ID: 956655003 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:71540929-71540951 |
| Sequence | GTAGGAGAACATTAACAAAA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 324 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 28, 4: 295} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 956654997_956655003 | 28 | Left | 956654997 | 3:71540878-71540900 | CCAATGAAAGATTAGAAGGAAAC | 0: 1 1: 0 2: 0 3: 17 4: 319 |
||
| Right | 956655003 | 3:71540929-71540951 | GTAGGAGAACATTAACAAAAAGG | 0: 1 1: 0 2: 0 3: 28 4: 295 |
||||
| 956655002_956655003 | -8 | Left | 956655002 | 3:71540914-71540936 | CCACAAGTTAAAGAGGTAGGAGA | 0: 1 1: 0 2: 0 3: 15 4: 184 |
||
| Right | 956655003 | 3:71540929-71540951 | GTAGGAGAACATTAACAAAAAGG | 0: 1 1: 0 2: 0 3: 28 4: 295 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 956655003 | Original CRISPR | GTAGGAGAACATTAACAAAA AGG | Intronic | ||