ID: 956655000

View in Genome Browser
Species Human (GRCh38)
Location 3:71540907-71540929
Sequence TTTAGGACCACAAGTTAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956654997_956655000 6 Left 956654997 3:71540878-71540900 CCAATGAAAGATTAGAAGGAAAC 0: 1
1: 0
2: 0
3: 17
4: 319
Right 956655000 3:71540907-71540929 TTTAGGACCACAAGTTAAAGAGG 0: 1
1: 0
2: 0
3: 4
4: 128
956654995_956655000 13 Left 956654995 3:71540871-71540893 CCAAACACCAATGAAAGATTAGA 0: 1
1: 0
2: 1
3: 25
4: 205
Right 956655000 3:71540907-71540929 TTTAGGACCACAAGTTAAAGAGG 0: 1
1: 0
2: 0
3: 4
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956655000 Original CRISPR TTTAGGACCACAAGTTAAAG AGG Intronic