ID: 956654999 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:71540890-71540912 |
| Sequence | TAGAAGGAAACAAGGTTTTT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 810 | |||
| Summary | {0: 1, 1: 0, 2: 3, 3: 85, 4: 721} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 956654995_956654999 | -4 | Left | 956654995 | 3:71540871-71540893 | CCAAACACCAATGAAAGATTAGA | 0: 1 1: 0 2: 1 3: 25 4: 205 |
||
| Right | 956654999 | 3:71540890-71540912 | TAGAAGGAAACAAGGTTTTTAGG | 0: 1 1: 0 2: 3 3: 85 4: 721 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 956654999 | Original CRISPR | TAGAAGGAAACAAGGTTTTT AGG | Intronic | ||