ID: 956650345

View in Genome Browser
Species Human (GRCh38)
Location 3:71499079-71499101
Sequence TCTAGGACACAGAGCTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 278}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956650345_956650357 18 Left 956650345 3:71499079-71499101 CCCACCCAGCTCTGTGTCCTAGA 0: 1
1: 0
2: 1
3: 28
4: 278
Right 956650357 3:71499120-71499142 CCAATGGGAGCTCTCATCTCAGG 0: 1
1: 0
2: 0
3: 9
4: 115
956650345_956650354 3 Left 956650345 3:71499079-71499101 CCCACCCAGCTCTGTGTCCTAGA 0: 1
1: 0
2: 1
3: 28
4: 278
Right 956650354 3:71499105-71499127 CCGCTCTCTGTCCAACCAATGGG 0: 1
1: 0
2: 1
3: 4
4: 39
956650345_956650352 2 Left 956650345 3:71499079-71499101 CCCACCCAGCTCTGTGTCCTAGA 0: 1
1: 0
2: 1
3: 28
4: 278
Right 956650352 3:71499104-71499126 GCCGCTCTCTGTCCAACCAATGG 0: 1
1: 0
2: 1
3: 3
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956650345 Original CRISPR TCTAGGACACAGAGCTGGGT GGG (reversed) Intronic
900532196 1:3160148-3160170 CTTGGCACACAGAGCTGGGTGGG + Intronic
900771531 1:4548550-4548572 TATAGGAGACAGAGCTGAGCTGG - Intergenic
902207077 1:14876593-14876615 TCAAGGTCACAGAGCTGGTAAGG - Intronic
902610496 1:17594385-17594407 TCTCCCACACAGAGCTGGTTTGG + Intronic
903161938 1:21495341-21495363 TCCAGGCCTCAGAGCTGGGCTGG - Intergenic
903175275 1:21576650-21576672 TCCAGGACCCAGGGCTGGGAGGG + Intronic
903262978 1:22141437-22141459 CCTGGGTCACAGAGCTGGGGAGG - Intronic
903789129 1:25880880-25880902 TCCAGGGCACAGAGGTGGGAGGG + Intergenic
904482859 1:30805171-30805193 TTCAGGACACAGAGCTGGGAAGG + Intergenic
904501232 1:30913903-30913925 TCTGGGACTCCAAGCTGGGTAGG + Intergenic
904503810 1:30934494-30934516 CCCAGGACACAGAGCTGCATCGG + Intronic
905291058 1:36922167-36922189 AATGGGACACAGAGCTGAGTGGG + Intronic
905710161 1:40095418-40095440 TCTAGGACAGAGATACGGGTTGG - Intronic
906711340 1:47932256-47932278 TCAAGGCCATGGAGCTGGGTGGG + Intronic
907249185 1:53126670-53126692 TCTGGGCCCCAGAGCTGGTTGGG - Intronic
909249541 1:73334280-73334302 TGTGGGACACAGAGCTGAGGTGG + Intergenic
910171795 1:84386005-84386027 TCTTGGAGATAGAGCTGGGCAGG + Intronic
910577561 1:88783345-88783367 TCTAGGACACAGTGCAGGGAGGG - Intronic
911482510 1:98461740-98461762 CCTAGGCCACAGAGCAGAGTAGG - Intergenic
911824515 1:102464615-102464637 TCAAGGTCACAGAGCTAGGAAGG + Intergenic
912610831 1:111041876-111041898 TCTAGGAAGCTGAGCAGGGTTGG + Intergenic
912630132 1:111239587-111239609 TCTTTGGCACAGATCTGGGTGGG - Intronic
913986109 1:143567608-143567630 TAGAGGAAACAGAGCTGGGGAGG - Intergenic
917606003 1:176630112-176630134 TCTAGGACACAAAGTTAAGTGGG + Intronic
920648643 1:207821163-207821185 CCTTGGACACAGTCCTGGGTGGG - Intergenic
920974405 1:210772133-210772155 GAAAGGTCACAGAGCTGGGTTGG - Intronic
920989738 1:210925555-210925577 TTTAGGACAGAGGGCTGCGTGGG + Intronic
922285369 1:224166209-224166231 TCTGGGAGACCGAGGTGGGTGGG + Intergenic
1063721061 10:8581939-8581961 TCTAGTCCACAGAGCTGTGACGG - Intergenic
1066299668 10:34085771-34085793 TCTAGGAACCAGGGCTAGGTAGG + Intergenic
1067413370 10:46084575-46084597 CCCAGGGCACAGAGCAGGGTGGG + Intergenic
1067432230 10:46252125-46252147 CCTGGGCCCCAGAGCTGGGTGGG + Intergenic
1067718391 10:48707473-48707495 TCCAGCACACAGGGCTGGGGTGG - Intronic
1070348389 10:75567723-75567745 TGTGGGACACAGAGCTGGAAAGG + Intronic
1070462522 10:76684102-76684124 TTAAGGACACAGAGCTGAGCTGG - Intergenic
1072520118 10:96223777-96223799 CCCAGGACACAGAGGGGGGTGGG - Intronic
1072913261 10:99521884-99521906 TCCAGGACACCGCGCCGGGTGGG - Intergenic
1073044935 10:100631523-100631545 TCTGGGGCACAGAGCCTGGTTGG + Intergenic
1073783479 10:106864431-106864453 TCTAACACACAGAGCTAAGTGGG + Intronic
1075023271 10:118966672-118966694 CCTGGGGCACAGAGCTGGGTAGG - Intergenic
1075873483 10:125788086-125788108 TCAAGGAGACAGAGGTGTGTGGG + Intronic
1076809801 10:132880535-132880557 TCTCGGGCACACAGCTGGGCCGG - Intronic
1077375318 11:2202887-2202909 TGGAGGCCACAGGGCTGGGTGGG - Intergenic
1079391998 11:20030053-20030075 TATGGGACACAGAGCTTGGCTGG - Intronic
1079752066 11:24212448-24212470 TCTCGAGCACAGAGCTGGGAAGG + Intergenic
1081701412 11:45155117-45155139 ACTAGGGCACTGAGCTGGGCTGG + Intronic
1082697541 11:56388087-56388109 TTTGGGACACAGAGGCGGGTAGG + Intergenic
1083048599 11:59757172-59757194 TCCAGGACACAGAGCCGGCCAGG + Intronic
1084062628 11:66686133-66686155 TCAAGGACACTGTGCTGAGTTGG + Intronic
1085528936 11:77180279-77180301 TCCAGAACTCAGAGTTGGGTGGG + Intronic
1088592073 11:111412257-111412279 TCAAAGGCACAGAGGTGGGTAGG + Intronic
1090357502 11:126149913-126149935 TGTGGGCCACAGAGCTGGGCAGG + Intergenic
1090390258 11:126383375-126383397 TCCAGGAGCCAGAGCTGGGGTGG + Intronic
1090480061 11:127060007-127060029 TGTGGGAGACAGAGATGGGTAGG + Intergenic
1090524900 11:127522481-127522503 TCCACAACACAGAGCTGAGTAGG + Intergenic
1091661745 12:2389369-2389391 TCTAGGACACTGTGCTGGGAAGG + Intronic
1092759579 12:11797510-11797532 ACTGGAAGACAGAGCTGGGTAGG + Intronic
1096098897 12:48957105-48957127 TGAAGGACGCAGAGCTGGGGTGG - Intronic
1096752508 12:53770533-53770555 TCTAGATCAGAGAGGTGGGTGGG - Intergenic
1097984939 12:65772772-65772794 TCTAGAAGTCAGAGCTGAGTGGG - Intergenic
1098451234 12:70620268-70620290 TCTGTAACACAGTGCTGGGTTGG + Intronic
1101442849 12:104716342-104716364 TCATGGTCACACAGCTGGGTGGG - Intronic
1102297586 12:111748799-111748821 TCTAGGCCACAGCCCTGGTTTGG + Intronic
1106577796 13:30992063-30992085 TTGAGGACAGAGAGCTGGGCTGG + Intergenic
1106793635 13:33182457-33182479 TCCAGGAGACAGAGGTGGGGAGG - Intronic
1107860970 13:44660699-44660721 TCCAGGGCACAGAACAGGGTGGG - Intergenic
1108871147 13:54987996-54988018 TCTCGGACACATAGAAGGGTGGG + Intergenic
1109555261 13:63965931-63965953 TTTAGGACACAGAGGCAGGTGGG + Intergenic
1110145745 13:72188233-72188255 TCTAGGCCATAGAGTTAGGTAGG - Intergenic
1111056832 13:82961386-82961408 TCTGAAACACATAGCTGGGTGGG + Intergenic
1112290498 13:98141859-98141881 TCTGTGACACACAGCTGGTTGGG + Intergenic
1113000485 13:105630366-105630388 CCTGGGACAGAGAGGTGGGTGGG - Intergenic
1113881161 13:113627395-113627417 TCTGGGACACAGGCCTGGGTGGG - Intronic
1115385333 14:32789841-32789863 GCAAGGGCACAGAACTGGGTTGG + Intronic
1116242228 14:42359525-42359547 TCTGAGACACAGAGCAGGGAAGG + Intergenic
1116862769 14:50007726-50007748 CCCAGGGCACAAAGCTGGGTGGG - Intergenic
1117562549 14:56956124-56956146 GATAGGAAACAGAGCAGGGTAGG + Intergenic
1120591841 14:86384605-86384627 TCTGGAACACAGAGCTGGGATGG - Intergenic
1120606378 14:86583656-86583678 TCTGTAACACAGAGCTGGGCTGG - Intergenic
1121793082 14:96713407-96713429 TCTAGGAAACAGAGCTTGCCTGG + Intergenic
1122156627 14:99753993-99754015 TCTTAGACACAGACCTGGGGTGG - Intronic
1202858021 14_GL000225v1_random:63654-63676 TTTAGGACACAGGGTTGGGACGG - Intergenic
1202864084 14_GL000225v1_random:104290-104312 TTTAGGACACAGGGTTGGGACGG - Intergenic
1202928596 14_KI270725v1_random:17899-17921 TCATGAACACAGAGCAGGGTAGG + Intergenic
1125216706 15:37283449-37283471 TCCAATACACAGAGCTGTGTGGG - Intergenic
1126556848 15:49997884-49997906 TCTAGGACGCAGAGATGAGTAGG + Intronic
1128575728 15:68773534-68773556 TATAGGACACAGAGGTGACTTGG + Intergenic
1128787847 15:70411279-70411301 TGTATGACACAGAGCTGGAGAGG + Intergenic
1129154163 15:73707389-73707411 TTGAGGACCCAAAGCTGGGTAGG - Intronic
1129460947 15:75699851-75699873 TCTTGGACAGGGAGATGGGTGGG + Intronic
1129846375 15:78769475-78769497 TCTGGGACACAGTACTGGCTCGG + Intronic
1131400239 15:92119580-92119602 CCAAGGACAAAGACCTGGGTGGG + Intronic
1131680364 15:94715514-94715536 TTGAGGTCACAGAGCTAGGTTGG + Intergenic
1131851085 15:96543956-96543978 TCAAGGTCCCAGAGCTGGGAGGG + Intergenic
1132089454 15:98936030-98936052 TCTTGCGCACGGAGCTGGGTGGG - Intronic
1132403530 15:101528554-101528576 TCAAGGCCACAGGGCTGGGGAGG + Intergenic
1132519277 16:379923-379945 CCACGGACACAGGGCTGGGTGGG + Intronic
1133733412 16:8595484-8595506 TCTAGGCCACAGAGCTTTCTGGG - Intergenic
1136347180 16:29683687-29683709 TCTGAGTCACAGAGCAGGGTGGG + Intronic
1137729945 16:50681821-50681843 TCAAGGCCACAAAGATGGGTGGG - Intergenic
1137843009 16:51657582-51657604 TTTAAGACACAAGGCTGGGTGGG - Intergenic
1138156055 16:54703838-54703860 TGTAGGACACATAACTGGGAAGG + Intergenic
1139528384 16:67529873-67529895 TCAAGGTCACACAGCTGGTTTGG + Intronic
1140032196 16:71347794-71347816 CCAAGGTCACAGAGCTGGGCGGG + Intergenic
1140192964 16:72833738-72833760 TCTAAAACACAGAGCTGTCTGGG - Intronic
1141479534 16:84297156-84297178 TCTAAAACACAGGCCTGGGTGGG + Intronic
1141539575 16:84709381-84709403 TCTTGGGCACAGAGCTGGAGGGG + Intronic
1142979805 17:3664981-3665003 TTGAGGACACAGGGCTGTGTGGG - Intronic
1142993323 17:3746398-3746420 TCCAGGACACAGAGCTCGATGGG - Intronic
1143105109 17:4525712-4525734 TCCAGGTCACAAAGCTGAGTAGG - Intronic
1143856370 17:9853853-9853875 TCTTGGCCACATAGCTGAGTTGG - Intronic
1146695114 17:34903006-34903028 TTTAGGAAACTGAGCAGGGTGGG - Intergenic
1146775651 17:35612717-35612739 TCTGGGACTCAGAACTAGGTTGG - Intronic
1147995003 17:44355458-44355480 TCTGGGAGAGAGAGCTGGGCTGG + Intronic
1148211121 17:45809309-45809331 TCTAGGAGAGAGAGATGGGGAGG + Intronic
1149608450 17:57941471-57941493 TGTAGGTCACACAGCTTGGTAGG - Intronic
1150228402 17:63536398-63536420 TCCAGGACACCAAGGTGGGTGGG + Intronic
1150836927 17:68572859-68572881 TCTAGGACACAGAGATAAATGGG - Intronic
1150869872 17:68895626-68895648 TCTATTACACAGATCTGGGAAGG - Intronic
1151329095 17:73396355-73396377 TGAAGGGCACAGAGCTGGGGTGG + Intronic
1151405733 17:73884971-73884993 CCTGTGACACAGAGCAGGGTGGG + Intergenic
1151458970 17:74243491-74243513 CCTGGGACAAAGAGCTGGGCAGG + Intronic
1151551999 17:74827692-74827714 ACTAGGACACAGTCCTGGCTTGG - Intronic
1152024640 17:77801011-77801033 TCTCGGAGACAGCGCTGGGCTGG - Intergenic
1152379747 17:79936255-79936277 CGGAGGACACACAGCTGGGTGGG + Exonic
1152589004 17:81202182-81202204 CCTAGAACACAGAGGTGGGCAGG - Intronic
1152823056 17:82446872-82446894 TCTGGGGGTCAGAGCTGGGTGGG - Intronic
1152856064 17:82664951-82664973 CCTTGGAAACAGAGCTGAGTCGG - Intronic
1153660726 18:7323553-7323575 CCCAGAACACAGAGCTGGGGAGG - Intergenic
1155000655 18:21682738-21682760 TCCAGGACACAAAGCCGGGGGGG - Intronic
1156308742 18:35903984-35904006 TCTAGGACACAGGGTTGGTGTGG + Intergenic
1157342721 18:46793847-46793869 GCAAGGACCCAGAGCTGGGGAGG + Intergenic
1158223999 18:55181859-55181881 ATTTGGACACAGAGCTGTGTTGG - Intergenic
1158932147 18:62332943-62332965 TCTAGGACACAGGCATGGGAAGG + Intronic
1159891397 18:73956357-73956379 TCCAGGACACAGAGTGGGATGGG - Intergenic
1160037494 18:75315457-75315479 TCTAGGCCACAGAGCAGGGTGGG - Intergenic
1160915872 19:1496232-1496254 CCAGGGGCACAGAGCTGGGTGGG + Intronic
1161129287 19:2578839-2578861 TTAAGGTCACAGAGCTGGGAAGG + Intronic
1161347323 19:3774841-3774863 CCTTGGACACAGAGCCTGGTGGG - Intergenic
1162967424 19:14162529-14162551 TCTGGGACCCAGGGGTGGGTGGG + Intronic
1162968084 19:14165212-14165234 CCTGGGACATAGAGCTGGGCAGG + Intronic
1163237722 19:16039083-16039105 TCTACGACACAGAGCCGGGCAGG + Intergenic
1163747812 19:19058423-19058445 TCAAGGCCGCAGAGCTGAGTAGG - Intronic
1165431355 19:35775363-35775385 CCGAGGACACAGAGCCGGGGCGG + Intronic
1165939726 19:39408990-39409012 TCTAGGAGACAGATTTGGGCAGG - Exonic
1166274162 19:41740203-41740225 TCTGAGATAAAGAGCTGGGTTGG - Intronic
1166822621 19:45589863-45589885 TGTAGGGCACTGTGCTGGGTGGG - Exonic
1167420732 19:49401434-49401456 TGGAGGACACAGGGCTGGGGTGG + Intronic
1167459694 19:49618282-49618304 GCCAGGACACAGAGCTTGATGGG - Intronic
1167506253 19:49872665-49872687 ACAAGGACACAGAGCAGGCTCGG - Intronic
1168167346 19:54559111-54559133 TCCAGGACACATAGCTATGTGGG + Intergenic
925494022 2:4426172-4426194 TCCAGGACACAGGGCTGGGCAGG - Intergenic
926594334 2:14773967-14773989 TTAAGGACTAAGAGCTGGGTAGG + Intergenic
926842052 2:17091772-17091794 CCAAGGTCACACAGCTGGGTGGG + Intergenic
927463987 2:23323568-23323590 TTCAGGAGGCAGAGCTGGGTCGG + Intergenic
928166411 2:28975775-28975797 TCTAGCACACAGATCTAGGTGGG + Intronic
928613376 2:33012252-33012274 CCAAGGGCACAGAGCTGGGATGG + Intronic
928934771 2:36664050-36664072 TCTAGGGAACAGAGGAGGGTCGG - Intergenic
932008228 2:67949045-67949067 TCTAGGAAACAGGACTGGGTGGG - Intergenic
933902450 2:86859761-86859783 GAGAGGACACAGACCTGGGTAGG + Intronic
935673783 2:105576922-105576944 TCGAGGCCACAGAGCTGTGTGGG + Intergenic
935778097 2:106489507-106489529 GAGAGGACACAGACCTGGGTAGG - Intergenic
937213396 2:120293292-120293314 CTAAGGACACAGGGCTGGGTTGG + Exonic
939183897 2:138838051-138838073 TCTTGGAGACAGATTTGGGTTGG - Intergenic
939416496 2:141905225-141905247 TCTAGGACAAAGGGCAGGGCTGG + Intronic
939548711 2:143586950-143586972 TCTGACACACAGAGCTGTGTTGG - Intronic
940502386 2:154509300-154509322 TCTAGAACACAGAGATGGCTAGG + Intergenic
941931836 2:170948364-170948386 CCCAGGACACAGAGCTGGTTTGG + Exonic
942247806 2:174023849-174023871 TCTAGGAAACCCAGCAGGGTGGG - Intergenic
944280522 2:197891377-197891399 TCTGGGAGACAGAACTGGGATGG - Intronic
944667138 2:201967789-201967811 TCTAGGACCCTTAGCTGGGGTGG - Intergenic
945058571 2:205888822-205888844 TCTTGCACACAGGGCTGGTTAGG - Intergenic
947690035 2:232126810-232126832 TTGGGGACACAGTGCTGGGTAGG - Intronic
948595298 2:239075916-239075938 CCAGGGAGACAGAGCTGGGTTGG + Intronic
948595313 2:239075974-239075996 CCTGGGAAACAGAGCTGGGCTGG + Intronic
948753157 2:240144040-240144062 TCCAGGAAACAGAGGTGGGCTGG - Intronic
1172635379 20:36406531-36406553 TCTTGGTCACAGGGCTGGGAAGG + Intronic
1173468232 20:43301460-43301482 TCCAGGACACAGAGAAGGGAAGG + Intergenic
1173800256 20:45890761-45890783 TCGAGGAGAAAGAGCTGGGCTGG - Exonic
1174486573 20:50865252-50865274 TCTAGGACAGAGGGATGGGGAGG + Intronic
1175219838 20:57410408-57410430 TCTAAGTCACCGAGTTGGGTGGG + Intergenic
1176590618 21:8646482-8646504 TCATGAACACAGAGCAGGGTAGG + Intergenic
1178087344 21:29125298-29125320 AGTAAGAGACAGAGCTGGGTTGG + Intronic
1178281181 21:31284435-31284457 CCTAGGACACACAGCAGGGGGGG + Intronic
1178724025 21:35035440-35035462 TCTAGGAGGCAGAACTCGGTTGG - Intronic
1178891638 21:36525154-36525176 TCGAGGTCACAGGGCTGGGCTGG - Intronic
1179897870 21:44372826-44372848 CCGTGGACACAGAGCAGGGTAGG - Intronic
1180273447 22:10623516-10623538 TCATGAACACAGAGCAGGGTAGG + Intergenic
1180613385 22:17111898-17111920 TCTGGGACACAGAGCTTTGGTGG - Exonic
1183483620 22:38077914-38077936 TCAGGGGCACAGGGCTGGGTGGG - Intergenic
1184128546 22:42503583-42503605 TCTAGGGCACACAGCTGGGCCGG + Intergenic
1184137340 22:42556898-42556920 TCTAGGGCACACAGCTGGGCCGG + Intronic
1185051346 22:48555861-48555883 TCAAGTACACAGACCTGGGAGGG + Intronic
949136653 3:575196-575218 TCATGAACACAGAGCAGGGTAGG - Intergenic
951320396 3:21237524-21237546 TCATGGAAACAGAGTTGGGTAGG + Intergenic
952610119 3:35198677-35198699 TCTATGACAAGAAGCTGGGTGGG + Intergenic
954277069 3:49549256-49549278 TCTATGAAACAGACATGGGTGGG + Intergenic
954894257 3:53962691-53962713 GCTAGGACTCAGAGCCTGGTGGG - Intergenic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
956590665 3:70911326-70911348 TCCATGACACTGAGCTGGATGGG - Intergenic
956650345 3:71499079-71499101 TCTAGGACACAGAGCTGGGTGGG - Intronic
956679282 3:71762770-71762792 ACTAGGATACAGAGTTGGTTGGG - Intergenic
956886368 3:73564302-73564324 ACTAGGACACAAAGAAGGGTAGG - Intronic
960743585 3:120861626-120861648 CCAAGGACACAGAGTTGGGGTGG + Intergenic
962300857 3:134241759-134241781 TGTAGGTCACAGAGATGTGTGGG - Intronic
965795677 3:172436408-172436430 CCAAGGACACTGAGCTGTGTTGG - Intergenic
967223211 3:187266694-187266716 TTAAGGACAGAGAGCTGGGAAGG + Intronic
967419570 3:189258853-189258875 CCTGGGACACTGAGCTTGGTTGG - Intronic
968265106 3:197356680-197356702 TGAAGAACACAGAGGTGGGTGGG + Intergenic
968734447 4:2288186-2288208 TCATGGACTCAGGGCTGGGTAGG - Intronic
968973932 4:3811379-3811401 TCCAAGTCACAGAGCTGGGCGGG - Intergenic
969051121 4:4373693-4373715 TCAAGGTCACACAGCTGGGAGGG - Intronic
972602544 4:40585890-40585912 TCTAGGGAACAGAGCAGAGTGGG + Intronic
975358411 4:73436039-73436061 TCAAGGACACAGAGCTCTTTGGG - Intronic
982016505 4:151159657-151159679 TCTAGCACATAGATCTTGGTTGG - Intronic
982266482 4:153542777-153542799 TGGAGGAGACAGAGCTGGGAGGG + Intronic
984484776 4:180353932-180353954 TTTAAGACACAGAACTGGCTGGG - Intergenic
984968402 4:185163523-185163545 TCTGGGGCACACAGCTGGCTAGG + Intronic
986641705 5:9878329-9878351 TCTATGACACAGTCCTGGGCGGG - Intergenic
986717639 5:10535395-10535417 CTCAGGACACAGACCTGGGTGGG + Intergenic
987370404 5:17187711-17187733 TCTAGGACACAGACTTGGCAGGG + Intronic
991281632 5:64921096-64921118 TCTGGAACACAGAGCAGTGTAGG - Intronic
993974266 5:94457572-94457594 TCTAGGACAGAGTGCTGGCGTGG - Intronic
994670483 5:102756026-102756048 CCAAGGCCACAGAGCTGGGAAGG - Intronic
997236516 5:132275125-132275147 TCCTAGACACAGTGCTGGGTAGG - Intronic
997258636 5:132448433-132448455 ACTAGGAGACAGAGTTGGCTGGG - Intronic
997424610 5:133794746-133794768 GCTTGGATACAGTGCTGGGTTGG - Intergenic
998229032 5:140347519-140347541 TGTTTGACACAGGGCTGGGTTGG + Intergenic
998763842 5:145462585-145462607 TCTTGGTCACAGAGCAGGGTAGG - Intergenic
998951988 5:147401779-147401801 TCTGAGACACAGTCCTGGGTAGG - Intronic
999742382 5:154566142-154566164 CCCAGGGCACAGAGCTGGGTGGG - Intergenic
1000300872 5:159954873-159954895 TGTAGGACACCCAGCTGGGTGGG - Intronic
1003195442 6:3910111-3910133 TCGGGGGCACAGAGCTGGCTGGG - Intergenic
1005787285 6:29257412-29257434 TCCATCACACTGAGCTGGGTAGG + Intergenic
1005860562 6:29896777-29896799 TTTAGGACACAGAGCTTGTGGGG + Intergenic
1006654152 6:35576054-35576076 TCTAGGATATCTAGCTGGGTAGG + Intronic
1007632588 6:43281032-43281054 GCCAGGTCACAGGGCTGGGTGGG + Intronic
1011489527 6:87876025-87876047 TCAAGGTCACACAGCTGGTTTGG - Intergenic
1015040733 6:128715695-128715717 TCAAGGACAGAGAGATAGGTTGG - Intergenic
1018622402 6:165743057-165743079 GCTAAGACACAGGGCAGGGTAGG - Intronic
1018641910 6:165911716-165911738 TCTTGGACACAGAGATGCCTGGG - Intronic
1019478328 7:1254798-1254820 CCGAGGACACACAGCTGGGCAGG + Intergenic
1020344555 7:7149034-7149056 TCAGGAACACAGGGCTGGGTAGG + Intergenic
1022906287 7:34860964-34860986 TCTTGGACACAAAGCTGAGCTGG + Intronic
1023579582 7:41667145-41667167 TCAAAGTCACAGAGCTGGGGAGG + Intergenic
1023608927 7:41955025-41955047 TCTAGTACACAGGGCTGGTAAGG + Intergenic
1023659883 7:42460539-42460561 TCTAGGTCAGAAAGCTGGATGGG - Intergenic
1023860743 7:44216487-44216509 TCCAGGACAGAGAGCTGGAATGG - Intergenic
1024157271 7:46638356-46638378 TCTATGAAACAGAGCTGTGTTGG - Intergenic
1026584207 7:71643085-71643107 TCCAGGACAAAGACCTGGGGTGG + Intronic
1026909665 7:74084450-74084472 TCAAGGTCACAGAGCCGGGCAGG - Intronic
1028041105 7:86056084-86056106 TCTTGAAGACAGAGATGGGTGGG + Intergenic
1028231937 7:88316214-88316236 TTTGGGACACGGAGGTGGGTGGG + Intergenic
1028442635 7:90881062-90881084 TCAAGGACAAAGAACTGGGTGGG + Intronic
1028712991 7:93932153-93932175 TCTACTTCACAGAGCTGGTTTGG + Intergenic
1029816198 7:103097902-103097924 CACAGGGCACAGAGCTGGGTGGG - Intronic
1032320527 7:130882503-130882525 TCTTGGTCACAGAGCTGGAGTGG + Intergenic
1032533128 7:132638150-132638172 TCTTGCACACACAGCTGTGTAGG - Intronic
1034438689 7:151075897-151075919 CCTAGGTGCCAGAGCTGGGTTGG - Intronic
1034980107 7:155470312-155470334 TCTTGGAGGAAGAGCTGGGTTGG - Intergenic
1035676317 8:1458832-1458854 CCCAGGACAGAGAGCAGGGTCGG + Intergenic
1036659532 8:10699123-10699145 TCTAGCACACGGAGCAGGGTGGG + Intronic
1038814995 8:30893224-30893246 CCAAGGACACAGAGCTAGGAAGG + Intergenic
1039312930 8:36338628-36338650 TCTTCGACACAGTGCTGTGTGGG + Intergenic
1042040848 8:64587066-64587088 TCCAGTAAACAGGGCTGGGTAGG + Intergenic
1042230473 8:66549315-66549337 ACTATGACACAAAGCTTGGTGGG - Intergenic
1043426869 8:80156561-80156583 TCTAAGAGAAAGAGCTGGGCAGG + Intronic
1044841758 8:96343142-96343164 TGCTGGACACACAGCTGGGTGGG - Intergenic
1046674378 8:117092669-117092691 TGTAAGAAACAGAGCTGGGGAGG + Intronic
1047573579 8:126129326-126129348 TCCAGGAAACGGTGCTGGGTAGG + Intergenic
1047759808 8:127945883-127945905 CCTAGGACACAGAGCTGACTGGG - Intergenic
1048140470 8:131789456-131789478 TCTAGGACACACAGATGCATGGG + Intergenic
1048286239 8:133143810-133143832 TTTAGGACACAGAGCTAGAAAGG - Intergenic
1048706760 8:137162296-137162318 TCTAGGTCAGAAAGCAGGGTGGG - Intergenic
1048743920 8:137592183-137592205 TCTAGGGGAGAGAGCTGGGCTGG - Intergenic
1049363726 8:142226503-142226525 ACGAGGACTCAGAGCTGGGAGGG + Intronic
1051175040 9:14352222-14352244 TCCAGGAGACGGAGCAGGGTAGG - Intronic
1051286314 9:15500824-15500846 TCTAAGATACAGAACTAGGTAGG + Intronic
1052855343 9:33403180-33403202 TAAAGGACCCAGAGCTGGATCGG + Intergenic
1053516458 9:38734613-38734635 AGTAGGACACAGAGATGTGTTGG - Intergenic
1054882469 9:70159489-70159511 TCTATGTCTCAGAGGTGGGTAGG + Intronic
1055146855 9:72946057-72946079 TCTAGGACACAGTGATGGAGTGG - Intronic
1056126481 9:83539641-83539663 TCTAGGACACCTAGTGGGGTTGG + Intergenic
1057215775 9:93227905-93227927 TCTAAAACACTGAGCTGGTTAGG + Intronic
1057724983 9:97562068-97562090 CCTAGCACACAGTGCTGGGGTGG + Intronic
1057735802 9:97658681-97658703 TGCAGGACACAGAGCTGAGAAGG - Exonic
1057810968 9:98256210-98256232 GCCAGGACAGAGAGCTGGGGAGG - Intergenic
1058539682 9:105998841-105998863 TCTTGGACACAGAGCAGGCCAGG - Intergenic
1058606205 9:106726240-106726262 TCTAGCACACAGCTCTGGTTTGG + Intergenic
1059638367 9:116192204-116192226 CCAAGGACACAGAGCAGGGTGGG + Intronic
1060381394 9:123177032-123177054 TGAAGGACACAGAGATGGGTGGG - Intronic
1060931215 9:127490592-127490614 TCAAGGACACAGAGCAGGTAAGG - Intronic
1061178190 9:129009663-129009685 CCTGTGACACAAAGCTGGGTTGG - Intronic
1062166751 9:135111689-135111711 TAAAGGTCACAGAGCTGGGAGGG - Intronic
1062256478 9:135624985-135625007 TTTAGGACGCCGAGGTGGGTGGG - Intronic
1062628889 9:137454856-137454878 TCAAGGACACAGAGCAGGAGAGG - Intronic
1203740236 Un_GL000216v2:171726-171748 TTTAGGACACAGGGTTGGGACGG + Intergenic
1203620631 Un_KI270749v1:125207-125229 TCATGAACACAGAGCAGGGTAGG + Intergenic
1188467228 X:30495722-30495744 TCTAGGAAACTGAACAGGGTTGG - Intergenic
1188791148 X:34409460-34409482 TGTAGGACACAGATATGGTTTGG + Intergenic
1190462414 X:50691607-50691629 TATAGGAAGAAGAGCTGGGTTGG + Intronic
1190469552 X:50764512-50764534 TCCACGACAAAGAGCTGGGTTGG + Intronic
1190847854 X:54210970-54210992 GCTGGGCAACAGAGCTGGGTGGG - Intronic
1194326794 X:92528587-92528609 TTTAGGACTCAAGGCTGGGTGGG - Intronic
1194766988 X:97853087-97853109 TCTAGGACAAAGAGCTTGATGGG + Intergenic
1195068363 X:101257246-101257268 TCTAAGTCACAGGTCTGGGTGGG + Intronic
1196109705 X:111932790-111932812 TCCAGGACACTGGGCTAGGTCGG - Intronic
1197366885 X:125574052-125574074 TATAGGACACAAGGCTGGGGAGG + Intergenic