ID: 956654995

View in Genome Browser
Species Human (GRCh38)
Location 3:71540871-71540893
Sequence TCTAATCTTTCATTGGTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 205}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956654995_956654999 -4 Left 956654995 3:71540871-71540893 CCAAACACCAATGAAAGATTAGA 0: 1
1: 0
2: 1
3: 25
4: 205
Right 956654999 3:71540890-71540912 TAGAAGGAAACAAGGTTTTTAGG 0: 1
1: 0
2: 3
3: 85
4: 721
956654995_956655001 17 Left 956654995 3:71540871-71540893 CCAAACACCAATGAAAGATTAGA 0: 1
1: 0
2: 1
3: 25
4: 205
Right 956655001 3:71540911-71540933 GGACCACAAGTTAAAGAGGTAGG 0: 1
1: 0
2: 0
3: 2
4: 130
956654995_956655000 13 Left 956654995 3:71540871-71540893 CCAAACACCAATGAAAGATTAGA 0: 1
1: 0
2: 1
3: 25
4: 205
Right 956655000 3:71540907-71540929 TTTAGGACCACAAGTTAAAGAGG 0: 1
1: 0
2: 0
3: 4
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956654995 Original CRISPR TCTAATCTTTCATTGGTGTT TGG (reversed) Intronic