ID: 956654999

View in Genome Browser
Species Human (GRCh38)
Location 3:71540890-71540912
Sequence TAGAAGGAAACAAGGTTTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 810
Summary {0: 1, 1: 0, 2: 3, 3: 85, 4: 721}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956654995_956654999 -4 Left 956654995 3:71540871-71540893 CCAAACACCAATGAAAGATTAGA 0: 1
1: 0
2: 1
3: 25
4: 205
Right 956654999 3:71540890-71540912 TAGAAGGAAACAAGGTTTTTAGG 0: 1
1: 0
2: 3
3: 85
4: 721

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956654999 Original CRISPR TAGAAGGAAACAAGGTTTTT AGG Intronic