ID: 956655001 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:71540911-71540933 |
| Sequence | GGACCACAAGTTAAAGAGGT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 133 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 2, 4: 130} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 956654997_956655001 | 10 | Left | 956654997 | 3:71540878-71540900 | CCAATGAAAGATTAGAAGGAAAC | 0: 1 1: 0 2: 0 3: 17 4: 319 |
||
| Right | 956655001 | 3:71540911-71540933 | GGACCACAAGTTAAAGAGGTAGG | 0: 1 1: 0 2: 0 3: 2 4: 130 |
||||
| 956654995_956655001 | 17 | Left | 956654995 | 3:71540871-71540893 | CCAAACACCAATGAAAGATTAGA | 0: 1 1: 0 2: 1 3: 25 4: 205 |
||
| Right | 956655001 | 3:71540911-71540933 | GGACCACAAGTTAAAGAGGTAGG | 0: 1 1: 0 2: 0 3: 2 4: 130 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 956655001 | Original CRISPR | GGACCACAAGTTAAAGAGGT AGG | Intronic | ||