648245 9:132024153-132024175 ATAAAGAAAGTGGCTCAGAAGGG - Intronic
1061684759 9:132266227-132266249 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1061937620 9:133866992-133867014 TTGAGGAAACAGGCTCAGGGAGG - Intronic
1061945124 9:133904481-133904503 ATGAGTGAGCAGGCTCAGGACGG + Intronic
1062056560 9:134472106-134472128 AGGAGGACCCAGGCTCAGGAAGG - Intergenic
1062271508 9:135711972-135711994 ATGAGCATACAGGCTCAGGGAGG + Intronic
1203631216 Un_KI270750v1:74046-74068 GTGAGGAAACAGGCTGCGGATGG - Intergenic
1185819100 X:3184614-3184636 ATGAGGACACAGGCTCAGTTGGG + Intergenic
1186780023 X:12903175-12903197 AGGAGGAAACAGGCTCATAAAGG - Intergenic
1186890313 X:13953429-13953451 ATGAGGAAACAGGCTCAAAGGGG - Intergenic
1187153655 X:16704255-16704277 ATGAAGGAATAGGCACAGAAAGG - Intronic
1187441332 X:19323318-19323340 ATGAAGAAACAGGCACATGGGGG - Intergenic
1187862601 X:23696583-23696605 ATGAGGAAACAGGCTTAGAGAGG - Intergenic
1187898291 X:24003211-24003233 ATAAGGAAACAGGCACAGAAAGG - Intronic
1188618188 X:32185347-32185369 GTGAAGAAACAGATTCAGGAAGG - Intronic
1189141905 X:38616003-38616025 ATGCAGAAACAGGCCCAGAGAGG - Intronic
1190119467 X:47648802-47648824 ATGAAGAAAAAGGCACAGAGAGG + Intronic
1190476761 X:50835877-50835899 AGGAAAAGACAGGCTTAGGACGG + Intergenic
1190545356 X:51520125-51520147 GTGAATACACAGGCTCAGAAAGG - Intergenic
1190756996 X:53409795-53409817 ATGAGGAAACAGGTACAGAAAGG - Intronic
1191020383 X:55853444-55853466 AAAAAGAAACAGGTTCAGTAAGG + Intergenic
1191021189 X:55862135-55862157 ATTAAGAAACAAGCTCAGAGAGG - Intergenic
1191765051 X:64689204-64689226 ATAAAGAATCAGGCTCAGGAGGG + Intergenic
1193384455 X:80854285-80854307 ATGAAGAAAGAGGCTGGGCATGG - Intergenic
1193864558 X:86715175-86715197 TTGAGGAAACATGTTCAGGAGGG - Intronic
1195272162 X:103242685-103242707 CTGGAGAAAGAGGGTCAGGAGGG - Intergenic
1195510492 X:105710737-105710759 ATTTAGAAACAGGCTCAGATAGG - Intronic
1195679548 X:107534073-107534095 ATGATGAAACAGGTCCAGAATGG - Intronic
1195781016 X:108464183-108464205 ATGAAGAAAGGGGATCAGGAAGG - Intronic
1196002537 X:110802204-110802226 ATAAGGAAACAAGCTCAGAAAGG - Intergenic
1196575828 X:117317881-117317903 ATGAAGAAAAGGGCACAGAAAGG + Intergenic
1196906304 X:120439858-120439880 AAGTGGAAACAGGATCAGGAAGG + Intronic
1197620474 X:128742187-128742209 CTGAATATACAGGATCAGGAAGG + Intergenic
1197707115 X:129641994-129642016 ATGAAAAATCAGGCTCATGGAGG - Intergenic
1197735437 X:129847380-129847402 ATGAAGAAATAGTCTCAGAAAGG - Intergenic
1197962435 X:132022018-132022040 ATGAAGAAAAAGGCTCAACCAGG - Intergenic
1197971093 X:132115822-132115844 ATGAATAAACAGGTTCACGGTGG + Intronic
1198056302 X:132998915-132998937 GTGAAGAAACAGGCCCAGAAAGG + Intergenic
1198377066 X:136050725-136050747 AGGAAGAGACAGGCTCAGGCAGG - Intergenic
1198399687 X:136256819-136256841 ATGAGGAAGCAGGCCCAGGGAGG + Intergenic
1198641878 X:138765112-138765134 ATGAAGAAAGAGGCTCAGTGAGG - Intronic
1198684278 X:139211256-139211278 ATGAGGAAACAAGCTCAGAGAGG + Intronic
1198783803 X:140265746-140265768 ATGAGAAAACAGGCTCAGTGAGG - Intergenic
1198924861 X:141778192-141778214 ATGAATTAACAGGCCTAGGAAGG + Intergenic
1200343944 X:155429363-155429385 ATGAGGAAACAGAATCAGGTGGG - Intergenic