ID: 956655003

View in Genome Browser
Species Human (GRCh38)
Location 3:71540929-71540951
Sequence GTAGGAGAACATTAACAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 295}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956654997_956655003 28 Left 956654997 3:71540878-71540900 CCAATGAAAGATTAGAAGGAAAC 0: 1
1: 0
2: 0
3: 17
4: 319
Right 956655003 3:71540929-71540951 GTAGGAGAACATTAACAAAAAGG 0: 1
1: 0
2: 0
3: 28
4: 295
956655002_956655003 -8 Left 956655002 3:71540914-71540936 CCACAAGTTAAAGAGGTAGGAGA 0: 1
1: 0
2: 0
3: 15
4: 184
Right 956655003 3:71540929-71540951 GTAGGAGAACATTAACAAAAAGG 0: 1
1: 0
2: 0
3: 28
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956655003 Original CRISPR GTAGGAGAACATTAACAAAA AGG Intronic