ID: 956654210

View in Genome Browser
Species Human (GRCh38)
Location 3:71533601-71533623
Sequence TCACAGAACAATAATGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956654210_956654219 30 Left 956654210 3:71533601-71533623 CCAACCCCATTATTGTTCTGTGA 0: 1
1: 0
2: 0
3: 10
4: 161
Right 956654219 3:71533654-71533676 ATTCTGCAGAATTATTTTTCGGG 0: 1
1: 0
2: 7
3: 47
4: 591
956654210_956654218 29 Left 956654210 3:71533601-71533623 CCAACCCCATTATTGTTCTGTGA 0: 1
1: 0
2: 0
3: 10
4: 161
Right 956654218 3:71533653-71533675 AATTCTGCAGAATTATTTTTCGG 0: 1
1: 0
2: 5
3: 75
4: 683

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956654210 Original CRISPR TCACAGAACAATAATGGGGT TGG (reversed) Intronic
901465164 1:9416770-9416792 TCACTGAAAAATAAAGGGGGAGG - Intergenic
904596613 1:31650298-31650320 AGACAGAAGGATAATGGGGTTGG + Intergenic
908138200 1:61154861-61154883 TCACACAAAAATAAAGGGCTTGG + Intronic
908966417 1:69770040-69770062 TCACAGAACAGTGATGGTCTGGG + Intronic
909985505 1:82156227-82156249 CCACAGAGCAAGAGTGGGGTGGG - Intergenic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
915128375 1:153680836-153680858 TCACAGAACAGAAAAGAGGTTGG + Intronic
916352493 1:163867073-163867095 TCACAGAAAAGTTATTGGGTGGG - Intergenic
916466285 1:165077341-165077363 TCACAAAAGAGTGATGGGGTAGG + Intergenic
917311895 1:173687462-173687484 TCAGAGAAGAAAAAAGGGGTGGG - Intergenic
923079652 1:230641666-230641688 TCTCAGAATAAAATTGGGGTGGG + Intergenic
924642334 1:245846077-245846099 TAGCAGAACATGAATGGGGTGGG + Intronic
1063424936 10:5943528-5943550 TCACACACACATAATGGGGTCGG + Intronic
1066372629 10:34830108-34830130 TAAAATAATAATAATGGGGTAGG + Intergenic
1069856456 10:71443628-71443650 CCACAGACCCACAATGGGGTGGG + Intronic
1070253579 10:74794903-74794925 TGTCAGAAAAATAATTGGGTAGG + Intergenic
1070483973 10:76912156-76912178 TCACAGAACAGTAATTATGTGGG + Intronic
1072257818 10:93637510-93637532 TCAAAGAAAAATAATAGGGATGG - Intronic
1074128996 10:110556551-110556573 TCACACAACAACAATGTAGTTGG - Intergenic
1078319910 11:10325004-10325026 TCTCAGGAGAATAATGAGGTTGG + Intronic
1079751573 11:24205938-24205960 CCACAGAACCTTAATGAGGTAGG + Intergenic
1086159968 11:83711098-83711120 GCACAGTTCAATAAGGGGGTTGG - Intronic
1086518277 11:87640056-87640078 TCAAAGAAAAATAATGAGGCAGG - Intergenic
1086657981 11:89382704-89382726 TGACAGAAGAATTATAGGGTGGG - Intronic
1088202977 11:107360109-107360131 ACTCAGAAGAATAAGGGGGTGGG - Intronic
1090849171 11:130556651-130556673 TCCCTGAACAATACAGGGGTTGG + Intergenic
1091385029 12:88390-88412 TCACTGAATAATAAAGGGGCAGG + Intronic
1091916867 12:4275990-4276012 TCACAGACCTATAATGGGAGTGG - Exonic
1092734137 12:11563815-11563837 TCTCATATCAATAAGGGGGTGGG - Intergenic
1093870699 12:24287850-24287872 TCACAGAACAACAATGCAGCAGG + Intergenic
1096217406 12:49805574-49805596 CCACAAAAGAAAAATGGGGTTGG + Intronic
1097349930 12:58537483-58537505 TCAGAGAGCAAGAATGTGGTGGG + Intergenic
1097506995 12:60485934-60485956 ACACAGAAGAATACTGGAGTTGG + Intergenic
1101863893 12:108505316-108505338 TCACATAACAAGATTAGGGTGGG + Intergenic
1105392505 13:19993820-19993842 TCACAGACCAAGACTGGAGTAGG + Exonic
1105793386 13:23825709-23825731 TCACACAATAATAATGAGGGGGG - Intronic
1113052900 13:106234457-106234479 TCACAGGGCAATTGTGGGGTGGG - Intergenic
1113642213 13:111965756-111965778 TCACAGCAAAATTATGGGGAAGG - Intergenic
1115396723 14:32917498-32917520 TCAAAAAACAGTAATGGGCTTGG - Intergenic
1118561690 14:67091638-67091660 TCACAGAACAATATTCTGTTTGG - Intronic
1120531561 14:85638354-85638376 TGACTGATCAATATTGGGGTAGG + Exonic
1122422772 14:101587931-101587953 TCACACATCAATAAGGGAGTGGG - Intergenic
1126617412 15:50598848-50598870 TCACATAACAATATTGAGCTAGG - Intronic
1126663587 15:51055538-51055560 CCACAGCACAACAATGGTGTAGG - Intergenic
1128964038 15:72039827-72039849 TCAAAGAAAAAAAAGGGGGTGGG + Intronic
1129979912 15:79859272-79859294 TCAAAGTAGAATAATGGGGCAGG + Intronic
1131948485 15:97653507-97653529 TTACAGAATAATAGTGGGGAGGG + Intergenic
1134237867 16:12481838-12481860 TCAAAGGACAATCATGGGGCCGG - Intronic
1134818750 16:17228467-17228489 GCACAGAACGGTGATGGGGTTGG + Intronic
1137430699 16:48416123-48416145 TCAAAGAACAAAAATGTGATTGG + Intronic
1141547003 16:84776812-84776834 TCTCAAAAAAATAATGGGTTAGG - Intronic
1141650528 16:85390535-85390557 TTTCAGAACAATAAAGGTGTCGG + Intergenic
1147338376 17:39740084-39740106 TCACAGACCAACAGTGGGGTGGG - Intronic
1147747421 17:42703471-42703493 TCACAAAATAATAATAGGCTGGG - Intronic
1149945102 17:60916523-60916545 TGAAAGAACAACAATGGGGTGGG + Intronic
1149975475 17:61261504-61261526 TAACAGAAGAGTAATGAGGTTGG - Intronic
1155075525 18:22350678-22350700 TCACAGAACTTCAGTGGGGTGGG + Intergenic
1156681214 18:39591049-39591071 TCACAGGCCAACTATGGGGTAGG - Intergenic
1157711942 18:49856236-49856258 TCACAGCACCTTCATGGGGTGGG - Intronic
1158332536 18:56378816-56378838 TCACAGATCAATAACGGCCTGGG - Intergenic
1165225208 19:34349860-34349882 GCACAGAATAGTAGTGGGGTGGG + Intronic
1168210649 19:54887619-54887641 TCAAAAAACAATAATAGGCTGGG + Intronic
930953285 2:57171552-57171574 TCACAGAGTAATAATGGGTCAGG - Intergenic
931037539 2:58260258-58260280 TTACAGAAAAAAAAGGGGGTGGG + Intergenic
933277649 2:80301088-80301110 TGACAGAGCAGTGATGGGGTGGG - Intronic
933645876 2:84812317-84812339 TGAAAGAACAAAAAAGGGGTTGG - Intronic
936609925 2:113992228-113992250 TCACTGTACAGTCATGGGGTGGG - Intergenic
937105468 2:119308342-119308364 TTTTAAAACAATAATGGGGTCGG + Intronic
940384617 2:153056128-153056150 TCACAGCACAACAAAGGGGTAGG - Intergenic
940494337 2:154406246-154406268 TAACAGAATAACAATGGGGGTGG - Intronic
941606732 2:167606779-167606801 TCAAAGAACAGTTATGGGATGGG + Intergenic
941671862 2:168302353-168302375 TGTCAGAGCAATAATAGGGTGGG + Intergenic
941788563 2:169525087-169525109 AAACAGAACAATAAAGGGGAAGG + Intronic
946518584 2:220440901-220440923 ACACACAGCAATAATGGGTTGGG + Intergenic
1175220955 20:57416233-57416255 TGAGAGAACAAGGATGGGGTTGG - Intergenic
1178547352 21:33503511-33503533 TCAAAAAATAATAATGGGCTGGG - Intergenic
1181327653 22:22062606-22062628 TCAAAGCAAAATAATGAGGTAGG + Intergenic
1181733750 22:24866271-24866293 TCACAGCAACACAATGGGGTGGG + Intronic
1182170618 22:28225072-28225094 TCACAGAAAAACAATGGTGCTGG + Intronic
950864394 3:16177007-16177029 GCACAAAACTAGAATGGGGTGGG - Intronic
950936087 3:16840829-16840851 GCTCAGAACAATAAAAGGGTGGG + Intronic
952106677 3:30078065-30078087 TCACAGAACAAGAATGCTTTTGG - Intergenic
953958263 3:47247662-47247684 TCAGAGAGGGATAATGGGGTCGG + Intronic
954088973 3:48269931-48269953 TCTTAGAACAAGAGTGGGGTGGG - Exonic
954983633 3:54769501-54769523 TCACAGAGCAAATATGGAGTAGG - Intronic
955392381 3:58531001-58531023 TGACAGAGCAATCGTGGGGTGGG - Intronic
956654210 3:71533601-71533623 TCACAGAACAATAATGGGGTTGG - Intronic
957402123 3:79729928-79729950 TCACAGAGAAATCATGGGATGGG - Intronic
958091250 3:88879607-88879629 TCACAGAACAAAAGAAGGGTAGG + Intergenic
958101256 3:89014207-89014229 TAAAAGAACACTAATGTGGTTGG - Intergenic
959571003 3:107883589-107883611 TCACAGAACTGTTATGTGGTTGG + Intergenic
961665579 3:128491665-128491687 ACACAGAACAGTAATGAGGTGGG - Intronic
967179056 3:186887092-186887114 TCACAAGACAATAGTGGGGAGGG + Intergenic
967334328 3:188325495-188325517 TGACAGAAGAATGATGGGGAGGG - Intronic
967431897 3:189395345-189395367 TCACAGAAAAAAAATGATGTGGG - Intergenic
969629255 4:8325979-8326001 TCAGTGAACCATAATGGGGCTGG + Intergenic
969860312 4:10030607-10030629 TCACAGAAAAATTATGAGGAAGG - Intronic
970455689 4:16221456-16221478 TCACAGAGCAATTCTGTGGTAGG - Intronic
971920316 4:32930904-32930926 TCAGTGAAAAATAATGTGGTAGG + Intergenic
972452935 4:39221689-39221711 TTACAGAAAAAGCATGGGGTGGG - Intronic
974856088 4:67463008-67463030 TCACTGAACAATAATAAGCTGGG + Intergenic
975175857 4:71288382-71288404 TCAGAGAACAAATATAGGGTAGG + Intronic
975840669 4:78470425-78470447 TGACAGAACAATAAGGTGGAGGG - Intronic
976224301 4:82782904-82782926 CCACACAACAATACTGAGGTGGG + Intronic
978659379 4:111105824-111105846 TCAAAGAACATTAGTGGAGTTGG + Intergenic
979178479 4:117694668-117694690 TCACAGTACAATAATGGTGGGGG + Intergenic
979187088 4:117810675-117810697 TCACAGGCCAGTAATTGGGTTGG - Intergenic
979230528 4:118343861-118343883 TCAGAAAACACTATTGGGGTGGG - Intronic
982363661 4:154551154-154551176 ACATAGAAAAATAATTGGGTAGG - Intergenic
984879076 4:184394718-184394740 CCACAGTAGAATAATGGGGTGGG - Intronic
985627980 5:999958-999980 GCAGGGAACATTAATGGGGTAGG + Intergenic
986515702 5:8561354-8561376 TCACAGAACAACACTGGGAAGGG - Intergenic
988851539 5:35185901-35185923 TCAGAGAACACTAATATGGTTGG - Intronic
990324320 5:54660061-54660083 TCCCAGAAAAATAAGTGGGTTGG + Intergenic
992811302 5:80391298-80391320 TCACACACCAGTCATGGGGTGGG - Intergenic
993410722 5:87570022-87570044 TCAAGGAAGAATAATGGGATTGG + Intergenic
998294951 5:140960303-140960325 TCACAGGACCCTAATGAGGTTGG - Intronic
999945731 5:156593185-156593207 TCACAGAATAAGAATGAGTTGGG + Intronic
1002145402 5:177176591-177176613 CAATAGAACAATAATGGGGTCGG - Intronic
1004957196 6:20741286-20741308 CCACAGAACAACAAAGGTGTGGG - Intronic
1005511046 6:26511744-26511766 TAAAAGAAAAAAAATGGGGTGGG - Intergenic
1005699518 6:28386415-28386437 TGAAATAACAATAACGGGGTGGG - Intronic
1006802792 6:36770035-36770057 TCACAGAACATTAAGAGAGTAGG + Intronic
1007244086 6:40447512-40447534 TCACAGAAAAATAAAGGTTTGGG - Intronic
1008388946 6:50926876-50926898 ACTCAGAACAATAATTGGGCTGG - Intergenic
1012359133 6:98354802-98354824 TCACAGAACGATGATGAAGTAGG - Intergenic
1015037954 6:128680112-128680134 CTAAAGTACAATAATGGGGTGGG - Intergenic
1017244395 6:152206950-152206972 TCACAGAAGAATATTGATGTTGG + Intronic
1017480123 6:154845132-154845154 CCACAGAACAATTATGGCTTAGG + Intronic
1017540727 6:155399767-155399789 CAACAGAACCCTAATGGGGTTGG + Intronic
1017729649 6:157304041-157304063 TCAAAGAACAAAAATGTGATTGG - Intronic
1019361588 7:607658-607680 GCACAGAACAGAAATGGGGCTGG - Intronic
1021609925 7:22446825-22446847 TCACAGCACCATTGTGGGGTGGG - Intronic
1021781497 7:24111192-24111214 TCACAGAAACATACTGGTGTTGG - Intergenic
1023064700 7:36366054-36366076 TCACAGAAAAATAGTCTGGTAGG + Intronic
1024469763 7:49755348-49755370 TCACAGAAGTTTAATTGGGTTGG - Intergenic
1028273867 7:88826601-88826623 TTACAGAATATTATTGGGGTTGG + Intronic
1028414310 7:90563966-90563988 CCACAGAAGAATGATGGGGAAGG - Intronic
1028744702 7:94314748-94314770 TCACAGAACAAAAATGGATTAGG - Intergenic
1030765244 7:113401151-113401173 AAACAGAACAATAATGGGTTAGG - Intergenic
1030780069 7:113589749-113589771 TCACAGAAAGATAATGGGGAGGG - Intergenic
1034272670 7:149811023-149811045 TCACAGGGCCATAATGGGATGGG - Intergenic
1038076237 8:24078119-24078141 TGACAGAACAAAATTGTGGTTGG + Intergenic
1038371190 8:26992981-26993003 ACACAGAACTGTAATGTGGTAGG + Intergenic
1039327119 8:36497880-36497902 TCATAGGATAATAAAGGGGTGGG + Intergenic
1039672104 8:39612917-39612939 TACCAGAAAAATAATGGGGGAGG - Intronic
1040624137 8:49126009-49126031 TCACAGAACTTTAATAGTGTAGG + Intergenic
1043351425 8:79365404-79365426 TCTCATAACAATACTGTGGTAGG - Intergenic
1044474242 8:92607434-92607456 TAACAGTACACTAATGGGATTGG - Intergenic
1044901242 8:96947287-96947309 TCACAAAATTATAATGGAGTAGG + Intronic
1045865168 8:106857156-106857178 TCACAGGAGCAGAATGGGGTGGG + Intergenic
1047279245 8:123430897-123430919 TCCCTGAAAAATAAAGGGGTGGG - Intronic
1047570823 8:126097235-126097257 TCAAAAAACAAAAATGGGATGGG + Intergenic
1047902226 8:129435781-129435803 TCAAAAGACAATGATGGGGTAGG - Intergenic
1048970529 8:139642903-139642925 TGGCAGAACAAGATTGGGGTAGG + Intronic
1050746908 9:8886686-8886708 TCACACAACAGTCAAGGGGTAGG - Intronic
1051560021 9:18430292-18430314 TCACAGAAAAATAATACTGTTGG - Intergenic
1055660918 9:78503098-78503120 TGACAGACTAATAATGTGGTAGG - Intergenic
1059930997 9:119260811-119260833 TAATAGAAAAACAATGGGGTGGG + Intronic
1186100697 X:6153246-6153268 TCACAGAACAATAATACAATGGG + Intronic
1187474007 X:19593646-19593668 TCACCTAACAATAATGAAGTCGG + Intronic
1187566579 X:20456060-20456082 TGACAGAACAAAAATGTGTTGGG + Intergenic
1190531204 X:51378384-51378406 TCAAAGAGCTAGAATGGGGTGGG + Intergenic
1190904007 X:54708194-54708216 TTACAAAACCACAATGGGGTTGG + Intergenic
1192805433 X:74504601-74504623 TCACAGAACAATCATTTAGTTGG + Intronic
1193671374 X:84390184-84390206 TAACAAAACAATGATGGGGGAGG - Intronic
1194114507 X:89879710-89879732 TTACATAACAATAAAGGGGCCGG + Intergenic
1196558447 X:117119623-117119645 TCACATAAAAATAATGCAGTAGG - Intergenic
1197799019 X:130329551-130329573 TCACAGTACATTAAAGGGGAGGG - Intergenic
1198986582 X:142461407-142461429 TTACAGAATAAAAATGTGGTAGG - Intergenic
1200467248 Y:3535076-3535098 TTACATAACAATAAAGGGGCCGG + Intergenic
1200936287 Y:8741239-8741261 TCACAGAAAAATAAACAGGTAGG + Intergenic