ID: 956656795

View in Genome Browser
Species Human (GRCh38)
Location 3:71560095-71560117
Sequence CTTCAGGTACAGATGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 524
Summary {0: 1, 1: 1, 2: 14, 3: 82, 4: 426}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956656795 Original CRISPR CTTCAGGTACAGATGGAGCC AGG (reversed) Intronic
900291965 1:1927456-1927478 CTTCAGACACAGCTGGATCCAGG - Intronic
900421895 1:2559365-2559387 CTTCAGGTACTGGTGGAGGTGGG - Intronic
901474111 1:9477304-9477326 CTTCAGGCAGAGGTGGATCCAGG - Intergenic
901627486 1:10632214-10632236 CTCCAGGGAGAAATGGAGCCGGG - Intergenic
901760385 1:11467364-11467386 CTTCAGGTATAGCTTGATCCAGG + Intergenic
902200517 1:14830123-14830145 CTTCAGGCACAGCTGGATCCAGG + Intronic
902905571 1:19554269-19554291 CTTCAGGTATGGCTGGATCCAGG - Intergenic
903663092 1:24990639-24990661 CTTCAGGCACAGATGGATCCGGG + Intergenic
903689732 1:25164250-25164272 CTCCAGGAGCAGAAGGAGCCTGG - Intergenic
904227245 1:29032271-29032293 ATTCAGGTATTGATGGAGTCAGG + Intronic
904475976 1:30764800-30764822 GTTCAGGTACATATATAGCCAGG - Intergenic
904480367 1:30789515-30789537 CTTCAGGTGCGGTTGGATCCAGG + Intergenic
904658447 1:32067070-32067092 CTTCAGGTATAGTTGGATCCAGG + Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905653001 1:39668932-39668954 CTTCAGCTCCACCTGGAGCCTGG - Intronic
906137429 1:43509180-43509202 CTTCAGGCTCAGCTGGATCCAGG + Intergenic
907046093 1:51301056-51301078 CTTCAGGTAGGGCTGGATCCAGG - Intronic
908797159 1:67841974-67841996 CTGCAGGTAGAGTTGGAGCCAGG - Intergenic
908896560 1:68907494-68907516 TTTCAGATACAGCTGGAACCAGG - Intergenic
910228991 1:84967229-84967251 CTTCAGGAATAGCTGGATCCAGG - Intronic
910781500 1:90940598-90940620 CCTCAGGTACAGATGGATTTAGG - Exonic
912221109 1:107676540-107676562 CTTCAGGCAGAGATGGATCCAGG - Intronic
912235138 1:107843036-107843058 CTTCAGGAACAAGTGGAACCAGG - Intronic
913230511 1:116737045-116737067 CTGCAGATACAGATGGGGTCTGG + Intergenic
914334473 1:146701921-146701943 CTTCAGGCACAGCTTGATCCAGG + Intergenic
914439790 1:147694685-147694707 CTTCAGGTGCTGCTGGATCCAGG + Intergenic
916170533 1:161998463-161998485 CTTGAGTTACAGAGGGGGCCTGG + Intronic
917711175 1:177687126-177687148 ATCCAGGAACAGAGGGAGCCAGG + Intergenic
917840428 1:178973122-178973144 CTTCAGGTAGAGAGGGAGTGGGG + Intergenic
919690895 1:200527504-200527526 CTTCAGACACAGCTGGATCCAGG + Intergenic
920615436 1:207487836-207487858 CTGCAGGTGCAGATGAAGGCAGG + Intronic
922063639 1:222115334-222115356 CTTTTGGTACAGATGGGGTCTGG + Intergenic
922414045 1:225403928-225403950 CTGGAGGTACTGGTGGAGCCAGG - Intronic
924145918 1:241074487-241074509 CTTCAGGTACAGCTGGAGCCAGG + Intronic
924795922 1:247292067-247292089 CCTCAGCTCCAGGTGGAGCCTGG - Intergenic
1063585085 10:7345087-7345109 CTTCACAGAGAGATGGAGCCAGG + Intronic
1064097700 10:12436136-12436158 CTTGAGTCACAGATGAAGCCGGG - Intronic
1066532754 10:36358322-36358344 TTGCAGGTAAAGATGGTGCCAGG + Intergenic
1067847528 10:49735950-49735972 CCTATGGGACAGATGGAGCCAGG + Intronic
1068667790 10:59695835-59695857 CTTTAGGTACATATGGAGGAAGG + Intronic
1069510376 10:69037706-69037728 CTTCAGGCACAGCTGGGTCCAGG - Intergenic
1070539334 10:77404972-77404994 TTTCAGGCACAGCTGGATCCGGG - Intronic
1071291327 10:84191311-84191333 CCTCAGTACCAGATGGAGCCTGG + Intergenic
1071727667 10:88216333-88216355 CTTCAGGCACAGCTGGATCTAGG + Intergenic
1072953914 10:99872339-99872361 GTTCAGGAACAGAGGCAGCCAGG + Intergenic
1074200156 10:111227444-111227466 CTTCAGGCATGGATGGATCCAGG + Intergenic
1074368393 10:112878610-112878632 CTTCAGGTACAGCTGAATCCAGG - Intergenic
1074369563 10:112888958-112888980 CTTCAGGCACAGCTGTATCCAGG - Intergenic
1075079377 10:119372610-119372632 CTTCAGGTATGGCTGGATCCAGG + Intronic
1075099264 10:119494444-119494466 CTTCACACACAGCTGGAGCCAGG - Intergenic
1075311354 10:121416520-121416542 CTTCAGATACAGCTTGATCCAGG - Intergenic
1075674462 10:124286787-124286809 CTTCAGGCTCAGCTGGATCCAGG + Intergenic
1075956600 10:126528703-126528725 CCTCAGGTCCAGATGGGGTCAGG - Intronic
1076419979 10:130324437-130324459 TTTCAGGCACAGCTGGATCCAGG - Intergenic
1076712436 10:132345754-132345776 CGTCAGGCACAGCCGGAGCCAGG + Intronic
1077014798 11:394743-394765 CTCCAGGCACAGGTGGGGCCTGG - Intronic
1078149332 11:8745348-8745370 AATCAGGTACAGATAGGGCCGGG - Intronic
1078423434 11:11230586-11230608 TTTCAGGTACAGCTGGATTCAGG - Intergenic
1078580759 11:12537913-12537935 ATTCAGATCCAGATGGAACCAGG + Intergenic
1080415907 11:32069995-32070017 TTTCAGGTACAGCTTGATCCAGG + Intronic
1081534141 11:43985116-43985138 CTCCAGGTACTGGTGCAGCCAGG - Intergenic
1081687050 11:45050123-45050145 CTTCAGGTGCAGCTGGATCCAGG - Intergenic
1081703448 11:45166161-45166183 CTTCAGGTACAGTTGGATCCAGG + Intronic
1084409484 11:68998150-68998172 CTTCAAGAACAGCTGGATCCAGG - Intergenic
1084409834 11:69000396-69000418 CTTCAGACACAGCTGGATCCAGG - Intergenic
1084644904 11:70450853-70450875 CTTCAGGTAGGGTTGGATCCAGG + Intergenic
1085174763 11:74476097-74476119 CTTCAGGCACAGATTGATCCAGG - Intergenic
1085552892 11:77391465-77391487 CTTCTGGTTTAGATGGAGCTGGG - Intronic
1085695954 11:78704960-78704982 CTGCAGGGACAGAGGGAGCTGGG - Intronic
1086739992 11:90354699-90354721 CTTCAGGAACAGGTGGATCCTGG + Intergenic
1087860619 11:103150006-103150028 CTTAAGGTAGAGAAGGAGCTTGG + Intronic
1088546048 11:110959978-110960000 CTTCTGGAACAGATGGAAGCTGG - Intergenic
1088750421 11:112837918-112837940 CTTCGGGTACAGATGAGGCCAGG + Intergenic
1089834050 11:121354370-121354392 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1090472479 11:126992484-126992506 CTTCAGGAACTGGTGGAGGCTGG - Intronic
1090652536 11:128820092-128820114 CTTCAGATACAAATAGATCCTGG - Intergenic
1091344886 11:134845963-134845985 CTCCAGGTACAGATGGGGAGGGG - Intergenic
1092883904 12:12909166-12909188 CTCAAGGTACAGATGCAGCCTGG + Exonic
1092992063 12:13912584-13912606 CTTCAGGTTCAGACAGAGCAAGG - Intronic
1093142411 12:15524567-15524589 CCTCAGGTACAGATGGGTCTGGG + Intronic
1093878730 12:24379694-24379716 CCTCAGGAACAGTTGGAACCCGG - Intergenic
1094183048 12:27612642-27612664 TTTGAAGTACAGGTGGAGCCGGG - Intronic
1095981501 12:47977111-47977133 CCTCAGGACCAGCTGGAGCCCGG - Exonic
1096156194 12:49342633-49342655 CGGCAGGTACAGATGGAACCAGG + Intergenic
1096414925 12:51404738-51404760 CTTCAGATACAGCAGGACCCAGG - Intronic
1100019067 12:90047919-90047941 CTTTAGGCACAGATGGCTCCAGG - Intergenic
1100786444 12:98083444-98083466 CTTCAGGTAAGGCTGGATCCAGG - Intergenic
1101647639 12:106645915-106645937 CCTCAGCTACAGATGGAGAAAGG + Intronic
1102175894 12:110874528-110874550 CTTCAGGCATAGCTGGATCCAGG + Intronic
1102402791 12:112644963-112644985 CTTCAGGTACAGCTGCATCCAGG - Intronic
1102525177 12:113507522-113507544 CTTCAGGCACAGTTGGATCCAGG + Intergenic
1102542573 12:113633202-113633224 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1102553650 12:113711370-113711392 CTTCAGGTGCAGCTGGACCAAGG - Intergenic
1102558499 12:113745565-113745587 CTTCAGGTGCAGCTGGACCCAGG + Intergenic
1102560381 12:113757815-113757837 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1102705409 12:114876172-114876194 CCTGAGGCAGAGATGGAGCCGGG + Intergenic
1102864138 12:116360821-116360843 TTTCAGGTCCAGCTGGATCCAGG - Intergenic
1102891550 12:116562263-116562285 TTTCAGGCACAGGTGGATCCAGG - Intergenic
1103139901 12:118539517-118539539 CTTCAGGTATAGCTGGATGCAGG + Intergenic
1103197157 12:119054693-119054715 CTTCAGTTCCAGATAGATCCAGG + Intronic
1103208087 12:119145850-119145872 CTTCAGGTACAGCTGGATTCAGG + Intronic
1103794704 12:123495295-123495317 CTTCAGGTACAGCTGGCTCCAGG - Intronic
1103845692 12:123900710-123900732 CTTCAGGCACAGCTGGATCTAGG + Intronic
1103942661 12:124509396-124509418 CTTCAGGCACAGTTGGGTCCAGG - Intronic
1103975965 12:124702944-124702966 CTTCAGGTACAGCTGGATCCAGG + Intergenic
1103979266 12:124726021-124726043 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1103981609 12:124740408-124740430 CTTCAGGTACAGCTTGATCCGGG - Intergenic
1103982286 12:124744426-124744448 TTTCAGGCACAGCTGGATCCAGG + Intergenic
1103993360 12:124813974-124813996 ATTCAGGTACAGCTTGATCCAGG - Intronic
1104086008 12:125474735-125474757 CTTTAGGCACAGCTGGATCCAGG + Intronic
1104094155 12:125541287-125541309 CTTGAGTTTCAGAAGGAGCCAGG + Intronic
1104098261 12:125581375-125581397 CTTCAGGTATAGTTGGATTCAGG + Intronic
1104216632 12:126740273-126740295 CTTCAGGCTCAGATGGATTCAGG - Intergenic
1104222980 12:126803739-126803761 CTTCAGGAACAGCTGGAGCCTGG - Intergenic
1104377415 12:128277259-128277281 CTTCAGGCACAGCTGGATCCAGG + Intronic
1104420617 12:128631669-128631691 CTTCAGGCACAGTTGGTTCCAGG + Intronic
1104434515 12:128745178-128745200 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1104517978 12:129445613-129445635 CTTCAGGCACAGCTGGATCCAGG - Intronic
1104523042 12:129493066-129493088 CTTCAAGTACAGCTGGATACAGG - Intronic
1104551604 12:129762114-129762136 CATCAGGAACAGATTGATCCAGG - Intronic
1104664344 12:130636797-130636819 CTTCAGTTACAGCTTGATCCAGG - Intronic
1104703899 12:130928345-130928367 CTGCAGGCACAGCTGGATCCAGG - Intergenic
1104785808 12:131447391-131447413 CTTCAGGTGCGGCTGGATCCAGG + Intergenic
1104958708 12:132478108-132478130 CTTCAGGTCTAGCTGGATCCAGG + Intergenic
1105378510 13:19864777-19864799 AATCAGGGACAGATGGCGCCCGG + Intergenic
1106016322 13:25872402-25872424 CTTCAGGCAGAGCTGGATCCAGG - Intronic
1106316386 13:28597779-28597801 CTTTAGGAAATGATGGAGCCAGG + Intergenic
1110593808 13:77295449-77295471 CTTGAGACACAGATGGATCCGGG - Intronic
1113105969 13:106771882-106771904 ATTCAGGGTCAGATGGACCCAGG + Intergenic
1117044984 14:51804284-51804306 CTCCAGGTACAGTTTGATCCAGG - Intergenic
1117343602 14:54812031-54812053 CATCAGGTACAGCTGGATCCAGG + Intergenic
1118182689 14:63508874-63508896 CTTAAGGTCCAGAAGAAGCCAGG + Intronic
1119531431 14:75364064-75364086 CTTTAGGAACAGCTGGATCCAGG + Intergenic
1119647653 14:76359941-76359963 CTTCAGGTATGGTTGGATCCAGG + Intronic
1119683670 14:76612890-76612912 ATTCAGGCACAGCTGGATCCGGG + Intergenic
1120656540 14:87197100-87197122 TTTGTGGTAGAGATGGAGCCTGG + Intergenic
1120839942 14:89076801-89076823 CTTCAGGTATAACTGGATCCAGG + Intergenic
1121432429 14:93897297-93897319 CTGCAGGTACAGCTGGCTCCAGG - Intergenic
1121442963 14:93960251-93960273 CCTCAGTTACAGAGGGACCCTGG - Intronic
1122061922 14:99141621-99141643 CTTCAGGTACGGCTGGATCCAGG - Intergenic
1122604336 14:102938289-102938311 CATCAGGTACAGGGGAAGCCTGG - Exonic
1122652578 14:103233511-103233533 CTTCAGGTAGGGCTGGATCCAGG + Intergenic
1122903075 14:104789909-104789931 CTTCAGGGACAGAAGGGACCGGG - Intronic
1123627393 15:22237230-22237252 CTTCAGGCACAACTGGATCCAGG - Intergenic
1124256413 15:28146328-28146350 CTTCAGGTGCAGAAGGACTCAGG - Exonic
1124348382 15:28937486-28937508 CTTCAGGAACCGAGGGAACCTGG - Intronic
1124439992 15:29678686-29678708 CTTCAGGTGCAGCTGGATCCAGG + Intergenic
1124552030 15:30690396-30690418 CTGCAGCTTCAGATGGCGCCTGG - Intronic
1124635982 15:31365586-31365608 ATACAGGTGCAGCTGGAGCCGGG + Intronic
1124679213 15:31715276-31715298 CTGCAGCTTCAGATGGCGCCTGG + Intronic
1126621379 15:50643365-50643387 CTGCAGTTACAACTGGAGCCTGG - Exonic
1128520851 15:68373895-68373917 CTGCAGGTACAGTTTGATCCAGG - Intronic
1128786917 15:70404354-70404376 CCTGAGGCACAGATGGATCCAGG - Intergenic
1129152089 15:73695750-73695772 CTTCAGGCATAGCTGGATCCAGG + Intronic
1129373543 15:75113137-75113159 CTTCTGGCTCAGATGGAGGCAGG - Intronic
1129828895 15:78654117-78654139 CTTCAGGGATGGATGAAGCCAGG + Intronic
1130550430 15:84887100-84887122 TTTCAGGTATAGTTGGATCCAGG + Intronic
1130606071 15:85318187-85318209 ATTCAGGTACAGCTGGATCCAGG - Intergenic
1130849838 15:87782172-87782194 CTTCAGGCACAGCTGGAACCAGG + Intergenic
1132215318 15:100057878-100057900 CTTCAGGCACTGCTGGATCCAGG - Intronic
1132411300 15:101579988-101580010 CTTCAGGCATAGCTGGACCCAGG + Intergenic
1133338537 16:5022049-5022071 CTTCAGGTATAGCTGGATCCAGG + Intergenic
1133431461 16:5740610-5740632 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1133532919 16:6672621-6672643 CTTCAGGTACACATGGATCCAGG + Intronic
1133661398 16:7921450-7921472 CTTAAGGTACAGCTGGATCCAGG - Intergenic
1134037384 16:11041420-11041442 CTTCAGGCAAAGCTGGATCCAGG + Intronic
1134396803 16:13872631-13872653 ATTCAGGAACAGCTGGATCCAGG - Intergenic
1134410712 16:14001263-14001285 CTTCGGGCACAGCTGGATCCAGG + Intergenic
1135048843 16:19176091-19176113 CTTCAGGCATAGCTGGATCCAGG + Intronic
1135099458 16:19593576-19593598 CTTCAGGTGCAGCTGGATCCAGG + Intronic
1135353538 16:21750473-21750495 GTTCAGATACAGCTGGATCCAGG + Intronic
1135452026 16:22566600-22566622 GTTCAGATACAGCTGGATCCAGG + Intergenic
1135502093 16:23005095-23005117 CTTCAGGTATAGGTCGATCCAGG - Intergenic
1135527380 16:23224312-23224334 CTTCAGGTATGGCTGGATCCAGG + Intergenic
1135806113 16:25544454-25544476 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1135875623 16:26197383-26197405 CTTCAGGCATAGTTGGATCCAGG - Intergenic
1135885800 16:26306321-26306343 ATTCAGGTACAGCTTGATCCAGG + Intergenic
1135968574 16:27055573-27055595 CCTCAGGTACAGACGGGACCTGG + Intergenic
1135978752 16:27129845-27129867 TTTCAGGCACAGTTGGATCCAGG + Intergenic
1136050406 16:27646184-27646206 CTTCAGGTGCAGCTGGATCCAGG + Intronic
1136064130 16:27747397-27747419 CTTTAGGCACAGCTGGATCCAGG + Intronic
1136079686 16:27843678-27843700 CTTCAGACACAGCTGGATCCAGG - Intronic
1136084606 16:27875949-27875971 CTTCAGGCACAGCTGCATCCAGG - Intronic
1136086040 16:27885775-27885797 CTTCAGGAACAGCTGGAACCAGG - Intronic
1136233285 16:28900343-28900365 CTGCAGGTGCTGATGGTGCCAGG - Intronic
1136251413 16:29008049-29008071 CTTCAGGAACAAGTGGATCCAGG - Intergenic
1137374610 16:47941899-47941921 CTTCAGGCACAATTGGATCCAGG + Intergenic
1137520478 16:49191015-49191037 CTTCAGATACAAATGGATTCAGG + Intergenic
1137595010 16:49717610-49717632 CTTCAGGTGCAGCTGAATCCAGG - Intronic
1138246132 16:55468455-55468477 TTTCAGGTATAGCTGGATCCAGG + Intronic
1138447285 16:57072099-57072121 CTTCAGGCACAGCTGGATCCAGG + Intronic
1139439628 16:66959564-66959586 CTTCGGGTATAGATGCTGCCAGG - Intergenic
1139466647 16:67157575-67157597 CTTCAGGGACGGCTGGATCCAGG - Intronic
1139558541 16:67727734-67727756 CTGCAGGTACAGGATGAGCCGGG - Exonic
1139999148 16:71009311-71009333 CTTCAGGCACAGCTTGATCCAGG - Intronic
1140094355 16:71862179-71862201 CTTAAGGAACAGTGGGAGCCAGG + Intronic
1140855071 16:78970848-78970870 CTTCAGGCACGGCTGGATCCAGG + Intronic
1141293943 16:82749236-82749258 CTTTAGGTACAGCTGGATCCAGG - Intronic
1141988234 16:87593918-87593940 CTTCAGGTACTGCTGGATCCAGG + Intergenic
1142124806 16:88404968-88404990 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1142188277 16:88705216-88705238 CTCCTGGTACAGAGGGAGCTGGG - Intronic
1142873498 17:2836674-2836696 CTTCAGGTCCAGCTAGATCCAGG + Intronic
1143284912 17:5781744-5781766 CTGCAGGTACAGGTGGAGGATGG + Intronic
1143606363 17:7988705-7988727 CTTCAGGCACAGCTGGATTCAGG - Intergenic
1143606815 17:7991705-7991727 CTTCAGGCACAGCTGGATTCAGG + Intergenic
1143732541 17:8889148-8889170 CTACACCTACAGCTGGAGCCAGG - Exonic
1143831860 17:9658774-9658796 CTTCAGGTAGGGCTGGATCCAGG + Intronic
1144811412 17:18002263-18002285 CTTGAGGTAGGGATCGAGCCTGG + Intronic
1146636629 17:34511251-34511273 CTTCAGGCACATCTGGATCCAGG + Intergenic
1146949667 17:36897121-36897143 CTTCAGGTGCAGCTGGATCCAGG + Intergenic
1149398891 17:56273888-56273910 CTTCAGGTACAGTTTGATTCAGG + Intronic
1149488058 17:57059882-57059904 CTTCAGACACAGTTGGATCCAGG - Intergenic
1150857065 17:68763416-68763438 TTTCAGGTACAGTTGGAACATGG - Intergenic
1151402396 17:73864355-73864377 CTTCATTTACAGATGGAAGCTGG + Intergenic
1151552115 17:74828218-74828240 CCTCAGGGACATCTGGAGCCAGG + Intronic
1151994449 17:77599896-77599918 CTTCAGGTATGGCTGGATCCAGG + Intergenic
1152182073 17:78828707-78828729 CTTCAGTAACAGATGGAGAATGG + Intronic
1152366074 17:79857227-79857249 CTCCAGGTTGGGATGGAGCCAGG + Intergenic
1155919520 18:31589117-31589139 CTACAGTTACAGATGGATTCTGG + Intergenic
1156245761 18:35296330-35296352 TATCAGGAACAGAGGGAGCCTGG + Intergenic
1156482479 18:37444987-37445009 CTTCAGGTGCAGACAGAGGCTGG + Intronic
1157905728 18:51568291-51568313 CTTCAGGCATGGCTGGAGCCAGG + Intergenic
1158310941 18:56157600-56157622 CTTCAGGTACAGCAGGATCTAGG + Intergenic
1159951133 18:74484784-74484806 CTTCAAATTCATATGGAGCCAGG + Intergenic
1160053649 18:75459637-75459659 CATCAGCTTCAGATGGAGCTGGG + Intergenic
1160158818 18:76455441-76455463 GCTCAGGGACAGATGGAGGCTGG + Intronic
1160539906 18:79614875-79614897 TTTCAGGTACAGACGTAGCTGGG - Intergenic
1160678507 19:402964-402986 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1160737577 19:671018-671040 GTTCAGGCACAGCTGGATCCAGG + Intergenic
1160926989 19:1551259-1551281 TTTCAGGCACAGCTGGATCCAGG + Intergenic
1160938169 19:1607454-1607476 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1161302225 19:3548201-3548223 CTGCAGGTGCAGCAGGAGCCAGG + Exonic
1161316678 19:3620576-3620598 CTTCAGGTAAGGCTGGATCCAGG - Intronic
1161455179 19:4366376-4366398 CTTCAGGCACAGCTGGATCCCGG - Intronic
1161503024 19:4627921-4627943 CTTCAGGTATGGTTGGATCCAGG + Intergenic
1161616379 19:5273080-5273102 CTTCAGGTTCAGCTGGATCCAGG - Intronic
1161623881 19:5314417-5314439 CTTCAGGCATAGTTGGATCCAGG - Intronic
1161773396 19:6243413-6243435 CTTCTGGGAGAGATGGAGCCAGG + Intronic
1161914709 19:7219748-7219770 TTTCAGGTACAGCTAGATCCAGG + Intronic
1162055068 19:8057725-8057747 CTTCAGGCTCAGCTGGATCCAGG + Intronic
1162496879 19:11028313-11028335 CTTCAGGCACAGCTGGATCCAGG + Intronic
1162556740 19:11391466-11391488 CTTCAGGCACAGTTGCATCCAGG - Intronic
1162882234 19:13668305-13668327 CTTCAGGCTCAGCTGGATCCAGG + Intergenic
1162902107 19:13801241-13801263 CTTCAGGTCCAGATGGGGTTGGG + Intronic
1162913095 19:13860542-13860564 CTGGAATTACAGATGGAGCCCGG - Intergenic
1162928368 19:13942223-13942245 CTTCAGGCACAGCTGGATCCAGG + Intronic
1163183338 19:15619110-15619132 CTTCAGGCACAACTGGATCCAGG + Intronic
1163257930 19:16168795-16168817 TGTCAGGTACAGCTGGAACCAGG - Intronic
1163540910 19:17909632-17909654 CTTCAGGTGCAGCTGGCTCCAGG + Intergenic
1163572527 19:18090846-18090868 GATCAGGAACAGATGGAGGCCGG + Intronic
1163654137 19:18535872-18535894 CTTCAGGCATAGCTGGATCCAGG - Intronic
1163668893 19:18616237-18616259 CTTCAGGCACAGCTGGATCCAGG + Intronic
1163768516 19:19176963-19176985 TGTCAGGTACAGTTGGATCCAGG + Exonic
1163784422 19:19267453-19267475 CTTCAGGTATGGCTGGATCCAGG - Intronic
1164678764 19:30120238-30120260 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1164916251 19:32054469-32054491 CTTCAGGTATAGCTGGATCCAGG - Intergenic
1165118343 19:33543131-33543153 CTTCAGTTACGGCTGGATCCAGG + Intergenic
1165341546 19:35215809-35215831 CTTCAGGCACAGTTAGATCCAGG - Intergenic
1165766664 19:38355776-38355798 CTTCAGGTATGGCTGGATCCAGG + Intronic
1165863546 19:38922062-38922084 CTTCAGGTGCGGCTGGATCCAGG - Exonic
1166770593 19:45279735-45279757 CTTCAGGCACAGTTGTATCCAGG + Intronic
1167090737 19:47341866-47341888 CTTCAGGCATAGCTGGATCCAGG + Exonic
1167097180 19:47380734-47380756 CTTCAGGCACAGCTGGATCCAGG + Intronic
1167215552 19:48162093-48162115 CTGCAGGCACAGCTGGATCCAGG - Intronic
1167292010 19:48629699-48629721 CTACAGGCACAGATGCACCCTGG + Exonic
1167536184 19:50053334-50053356 CTTCAGGAACAGATGGATCCAGG - Intronic
1167536778 19:50058605-50058627 CTTCAGGAACAGATGGATCCAGG - Intergenic
1167702474 19:51058182-51058204 CTTTAGGCACAGATGGATCCAGG - Intronic
1167745830 19:51351360-51351382 CTTCAGGCACAGCTTGATCCAGG - Intronic
926054226 2:9764849-9764871 CTTCAGGAACAAATGAAGCAGGG - Intergenic
926460055 2:13117957-13117979 CTGTAGTTAGAGATGGAGCCTGG - Intergenic
927081114 2:19631473-19631495 CTTCAGGAACAGCTGGAACCAGG - Intergenic
927851953 2:26504859-26504881 CTGTAGGTCCAGGTGGAGCCAGG + Intronic
928013224 2:27629909-27629931 CTTCATGTACTGCTGGATCCAGG - Exonic
928452302 2:31387778-31387800 CCTCAGGGACAGATCCAGCCGGG - Intronic
929032096 2:37658691-37658713 CTTGATGTAGAGATGGAGGCGGG - Intronic
929237174 2:39617758-39617780 GTTTAGGTACAGCTGGATCCAGG - Intergenic
930020797 2:47000977-47000999 CTGGAGGCACAGAAGGAGCCAGG + Intronic
930090075 2:47525556-47525578 CTTGAAGTACAGATGGCCCCTGG - Intronic
931992027 2:67800034-67800056 CTTAAGGCATAGATGGTGCCTGG + Intergenic
934985598 2:98882576-98882598 CTTCAGGAATAGCTGGATCCAGG - Intronic
937304241 2:120861415-120861437 ATTCAGCTCCAGGTGGAGCCTGG + Intronic
937468742 2:122157315-122157337 CCTCAGGGACAGAAGGAGCAAGG + Intergenic
938004368 2:127775952-127775974 TATAAGGTATAGATGGAGCCTGG - Intronic
938277456 2:130038555-130038577 CTTCAGTCACAGATGGGGGCTGG - Intergenic
938307731 2:130266407-130266429 CCTGAGGTCCAGATGGACCCTGG - Intergenic
938328426 2:130429358-130429380 CTTCAGTCACAGATGGGGGCTGG - Intergenic
938361520 2:130692136-130692158 CTTCAGTCACAGATGGGGGCTGG + Intergenic
938437927 2:131298825-131298847 CTTCAGTCACAGATGGGGGCTGG + Intronic
938595695 2:132785120-132785142 CCTCAGGTACAGAGGGAGAGGGG - Exonic
938694556 2:133823453-133823475 CTTCAGTGACACATGGAGCTGGG - Intergenic
938948737 2:136238154-136238176 CTTCAGGTAAAGATGGATCCAGG + Intergenic
942389229 2:175475161-175475183 CTGCAGGTGCAGATGGTTCCAGG + Intergenic
942399005 2:175581328-175581350 CACCAGACACAGATGGAGCCAGG + Intergenic
943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG + Intronic
943717933 2:191172809-191172831 TTTCAGGTAATGAGGGAGCCAGG - Intergenic
945172852 2:207014923-207014945 CTTCAGGGACAGGTGGACCTAGG - Intergenic
946059597 2:216930364-216930386 CTTCAGGTATAGCTGGACCCAGG + Intergenic
946309600 2:218875951-218875973 ATTCAGGTACAGCTGAACCCAGG + Intergenic
947643383 2:231720396-231720418 CTTCAGGTACAGCAGGATTCAGG + Intergenic
948108063 2:235430899-235430921 CTTCAGGAACAGCTGGATCCAGG - Intergenic
948439278 2:237976194-237976216 CTTGTGCTGCAGATGGAGCCCGG - Intronic
948772125 2:240256997-240257019 TTTCAGGCACAGCTGGATCCAGG + Intergenic
948826240 2:240574607-240574629 CTGCAGGTCAAGCTGGAGCCAGG + Exonic
949055270 2:241924750-241924772 CTTCAGGTATGGCTGGATCCAGG + Intergenic
1168983793 20:2030073-2030095 CTTCAGGAACAGGTGGATCCAGG + Intergenic
1169268490 20:4181954-4181976 CTTCAGGTACTGCTGGATCATGG - Exonic
1169860487 20:10146317-10146339 CTTCAGGTATGGCTGGATCCAGG - Intergenic
1170194784 20:13678838-13678860 CTTCAGGTTCAGTTGGATCAAGG - Intergenic
1172630187 20:36373251-36373273 CTTCAGGCTCAGCTGGATCCAGG + Intronic
1172692867 20:36802702-36802724 CTTCAGGTATAGCTGGATCCAGG - Intronic
1172692875 20:36802757-36802779 CTTCAGGTATAGCTGGATCTAGG - Intronic
1172897117 20:38308016-38308038 CTTCAGGTTCAGCTTGAGGCAGG + Intronic
1173650985 20:44664050-44664072 CTTAGGATACAGAAGGAGCCAGG + Intergenic
1173916804 20:46714119-46714141 CTTCAGGTGCAGTTGGATCTAGG + Intronic
1173942320 20:46921779-46921801 CTTCAGGAACAGCTGGATCCAGG - Intronic
1174068423 20:47882864-47882886 CTTCAGGTACTGCTGCATCCGGG + Intergenic
1174085219 20:48003199-48003221 CTTCAGGCATGGATGGATCCAGG + Intergenic
1174107766 20:48175004-48175026 CTTCAGGTATAGGTAGATCCAGG - Intergenic
1174113667 20:48212989-48213011 CTTCAGGCACAGCTGCATCCAGG + Intergenic
1174168188 20:48599552-48599574 CTTCAGGCACAGCTGCATCCAGG - Intergenic
1174200573 20:48803843-48803865 CCTCAGGCACAGTTGGATCCAGG - Intronic
1174267755 20:49344328-49344350 CTTCAGGTATGGCTGGATCCAGG + Intergenic
1174327251 20:49789256-49789278 CTTCAGGTACAGCTGGATTCAGG - Intergenic
1174407848 20:50313624-50313646 TTTCAGGTACAGTGGGATCCAGG - Intergenic
1174412873 20:50347204-50347226 CTTCAGATACAGCTGGATCCAGG - Intergenic
1174518219 20:51109606-51109628 CTTCAGGCATGGATGGATCCAGG - Intergenic
1175052009 20:56164400-56164422 CTTCAGGTATAGCTGGATGCAGG - Intergenic
1175117589 20:56694048-56694070 CTTCAGGCACAGATGGATCTAGG + Intergenic
1175118195 20:56698699-56698721 CTTCAGGTACAGCTGGATCCGGG + Intergenic
1175122322 20:56725276-56725298 CTTCAGGCACGGCTGGATCCAGG + Intergenic
1175228460 20:57459163-57459185 CTTCAGGCACAGATGGATCCAGG + Intergenic
1175304187 20:57964798-57964820 CTGCAGGCACAGCTGGATCCAGG + Intergenic
1175367502 20:58466335-58466357 CTTCAGGTCTGGGTGGAGCCCGG - Intronic
1175678131 20:60964877-60964899 CTTCAGGAACACCTGGACCCAGG + Intergenic
1175749146 20:61483239-61483261 TTTCAGGTCCAGCTGGATCCAGG - Intronic
1175831335 20:61966678-61966700 CTTCAGGCACGGCTGGATCCAGG + Intronic
1176119806 20:63449200-63449222 CTTCAGGCACAGCTGGATCCAGG - Intronic
1176708658 21:10132644-10132666 CCTGATGTACATATGGAGCCTGG - Intergenic
1176916632 21:14633629-14633651 CTTCATGGACAAATGGAGCAGGG + Intronic
1178317249 21:31576930-31576952 CTTCAGGTAGAGTTGGATTCAGG - Intergenic
1179658189 21:42858605-42858627 CATGAGGGACAGATGGGGCCTGG + Intronic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1181298100 22:21858343-21858365 CTTTAGGTATAGTTGGAACCAGG - Intronic
1181733782 22:24866532-24866554 CTTCAGGCATGGATGGATCCAGG + Intronic
1182230859 22:28836592-28836614 CTTCAAGTACAAATGGATCCAGG + Intergenic
1182533231 22:30978764-30978786 CTTCAGGCACGGTTGGATCCAGG - Intergenic
1182756547 22:32684364-32684386 CTTCAGGCACAGCTGGATCTAGG - Intronic
1182884174 22:33759151-33759173 CTTCAGGCAGAGTTGGATCCAGG - Intronic
1183232934 22:36594088-36594110 CTTCAGGCACAGATGGATCCAGG + Intronic
1183261737 22:36799809-36799831 CTTCAGGAACAGCTGGATCAAGG - Intergenic
1183345723 22:37306667-37306689 CTTCAGGTTCAGCTAGATCCAGG + Intronic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
949264040 3:2136265-2136287 CTTCAGGTACAGCTTCATCCAGG - Intronic
949385602 3:3498844-3498866 CTTCAGGTATAGTTTGATCCAGG + Intergenic
949394979 3:3605034-3605056 GTTCAGGCACAGTTGGAGTCAGG - Intergenic
949876078 3:8626855-8626877 CTTCAGGCCCAGCTGGATCCGGG - Intronic
949921821 3:9009049-9009071 CTTCAGGCACAGCTGGATCCAGG - Intronic
949922345 3:9013017-9013039 CTTCAGGTATAGCTTGATCCAGG - Intronic
949996723 3:9623117-9623139 CTACAGTTACAGAGGGAGCATGG + Intergenic
950047814 3:9960879-9960901 CTTCAGGCACAGCTGGGTCCAGG - Intergenic
950132761 3:10558578-10558600 CTTCAGGCACAGCTGGATCCAGG - Intronic
950192901 3:10990633-10990655 CTTCAGGTATGGCTGGATCCAGG + Intergenic
950441036 3:13010594-13010616 CTTCAGGTACAGTTGGATTCGGG - Intronic
952968054 3:38633131-38633153 CTGCAGGTCCAGCTGGGGCCGGG + Exonic
953376327 3:42431445-42431467 CTTCAGGTAGATCTGGAGCTGGG - Intergenic
954034089 3:47841173-47841195 CTCAAGGTACAGATGGAGGATGG + Exonic
954381083 3:50219570-50219592 CTTCAAGTATAGCTGCAGCCTGG + Intronic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
954948510 3:54448036-54448058 CTTCAGGTAAGGATGAATCCAGG + Intronic
955003537 3:54948969-54948991 CTTCAGGTACAGTTGGATCTGGG + Intronic
955352003 3:58200494-58200516 CTTCAGGCATAGCTGGATCCAGG - Intronic
955483977 3:59417414-59417436 CTTCAGATATGGCTGGAGCCGGG + Intergenic
955511484 3:59685327-59685349 CTTCAGGCACAGATGGATCCAGG + Intergenic
955527156 3:59832911-59832933 CTTCAGGCACAGCTGGATTCAGG - Intronic
955999061 3:64709439-64709461 CTTCAGGCACAGTTGGATCCAGG + Intergenic
956656795 3:71560095-71560117 CTTCAGGTACAGATGGAGCCAGG - Intronic
956668623 3:71664966-71664988 CTTCAGGCACAGCTTGATCCAGG - Intergenic
956722885 3:72133818-72133840 CTTCAGGTATAGCTGGATCCAGG + Intergenic
956894350 3:73644545-73644567 CTTCAGGCACAGATGGATTCAGG - Intergenic
960525862 3:118708983-118709005 CTTCCGGACCAGATGGAGGCTGG - Intergenic
960883391 3:122369377-122369399 CTTCAGCTACAGAAGGAAGCTGG + Intronic
961368072 3:126413939-126413961 CTTTAGGCACAGCTGGATCCAGG + Intronic
961515315 3:127428752-127428774 CTTCAGGCACAGCTGGATCCAGG + Intergenic
961517655 3:127448209-127448231 CTTCTGGCACAGCTGGATCCAGG + Intergenic
961537622 3:127579633-127579655 CTTCAGGTATGGCTGGATCCAGG - Intronic
961673388 3:128550431-128550453 CTTCAGGTGCAGGTGAATCCAGG - Intergenic
961741285 3:129034580-129034602 CTTCAGGCACAGCTGGGTCCAGG + Intronic
962121515 3:132565380-132565402 CTTCAGGTACTGATGGAAGCTGG + Intronic
962805483 3:138924063-138924085 CTTCAGGTATAACTGGATCCAGG + Intergenic
963598896 3:147360362-147360384 CTTCAGGCCCAGATGGGGACTGG - Intergenic
964199183 3:154098796-154098818 CTTCAGGTATTGGTGGATCCAGG - Intergenic
964807145 3:160622890-160622912 CTTCAGGGACAGATGAATCCAGG - Intergenic
965678265 3:171222713-171222735 CTTCAGAAAGAGATGGAGGCTGG + Intronic
965940819 3:174179281-174179303 CTACAGGTACACATGGACCTTGG - Intronic
966578968 3:181537660-181537682 CTTGAGGTACAAATAGGGCCAGG - Intergenic
967280738 3:187821243-187821265 CTACAGGTAGAAATGGATCCTGG + Intergenic
967716268 3:192765516-192765538 CTTCAGGAACAGCTGGAATCAGG + Intronic
968628180 4:1637417-1637439 CTCGAGGGACAGAGGGAGCCTGG + Intronic
969298500 4:6283452-6283474 CTTCAGGCACGGCTGGATCCAGG + Intronic
969310257 4:6348808-6348830 CTTCAGGTGCAGCTTGATCCAGG - Intronic
971699775 4:29956108-29956130 CTTCAGGTACAGCAGGATTCAGG + Intergenic
973866247 4:55116782-55116804 CTTCAGCAATGGATGGAGCCAGG - Intronic
974102001 4:57427440-57427462 CTTCATGTAAGGAAGGAGCCAGG - Intergenic
974433494 4:61828749-61828771 CATCAGCAACAGCTGGAGCCTGG + Intronic
975031758 4:69629202-69629224 CTCCAGGTAGAAAGGGAGCCAGG + Intronic
975543991 4:75543358-75543380 CTTCAGGTACAGCTGGATCTAGG + Intronic
975618334 4:76270108-76270130 CTTCAGGCACAGCTGGATCCAGG + Intronic
976832222 4:89328407-89328429 CTTCAGGCACAGGTTGATCCAGG + Intergenic
977971294 4:103217412-103217434 GCTCAGGTACATATGGAACCTGG + Intergenic
981048075 4:140283972-140283994 CTTCAAGTACAGATGCACCGAGG - Intronic
982116465 4:152102596-152102618 CTTCAGCTACAGCTGGAGCAGGG - Intergenic
985774732 5:1834943-1834965 CTCCGGGCAGAGATGGAGCCTGG + Intergenic
985948404 5:3204162-3204184 CTTCAGGCACAGCTGTACCCAGG - Intergenic
986757590 5:10852660-10852682 TTTCAGGTACAGCTTGATCCAGG - Intergenic
988487440 5:31678486-31678508 TCTCAGGGACAGCTGGAGCCTGG + Intronic
992358028 5:76005805-76005827 CTTCAGGTTCAGCTGGATCCAGG - Intergenic
993190369 5:84672639-84672661 CTTCAGGTTCAGAAGGTGACAGG + Intergenic
994074620 5:95636646-95636668 CTTCAGGCAGAGCTGGATCCAGG + Intergenic
996307192 5:122060796-122060818 CTGCAGGAGCAGATGGAACCAGG - Intronic
997516683 5:134495014-134495036 CTTCAGGCACAGTTTGATCCAGG - Intergenic
997726743 5:136127251-136127273 CTTCAGGTACAGCTGGATCCAGG + Intergenic
998207657 5:140170345-140170367 TTTCAGGTATAGCTGGATCCAGG - Intergenic
998765040 5:145477217-145477239 CTTCAGGTACAGCTGGATCCAGG + Intronic
999076944 5:148805565-148805587 CTTCAGGGAGAGGTGGAGACTGG + Intergenic
999233140 5:150074183-150074205 CTTCAGGAACACTTGGATCCAGG - Intronic
999805481 5:155077298-155077320 CTTTAGTGACAGATGGAGCATGG - Intergenic
1000278372 5:159760450-159760472 CTTCAGGCACAGATGGGTTCAGG - Intergenic
1000810411 5:165854499-165854521 CTTCAGGCACAGCTAGATCCAGG - Intergenic
1001050661 5:168411524-168411546 CTTCAGGCACAGCTGGATCCAGG + Intronic
1001146625 5:169190374-169190396 CTTCAGGAACAGCTGGATCCAGG - Intronic
1001198762 5:169697186-169697208 CTTCAGGCATAGCTGGATCCAGG + Intronic
1001255985 5:170183913-170183935 CTTCAGGGAGTGAGGGAGCCTGG - Intergenic
1001330820 5:170761170-170761192 TGCCTGGTACAGATGGAGCCTGG + Intergenic
1001404093 5:171463377-171463399 CTTCAGGCAAAGCTGGATCCAGG + Intergenic
1001441186 5:171744238-171744260 CTTCAGGAACTGATGGATCCAGG + Intergenic
1001452817 5:171839273-171839295 CTTCAGGCACAGCTGGATCCAGG + Intergenic
1001454505 5:171850336-171850358 CTTTAGGCACAGCTGGATCCAGG - Intergenic
1001492646 5:172166285-172166307 CTTCAGGTACAGCTGTCTCCAGG - Intronic
1001564981 5:172694210-172694232 CTTCAGGAACAGCTAGATCCGGG + Intergenic
1001757526 5:174182009-174182031 CTTCAGGCTCAGCTGGATCCAGG + Intronic
1002080631 5:176735200-176735222 CTTCAGGCCCAGCTGGATCCAGG - Intergenic
1002081041 5:176737650-176737672 CTTCAGGTACGGCTGAATCCAGG + Intergenic
1002082745 5:176747358-176747380 CTTCAGGCACAGCTGGATCCAGG + Intergenic
1002129688 5:177072849-177072871 CTTCAGGCATAGCTGGATCCAGG - Intronic
1004743081 6:18482081-18482103 ATAGAGGTACAGATGGAGGCAGG - Intergenic
1005909488 6:30295708-30295730 CCTCAGGTACAACTGGAACCAGG + Intergenic
1005944272 6:30584278-30584300 CTTCAGGGACAGCTGGAACAAGG + Exonic
1006460647 6:34155673-34155695 CTTCTGGGATAGCTGGAGCCTGG - Intergenic
1007124180 6:39411128-39411150 TTTCAGGTACAGCTGGGACCAGG + Intronic
1008960498 6:57261270-57261292 CTTAAGGGACAAAAGGAGCCAGG + Intergenic
1009537793 6:64911929-64911951 CTTCAGATACGGCTGGATCCAGG + Intronic
1015393832 6:132713522-132713544 TTTCTGGTACAGATGGAGGATGG - Intronic
1017995440 6:159528010-159528032 AATCAGATGCAGATGGAGCCTGG + Intergenic
1019356904 7:585007-585029 CTTCAGGCACGGCTGGATCCAGG - Intronic
1019516497 7:1442504-1442526 CATCAGGCACAGCTGGATCCAGG + Intronic
1020254389 7:6494550-6494572 CTTCAGGTATGGCTGGATCCAGG + Intergenic
1020264917 7:6553871-6553893 TTTCAGGCACAGCTGGATCCAGG - Intergenic
1022717239 7:32909720-32909742 CCTAAGGAACAGATGGAGTCTGG - Intergenic
1024606883 7:51028821-51028843 CTTCAGGCACAGACGAAGACAGG + Exonic
1025034705 7:55586987-55587009 CCTGAGGTTCAGATGGACCCTGG - Intergenic
1026937063 7:74263602-74263624 ATTCAGGCAGAGATGGAGACAGG - Intergenic
1028364460 7:90011241-90011263 ATTCAGGCACAGCTGGATCCAGG - Intergenic
1031380794 7:121083624-121083646 AGGGAGGTACAGATGGAGCCAGG + Intronic
1033420202 7:141198805-141198827 CTCCAGGTACAGTTTCAGCCAGG - Intronic
1035451345 7:158979129-158979151 CTACAGCTGCAGATGGAGCTGGG + Intergenic
1035785610 8:2258029-2258051 CCTCAGGGACAGCTGCAGCCAGG + Intergenic
1035807197 8:2463687-2463709 CCTCAGGGACAGCTGCAGCCAGG - Intergenic
1037523890 8:19706303-19706325 ATACAGATACAGATTGAGCCTGG - Intronic
1037709428 8:21343782-21343804 CATCAGGTAGAGCTGGAGGCAGG - Intergenic
1039827920 8:41190468-41190490 CTTCAGGTGGCCATGGAGCCAGG + Intergenic
1043375433 8:79644244-79644266 CATCAGGAACAGCTGGATCCAGG + Intronic
1043875794 8:85484603-85484625 CAGCAGACACAGATGGAGCCAGG - Intergenic
1044716285 8:95102678-95102700 CTGCTGGTACTGAAGGAGCCAGG + Intronic
1044868660 8:96597119-96597141 TTTCAGGAACAGATGGGGCTGGG + Intronic
1044871865 8:96627654-96627676 CTTCAGGCACAGCTGGATCTTGG + Intergenic
1045208274 8:100066861-100066883 ATTCAGGGGCAGATGGAGTCAGG - Intronic
1046716514 8:117573757-117573779 CTTCAGGCACAGCTGTAACCAGG - Intergenic
1047132163 8:122033640-122033662 AGTCACATACAGATGGAGCCAGG + Intergenic
1047716522 8:127600604-127600626 TTTCAGGGACAGATGGATCCAGG + Intergenic
1047728956 8:127709995-127710017 CTTCAGGTACAGTTGGATCAAGG - Intergenic
1047974825 8:130119647-130119669 ATTCAGGTACAGCTGGATCCAGG - Intronic
1048491714 8:134900467-134900489 CTTCAGGCACAGCTAGATCCAGG + Intergenic
1049784805 8:144445209-144445231 CTTCAGCTGCAGAAGTAGCCCGG + Intergenic
1050365137 9:4867170-4867192 CTTCAGGTAAAGCTGGATCTAGG + Intronic
1051243708 9:15086849-15086871 CTTGAGGAACAGATGTAGCAAGG - Intergenic
1052415593 9:28172638-28172660 CTTCAGGGAAAGATGGAGAAAGG + Intronic
1052454521 9:28678254-28678276 CTTTCAGCACAGATGGAGCCTGG - Intergenic
1053645629 9:40118140-40118162 CCTGATGTACACATGGAGCCTGG - Intergenic
1053652243 9:40180970-40180992 CTTCAGGTACAGCTAGATTCAGG + Intergenic
1053760080 9:41345369-41345391 CCTGATGTACACATGGAGCCTGG + Intergenic
1053902638 9:42810283-42810305 CTTCAGGTACAGCTAGATTCAGG + Intergenic
1054326644 9:63716041-63716063 CCTGATGTACACATGGAGCCTGG - Intergenic
1054532339 9:66195235-66195257 CTTCAGGTACAGCTAGATTCAGG - Intergenic
1054538944 9:66257832-66257854 CCTGATGTACACATGGAGCCTGG + Intergenic
1055649175 9:78390292-78390314 CATCAGGTATAGCTGGATCCAGG - Intergenic
1055726080 9:79230444-79230466 CATCAGGTACAGCTGGAAACAGG + Intergenic
1056367768 9:85922865-85922887 CTGGAGGTTCAGGTGGAGCCAGG + Intergenic
1056368367 9:85929198-85929220 ACTCAGGAACTGATGGAGCCAGG + Intergenic
1056774768 9:89503210-89503232 CTCCAGGTACAGTTAGATCCAGG + Intergenic
1057522353 9:95770087-95770109 CTTCAGGCACAGCTGGATCTAGG - Intergenic
1057891526 9:98873651-98873673 CTTCAGGCACAGCTGGATCCAGG + Intergenic
1059358520 9:113720072-113720094 CTCCAGCTGCAGATGGAGGCGGG - Intergenic
1060202920 9:121662292-121662314 ATTCAGGTCCAGAAGGAGTCAGG + Intronic
1060406656 9:123376219-123376241 CTGGAGGTACAGAGGGAGGCTGG + Intronic
1060818549 9:126648693-126648715 CTTCAGGTGAAGATGAGGCCTGG + Intronic
1060826090 9:126688857-126688879 CTTGAGGATCAGATGGGGCCAGG + Intronic
1060887739 9:127167428-127167450 CTTCAGGGTCAGATGGACTCCGG + Intronic
1061064898 9:128271535-128271557 TTTCAGGAACACAGGGAGCCTGG - Intronic
1061207280 9:129172145-129172167 CTTCAGGCACAGCAGGATCCAGG - Intergenic
1061297415 9:129684309-129684331 CTTCAGGCACTGCTGGATCCAGG + Intronic
1062118703 9:134822594-134822616 CTGCAGGTACACATGGCCCCCGG + Intronic
1062194905 9:135267570-135267592 CTTCAGTTACAGATGGACTTTGG + Intergenic
1062235094 9:135504059-135504081 CTGCAGGGCCAGAAGGAGCCCGG + Exonic
1062535581 9:137019835-137019857 CTTAAGGGACACATGGAGACAGG - Intronic
1202793419 9_KI270719v1_random:101613-101635 CCTGATGTACATATGGAGCCTGG - Intergenic
1185519794 X:729788-729810 GGTCAGGTACAGATGGGACCAGG + Intergenic
1185596932 X:1312896-1312918 CTTGGGGAAGAGATGGAGCCAGG + Intergenic
1187826609 X:23337439-23337461 CTTTTGGTAGATATGGAGCCAGG + Intronic
1189308019 X:40001922-40001944 CTTCAGGTTCAACTGGATCCAGG + Intergenic
1189424101 X:40882610-40882632 CTTCAGGTACAGATGGGGAAAGG + Intergenic
1192129983 X:68540724-68540746 CTTCAGGCACAGCTGGACTCAGG - Intergenic
1193276786 X:79598240-79598262 CTCCACCTACAAATGGAGCCTGG - Intergenic
1196668474 X:118341560-118341582 CTTCAGGTATGGCTGGATCCAGG - Intergenic