ID: 956659393

View in Genome Browser
Species Human (GRCh38)
Location 3:71583326-71583348
Sequence GCCCCCACCCATCCCAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 5, 3: 50, 4: 371}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956659389_956659393 -6 Left 956659389 3:71583309-71583331 CCGCGCGCCGGCCCGCAGCCCCC 0: 1
1: 2
2: 10
3: 109
4: 797
Right 956659393 3:71583326-71583348 GCCCCCACCCATCCCAGAGCTGG 0: 1
1: 0
2: 5
3: 50
4: 371
956659383_956659393 10 Left 956659383 3:71583293-71583315 CCGGAGCTCCCTCCACCCGCGCG 0: 1
1: 0
2: 0
3: 16
4: 187
Right 956659393 3:71583326-71583348 GCCCCCACCCATCCCAGAGCTGG 0: 1
1: 0
2: 5
3: 50
4: 371
956659380_956659393 29 Left 956659380 3:71583274-71583296 CCAAAGGGTGCGGGCGCCGCCGG 0: 1
1: 0
2: 0
3: 8
4: 76
Right 956659393 3:71583326-71583348 GCCCCCACCCATCCCAGAGCTGG 0: 1
1: 0
2: 5
3: 50
4: 371
956659379_956659393 30 Left 956659379 3:71583273-71583295 CCCAAAGGGTGCGGGCGCCGCCG 0: 1
1: 0
2: 0
3: 3
4: 37
Right 956659393 3:71583326-71583348 GCCCCCACCCATCCCAGAGCTGG 0: 1
1: 0
2: 5
3: 50
4: 371
956659387_956659393 -2 Left 956659387 3:71583305-71583327 CCACCCGCGCGCCGGCCCGCAGC 0: 1
1: 1
2: 8
3: 53
4: 515
Right 956659393 3:71583326-71583348 GCCCCCACCCATCCCAGAGCTGG 0: 1
1: 0
2: 5
3: 50
4: 371
956659385_956659393 2 Left 956659385 3:71583301-71583323 CCCTCCACCCGCGCGCCGGCCCG 0: 1
1: 0
2: 2
3: 33
4: 341
Right 956659393 3:71583326-71583348 GCCCCCACCCATCCCAGAGCTGG 0: 1
1: 0
2: 5
3: 50
4: 371
956659388_956659393 -5 Left 956659388 3:71583308-71583330 CCCGCGCGCCGGCCCGCAGCCCC 0: 1
1: 0
2: 13
3: 84
4: 643
Right 956659393 3:71583326-71583348 GCCCCCACCCATCCCAGAGCTGG 0: 1
1: 0
2: 5
3: 50
4: 371
956659386_956659393 1 Left 956659386 3:71583302-71583324 CCTCCACCCGCGCGCCGGCCCGC 0: 1
1: 0
2: 14
3: 94
4: 694
Right 956659393 3:71583326-71583348 GCCCCCACCCATCCCAGAGCTGG 0: 1
1: 0
2: 5
3: 50
4: 371
956659382_956659393 13 Left 956659382 3:71583290-71583312 CCGCCGGAGCTCCCTCCACCCGC 0: 1
1: 0
2: 0
3: 30
4: 327
Right 956659393 3:71583326-71583348 GCCCCCACCCATCCCAGAGCTGG 0: 1
1: 0
2: 5
3: 50
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956659393 Original CRISPR GCCCCCACCCATCCCAGAGC TGG Intronic
900159440 1:1216519-1216541 GCCCCCACACGCCACAGAGCAGG + Intergenic
900208085 1:1440012-1440034 GCCCCATCCCCGCCCAGAGCCGG + Exonic
900737690 1:4309387-4309409 GCCCCCACCCACCCCACAACAGG - Intergenic
900853760 1:5164408-5164430 GCCCCCACACATGTCAGGGCTGG + Intergenic
900881732 1:5386489-5386511 CCCACCTCTCATCCCAGAGCAGG + Intergenic
901221694 1:7587127-7587149 CCCCACTCCCATCCCAGACCAGG + Intronic
901660330 1:10794962-10794984 GCCCCCTCCCCTTCCAGACCCGG + Intronic
902032156 1:13430795-13430817 GGCCTCACCCAGCCCAGAGAGGG + Intergenic
902465378 1:16613976-16613998 GCCCCCAGCTCTCCCAGAGGTGG + Intergenic
902546719 1:17194876-17194898 TCAGCCACCCATCCCACAGCTGG - Intergenic
903115551 1:21176404-21176426 GCCACCAACCCCCCCAGAGCGGG + Intronic
903324043 1:22559494-22559516 CCCACCCCACATCCCAGAGCAGG - Intergenic
904331193 1:29758638-29758660 CCCACCACCTACCCCAGAGCTGG - Intergenic
904415488 1:30358925-30358947 CCCACCACCTACCCCAGAGCTGG + Intergenic
904661562 1:32089418-32089440 CACCACACCCAGCCCAGAGCTGG + Intronic
904956528 1:34288825-34288847 AGCCCCACCCATCCTAGAGAGGG + Intergenic
907275531 1:53314742-53314764 TCCCCCTTCCATCCCAGTGCAGG - Intronic
907708220 1:56851366-56851388 CCCCTCCCCCATCCCAGTGCAGG + Intergenic
910159759 1:84260316-84260338 GCCCACACTCAGCCCTGAGCAGG + Intergenic
911161942 1:94690138-94690160 ATGCCCACCCATCCCAGAGTAGG + Intergenic
915169756 1:153969402-153969424 GCCCACATCCTGCCCAGAGCAGG + Exonic
915563211 1:156699738-156699760 GCCCCAAACCAGCCCAGAGCAGG - Exonic
920248370 1:204605456-204605478 GTCCCCACCCATCCCCAGGCAGG - Intergenic
922465950 1:225845720-225845742 GCCCCCACCCCTCCCAGCGCAGG + Exonic
922685963 1:227639065-227639087 GCCCCCATCCCTTCCCGAGCAGG - Intronic
923200510 1:231706343-231706365 TGCCCCACCCATGTCAGAGCTGG - Intronic
923468482 1:234269259-234269281 GGCCTCACCCTTCCCACAGCTGG + Intronic
923789551 1:237100301-237100323 GAGTCCACCCATCCCAGATCAGG - Intronic
923890987 1:238214643-238214665 AGCCCCACCCATCACAGACCTGG - Intergenic
1062824098 10:556156-556178 GCACCCACCCCTCCCACAGCCGG + Intronic
1062824112 10:556194-556216 CCACCCACCCCTCCCACAGCCGG + Intronic
1062824127 10:556232-556254 CCACCCACCCCTCCCACAGCCGG + Intronic
1062824140 10:556266-556288 GCACCCACCCCTCCCACAGCCGG + Intronic
1062824171 10:556343-556365 CCACCCACCCCTCCCACAGCCGG + Intronic
1065554853 10:26905487-26905509 GGCCTCAGCCAGCCCAGAGCGGG - Intergenic
1066025533 10:31355551-31355573 CTCCCCCACCATCCCAGAGCAGG - Intronic
1067080995 10:43212095-43212117 GCCCCAACCTCTCCCAGGGCTGG - Intronic
1067226910 10:44382551-44382573 AGCCCCACCCATCCCAGCGGGGG - Intronic
1067428294 10:46225737-46225759 GCCTCGCCCCAGCCCAGAGCTGG + Intergenic
1067734016 10:48834998-48835020 GCCCTCACCCAAGACAGAGCCGG - Intronic
1067739292 10:48882209-48882231 GACCCTCCCCACCCCAGAGCAGG - Intronic
1070664893 10:78336067-78336089 GCCCCCACCCATCTGGGTGCAGG + Intergenic
1070751862 10:78968644-78968666 ACCCTGCCCCATCCCAGAGCTGG + Intergenic
1071563542 10:86660213-86660235 CCCCCCACCCACCCCGGGGCTGG - Intronic
1071956989 10:90770557-90770579 GCCTGCTCCCATCTCAGAGCGGG + Intronic
1072163265 10:92787767-92787789 GTCCCAACCTATCCCAGAGAGGG - Intergenic
1072199909 10:93149160-93149182 GTCTCCTCCCATCCCAGAGTGGG + Intergenic
1073084272 10:100878443-100878465 GCTCCCATCCTTCCCAGAGCTGG + Intergenic
1073344908 10:102775763-102775785 ACCCCCACCCCTGCCAGAGTCGG - Intronic
1073351662 10:102824344-102824366 ACCCCCGCCCCTCCCAGACCTGG + Intergenic
1073439280 10:103543168-103543190 GCCCCCAGCCACCCCACTGCAGG - Intronic
1074455662 10:113593354-113593376 GCCCCACCCCATCCCACAACTGG + Intronic
1074546285 10:114404307-114404329 GCCCCCACCCAGCCCGGACCTGG - Intronic
1074784325 10:116825685-116825707 TCCCCCACCAATCCCAGCCCTGG - Intergenic
1075789181 10:125071215-125071237 GCTCCTTCCCTTCCCAGAGCAGG - Intronic
1076373526 10:129969142-129969164 GCTCCCACCCACCCCGGGGCAGG + Intergenic
1076540902 10:131214170-131214192 GCTCCCACCCCTCCCTGGGCAGG - Intronic
1076612681 10:131736538-131736560 GCCCCCACCCATGCCATGCCGGG - Intergenic
1076769562 10:132655665-132655687 CCCCCCACCCCTCCCACTGCAGG - Intronic
1076847633 10:133077104-133077126 CCCCCCACCCAGCCCAGCCCAGG + Intronic
1077161065 11:1113141-1113163 GCCCTGCCCCTTCCCAGAGCAGG + Intergenic
1077216800 11:1398421-1398443 GCCACCACCCTTCCCGGGGCGGG - Intronic
1078079628 11:8194416-8194438 GGACCCAGTCATCCCAGAGCTGG - Intergenic
1078115866 11:8449625-8449647 CCCCCCACCCACCCCACAACAGG - Intronic
1078687957 11:13550305-13550327 GCCTTAACCCTTCCCAGAGCTGG - Intergenic
1079076912 11:17389700-17389722 GGCGCCACCAATCCCAGGGCTGG + Intergenic
1079354431 11:19718053-19718075 ACCCCCACCCTTCCCAGTGCAGG + Intronic
1079391025 11:20022302-20022324 ACCCCTTCCCATCCCAGAGCTGG + Intronic
1083228955 11:61303012-61303034 CTCCCCACCACTCCCAGAGCTGG + Intronic
1083304676 11:61756178-61756200 CCCCTTACCCATCCCACAGCCGG - Intronic
1083540939 11:63511122-63511144 GCCCCCAGCCCTGACAGAGCAGG - Intronic
1083731285 11:64653919-64653941 GCTCCAACCCTCCCCAGAGCTGG + Intronic
1083744931 11:64730125-64730147 GCGCCCCCCCAACACAGAGCTGG + Exonic
1083864506 11:65446239-65446261 GCCCCCTCCCATCCCCAAGAGGG + Intergenic
1083894599 11:65613766-65613788 TCCTCCACACATCCCAGCGCCGG - Exonic
1083923543 11:65792919-65792941 GCACCCTGCCATCCCACAGCCGG - Intronic
1084045343 11:66564801-66564823 ACCCCTTCCCATCTCAGAGCTGG - Exonic
1084089193 11:66869235-66869257 GCCCCCACCCATCCCAGGCTCGG + Intronic
1084785335 11:71438666-71438688 GCCTCCTCCCCTCCCAGGGCTGG + Intronic
1085761043 11:79241830-79241852 ACCCCCACTCATCCCTGAGCTGG + Intronic
1086244255 11:84732788-84732810 CCCCCCACCCACCCCACAACAGG + Intronic
1086334126 11:85782386-85782408 CCCCCCACCCATCACAGGTCTGG - Intronic
1089466699 11:118690319-118690341 GCCCCCTCCCGACCCTGAGCAGG - Intergenic
1089515270 11:119028089-119028111 CTCCACACCCAACCCAGAGCAGG - Intronic
1090440967 11:126725529-126725551 GCCCCCGCTCATCCCCAAGCTGG + Intronic
1091591467 12:1845370-1845392 CCCCCCACCCATCCCTGCGGAGG - Intronic
1092122662 12:6055491-6055513 TCCCCAAGACATCCCAGAGCTGG + Intronic
1096227891 12:49881175-49881197 GCCCCCACCCACCCCGGCTCTGG + Intronic
1096681632 12:53259311-53259333 GCCCCCTCCCCTCCCAGGGCAGG - Intergenic
1097040488 12:56153313-56153335 GCCCCCACCCAGCCAAGAACTGG - Intronic
1100444853 12:94650684-94650706 CCCCCCACCCACCCCCGACCCGG + Intergenic
1101157054 12:101937777-101937799 TTCACCACCCCTCCCAGAGCTGG + Intronic
1101969760 12:109304764-109304786 GCCCTCCCACATCCCAGAGAAGG - Intronic
1102060360 12:109926680-109926702 ACCCTCTCCCATCTCAGAGCAGG + Intronic
1103059873 12:117849927-117849949 GCCCCAGCTCAACCCAGAGCTGG - Intronic
1103364057 12:120369449-120369471 CCCCCCACCCACCCCGGCGCGGG + Intergenic
1103526474 12:121572531-121572553 GCCCCCCTTCATCCCAGAGAGGG + Intronic
1103614384 12:122142930-122142952 ACCTCCACCCAGCCCAGATCTGG - Exonic
1103963917 12:124626195-124626217 GTCCCCACCCATCCCAGAGGAGG - Intergenic
1105071132 12:133235297-133235319 AACCCCGCCCCTCCCAGAGCCGG - Exonic
1105831377 13:24165391-24165413 ACCCCCATTCATACCAGAGCAGG + Intronic
1105889870 13:24674906-24674928 GCTCCCACGCTTTCCAGAGCTGG - Intergenic
1107014134 13:35695307-35695329 GCCCCCACCCCTCCCACTCCTGG + Intergenic
1107553007 13:41494494-41494516 GCCCCCACCCAGCCAAGATCAGG + Intergenic
1108532825 13:51343399-51343421 TCCCCCAGGCATCCCATAGCTGG - Intronic
1111442897 13:88304235-88304257 GGCCCCTCCCATCACAGAACTGG + Intergenic
1114504252 14:23196861-23196883 GCCCCCACCCACCCCATTCCTGG + Intronic
1118324207 14:64770516-64770538 GCCCCCTCACATCCCAGGGCTGG + Intronic
1119338108 14:73851790-73851812 GCCCCCTCCCCTCCCAGGGGCGG - Intergenic
1119478984 14:74948180-74948202 GCTGCCTCCCATCCCAGAGAAGG + Intronic
1121694137 14:95899238-95899260 GCCACCAACCATCCCAGATGTGG - Intergenic
1122088143 14:99320984-99321006 GCCCCCAGCCAGCCCAGAGGAGG + Intergenic
1122264863 14:100541797-100541819 GCTCCCAGCTGTCCCAGAGCTGG - Intronic
1122885191 14:104707644-104707666 GCCCCCACCCCTGCCAGGCCTGG + Exonic
1122922326 14:104885171-104885193 GCCCCTCCCCTTCCCAGGGCTGG + Intronic
1123095574 14:105765581-105765603 GCCCCCACCCAGGCAGGAGCTGG - Intergenic
1202835934 14_GL000009v2_random:77287-77309 GCACCGTCCCATCCCAGAACTGG - Intergenic
1123499271 15:20865845-20865867 GCCTCCTCCCATCCCAGGCCCGG + Intronic
1123556506 15:21439464-21439486 GCCTCCTCCCATCCCAGGCCCGG + Intronic
1123592745 15:21876810-21876832 GCCTCCTCCCATCCCAGGCCCGG + Intergenic
1125881116 15:43196972-43196994 TCCCTCCCCCACCCCAGAGCTGG + Exonic
1127968013 15:63938391-63938413 GACCCCACAGATCCCAGGGCAGG - Intronic
1128075122 15:64821077-64821099 GCCCCCACCAGTCCAAGAGCTGG - Exonic
1128477302 15:68008209-68008231 GCACCCTCACATGCCAGAGCAGG - Intergenic
1129262956 15:74379056-74379078 TCCCACACCCACCCCAGGGCAGG - Intergenic
1129660143 15:77548816-77548838 TCCCCCACCCTTCACACAGCCGG - Intergenic
1129691723 15:77717702-77717724 GCCCCCACCAAGCCCAGGCCCGG + Intronic
1129738429 15:77978260-77978282 GCCCCCACCCAGCTCAGACCTGG - Intergenic
1129738872 15:77980224-77980246 GTCCCCACCCAGCCTAGAGACGG + Intergenic
1129847090 15:78772970-78772992 GCCCCCACCCAGCCTGGAGATGG - Intronic
1129847644 15:78775349-78775371 GCCCCCACCCAGCTCAGACCTGG + Intronic
1130254812 15:82320920-82320942 GCCCCCACCCAGCCTAGAGATGG + Intergenic
1130600161 15:85269086-85269108 GCCCCCACCCAGCCTAGAGATGG - Intergenic
1130600710 15:85271410-85271432 GCCCCCACCCAGCTCAGACCTGG + Intergenic
1131512432 15:93056675-93056697 GCCCTCAGCCCACCCAGAGCTGG - Intronic
1132090984 15:98947856-98947878 TCCCCCACCCACAACAGAGCTGG - Intronic
1132279704 15:100602500-100602522 ACCCCCACCCATCCCGGACCTGG + Intronic
1132450572 15:101966004-101966026 GCACCCACCCACCACAGGGCAGG - Intergenic
1132685455 16:1160183-1160205 GTCCCCGCCCTTCCCACAGCGGG - Intronic
1132715687 16:1288920-1288942 GTCCCCACCCACCCCAGGGCTGG + Intergenic
1132731955 16:1367063-1367085 CCCCTCACCCTGCCCAGAGCAGG + Intronic
1132851657 16:2027386-2027408 GCCCCCCCCCACCCCCGTGCAGG - Intronic
1133220461 16:4317213-4317235 GCCCCCAGCCATCACAGCCCAGG + Intronic
1133221243 16:4320001-4320023 GCCCCCACCCATCCCCCAGCAGG - Intronic
1133223235 16:4328119-4328141 GCCCCCACCTGACCGAGAGCCGG + Intronic
1133272078 16:4615135-4615157 ACCCCCATCCGTGCCAGAGCAGG - Intergenic
1133693670 16:8240083-8240105 GCCTTCACTCATCCCAAAGCTGG - Intergenic
1133944948 16:10340293-10340315 TCTCCCTCCCATCCCAGAGCAGG + Intronic
1133999157 16:10769179-10769201 GACCCACCCCATCCCGGAGCTGG - Exonic
1134855394 16:17514509-17514531 GCCTCCACCCCTCACAGTGCTGG - Intergenic
1135235030 16:20747201-20747223 TCTCCCTGCCATCCCAGAGCAGG + Intronic
1136077731 16:27828399-27828421 GCCATCACCAATCCCACAGCTGG + Intronic
1136230571 16:28883140-28883162 GCCCCCACCCCTCCCTGGCCAGG - Intronic
1137021814 16:35435675-35435697 GCCCCCACCCATTTCATAGACGG + Intergenic
1137574839 16:49592749-49592771 GCCCCCACCTCTGCCAGAACCGG + Intronic
1137677917 16:50313067-50313089 GCCCCCACCCATGCTGGAGAGGG + Intronic
1137926368 16:52546181-52546203 TCCCCCACCTACTCCAGAGCCGG - Intronic
1138483368 16:57318738-57318760 TCCCCCACCCACCCCAGGGAAGG - Intergenic
1139591491 16:67935697-67935719 GACCCCGCCCATCCTCGAGCAGG - Exonic
1139651521 16:68364698-68364720 GCCCACAGCCTCCCCAGAGCTGG + Intronic
1140965997 16:79966571-79966593 GCCTCCACCCATCCCAAAGCAGG + Intergenic
1140974375 16:80044890-80044912 CCCCCCCCCCATCCCCTAGCTGG - Intergenic
1141010181 16:80389601-80389623 GCCTCCCTCCTTCCCAGAGCAGG + Intergenic
1141250832 16:82357545-82357567 GCATCCACCCCTCCCAGAGGAGG - Intergenic
1141460531 16:84176344-84176366 TGCCCCACCCATCCCAGGCCGGG - Intronic
1141499235 16:84432069-84432091 GGCCCCACCCAGCCCCGAGTTGG - Intronic
1141526221 16:84613829-84613851 CCCCCCACCCACTCCAGAGGTGG + Intronic
1141575965 16:84963766-84963788 ACACCCACCCCTCCCAAAGCTGG - Intergenic
1142144201 16:88486022-88486044 GCCCCGAGCCCTCCCAGCGCAGG + Exonic
1142191920 16:88722044-88722066 GCGCCTGCGCATCCCAGAGCTGG - Exonic
1142303199 16:89270748-89270770 GTCACCACCCATCACAGAACTGG + Intronic
1142483143 17:230627-230649 GACCACACCCAACCCAGACCAGG - Intronic
1142592140 17:1010941-1010963 GCCCCCACCCACTCCAGCTCTGG + Intronic
1142885380 17:2909355-2909377 CGCCCCACCCCTCCCAGGGCTGG - Intronic
1143803881 17:9409084-9409106 GCCCCCGCCCCCACCAGAGCTGG + Intronic
1143884329 17:10054821-10054843 GCTCCCACCCACCCGAGAACTGG + Intronic
1144421360 17:15102139-15102161 GCCCCAACCCATCCCAGGAAAGG - Intergenic
1144767777 17:17742105-17742127 CCCACCTCCCACCCCAGAGCCGG - Intronic
1144802547 17:17940467-17940489 GCCCCCACCCAGCTCAGGGATGG + Intronic
1146481487 17:33208384-33208406 TCCCCAACCCATCCCAGACTCGG + Intronic
1147340539 17:39751070-39751092 GCCCCCTCCCTTCTCAGTGCTGG + Intergenic
1147507151 17:41029947-41029969 GCCACCACCAATGCCACAGCCGG + Exonic
1147690240 17:42310357-42310379 GCCCCCACCCCACCCCAAGCTGG - Intronic
1148081689 17:44970442-44970464 GCGCCCACCCACCCCCGCGCCGG + Intergenic
1148124839 17:45231267-45231289 AGCCCCACCCAGCCCAGCGCTGG - Intronic
1148572125 17:48678551-48678573 GCCCCCAGCACTCCCGGAGCTGG + Intergenic
1149334360 17:55620199-55620221 ACCCCCACCCCTCCAATAGCAGG - Intergenic
1149434311 17:56620075-56620097 GTCCCCACCCTGCCCAGATCTGG - Intergenic
1149517983 17:57294865-57294887 GCCTGCACCCAACCCAGAGCAGG - Intronic
1149993730 17:61396520-61396542 GCCCCCACCCCAACCAGACCTGG + Intergenic
1150074220 17:62179035-62179057 GCCCCCGCCAATACCACAGCTGG + Intergenic
1150488444 17:65559818-65559840 GCGTGCACCCATCCCAGATCCGG - Intronic
1151977713 17:77491880-77491902 GCCCCTCCCTATCCCACAGCAGG - Intronic
1152135827 17:78502867-78502889 GCCCCCACCCGCCTCAGACCTGG + Exonic
1152266047 17:79295495-79295517 GCCCCTGCCCTTCCCTGAGCTGG - Intronic
1152349917 17:79778568-79778590 GCCCCCGCCCCCCTCAGAGCCGG - Intronic
1152386361 17:79977248-79977270 GCCCCGCCCCATCCCAGAGACGG + Intronic
1152587981 17:81197559-81197581 GCCCCCACCCGGCCCCCAGCAGG - Intronic
1152614853 17:81333390-81333412 GCCATCTCCCACCCCAGAGCTGG + Intergenic
1152679233 17:81657062-81657084 GCCCCCAGCCAGCCCAGAGAAGG + Intronic
1157696835 18:49729846-49729868 GCCCCCACCCTTCACAGATGGGG - Intergenic
1158278815 18:55798627-55798649 CCCCCCACCCACCCCACAACAGG + Intergenic
1158757849 18:60348319-60348341 CCCTCCACCCACCCCAGAACAGG + Intergenic
1160159755 18:76462019-76462041 GCTCCCACCCTTCCCACATCCGG + Intronic
1160451076 18:78966312-78966334 GCCCCCACCCATTGCTGACCAGG + Intergenic
1160465414 18:79072701-79072723 GCCCCCCCACCTCCCAGACCAGG + Intronic
1160586771 18:79917532-79917554 GTCCCCAGCCACCCCACAGCTGG - Intronic
1160691292 19:461574-461596 CCCCCCCCCCACCCCCGAGCCGG - Intergenic
1161059392 19:2207495-2207517 GACCTCACCCACCCCAGGGCAGG - Intronic
1161217154 19:3100260-3100282 GCCTCCACCCACACCAGACCAGG + Intronic
1161810536 19:6468640-6468662 GCCCCCACCCTTTGCAGAACCGG - Exonic
1162362936 19:10230615-10230637 CCCACGACCCATCCCTGAGCCGG + Intronic
1162396403 19:10420335-10420357 GCCCCCTCCCAGCCCGGAGCGGG + Intronic
1162808678 19:13151747-13151769 GCCCCTCCCCATCCCCGACCCGG - Intronic
1163202751 19:15780264-15780286 GCCCCTCCCCATCCCAGGCCAGG + Intergenic
1163316197 19:16542254-16542276 GCCCCGCCCCCTCCCAGACCCGG + Intronic
1163506399 19:17709657-17709679 GCTCCCTGGCATCCCAGAGCAGG + Intergenic
1163646915 19:18494829-18494851 GGCCCCACCCGTACCTGAGCTGG + Intronic
1164390937 19:27820567-27820589 CCACCCACCCATCCCATAACAGG - Intergenic
1164461943 19:28456443-28456465 GCCCCCACCCACGCTGGAGCTGG + Intergenic
1165247310 19:34505011-34505033 GCCTCCACCCAGCCCAGCTCTGG + Exonic
1165359885 19:35329710-35329732 GCTCCAGCCCGTCCCAGAGCAGG + Intronic
1166546304 19:43636347-43636369 GCCTGCACCCTTCCCGGAGCAGG - Intronic
1166930394 19:46298319-46298341 GCCCCCACCCAGCCAGGAGGGGG - Intronic
1167048951 19:47067291-47067313 CCCCCTACCCATCCCCAAGCAGG - Exonic
1167113491 19:47475385-47475407 GCACCCACTCTTCCCAGACCTGG - Exonic
1167220776 19:48196788-48196810 TCCCCCAGCAATCCCTGAGCAGG - Intronic
1167293212 19:48635667-48635689 GCCCGCACCCTCCCCAGGGCCGG - Exonic
1167492532 19:49800895-49800917 GCACCCACCGATCCCGGAGAGGG + Intronic
1202636703 1_KI270706v1_random:50075-50097 GCACCGTCCCATCCCAGAACTGG + Intergenic
925846881 2:8042846-8042868 GCCCCCACTCATGCCAGTGGTGG - Intergenic
927156583 2:20224576-20224598 CCCCCCACCCTCCCCAGCGCGGG + Intronic
927721753 2:25387622-25387644 GCCACCACACAATCCAGAGCTGG + Intronic
928303583 2:30147505-30147527 GCCCCCACCCGTCGCATAGTCGG + Intronic
930015912 2:46970483-46970505 GGCATCACCCATCCCAGTGCTGG + Intronic
930187462 2:48424604-48424626 CCCTTCCCCCATCCCAGAGCCGG - Intergenic
932522363 2:72427455-72427477 GCCCACTCCCATCTCGGAGCAGG + Intronic
933551335 2:83780971-83780993 CCCACCACCAATCCCATAGCAGG + Intergenic
933900471 2:86846158-86846180 GCTCCCAGCCACCCCAGAGACGG - Intronic
934572068 2:95379128-95379150 CCCCCCACCCATCCCCCAGGAGG + Intronic
935199519 2:100844207-100844229 ACCCACACCCAGCACAGAGCTGG - Intronic
935274331 2:101463323-101463345 GCCCACACCCCTCCCACACCAGG - Intronic
936239332 2:110773553-110773575 TCCCCCACCCATCCCAGGACTGG + Intronic
936290293 2:111217527-111217549 GCACCCACCCAAACCACAGCTGG - Intergenic
936488460 2:112947681-112947703 GCCCTCACCCTGCCCAGGGCAGG - Intergenic
936786376 2:116098478-116098500 GTCCCCACACTTCCCAGAGCTGG - Intergenic
937074200 2:119089179-119089201 GGACCCTCACATCCCAGAGCAGG + Intergenic
937745105 2:125403163-125403185 TCCCCCACCCAACCTAGCGCAGG - Intergenic
942186195 2:173427173-173427195 GCCCCCAGCCATGGCAGTGCTGG + Intergenic
942984113 2:182119052-182119074 CCCACCACCCACCCCACAGCAGG + Intronic
945166344 2:206950919-206950941 GCCCCCACCCCACCCACAACTGG - Intronic
946138926 2:217671525-217671547 CCCCACCCCCATCCCAGTGCAGG + Intronic
946203848 2:218089421-218089443 GCCCCCACCCACCCCAGGGAAGG + Intronic
947711448 2:232318689-232318711 GCCCCAACCCACCCCAGGGGAGG + Intronic
947715563 2:232337369-232337391 GCACCCACTCACACCAGAGCTGG - Intronic
948407567 2:237733873-237733895 GCCCCCACCAAGCCCAGAGCCGG + Intronic
948811732 2:240481867-240481889 GCCACCTCCCATCCCAGAGACGG - Intronic
1168805293 20:669122-669144 GCCCCCACCCACCCCACCACAGG - Intronic
1168861380 20:1048349-1048371 CCACCTACCCATCCCATAGCAGG + Intergenic
1168896800 20:1329181-1329203 GGCACCACCCTTCCCAGATCAGG - Intronic
1169208680 20:3753947-3753969 CCCCACACCCACCCCAGAGAGGG + Exonic
1170828727 20:19820833-19820855 TCCACAACCCATCCCAGAGCTGG - Intergenic
1171121286 20:22571298-22571320 GCCCCCAACCATACCACATCTGG - Intergenic
1171988240 20:31675711-31675733 GCACCCACCCATACCTGGGCCGG - Intronic
1172242551 20:33423145-33423167 TCGCCCAGCCATCCCAGATCTGG + Intronic
1172389803 20:34559024-34559046 GCCCCCGCCCAGGCCGGAGCTGG - Intronic
1173596948 20:44264567-44264589 GCCCCCACCTCCCCCAGGGCTGG - Intronic
1175196163 20:57244726-57244748 GCTCCCAGCCAGGCCAGAGCAGG + Intronic
1176816846 21:13610754-13610776 GCCTCCTCCCATCCCAGGCCCGG - Intronic
1178303385 21:31470920-31470942 GCCGCCACCCACCCCCGAGGGGG + Intronic
1179814667 21:43897678-43897700 GGCTCCTCCCATCCCAGAGGGGG + Intronic
1179886021 21:44314575-44314597 CCCCCCATCCCTCCCAGAGGCGG - Intronic
1180154538 21:45971597-45971619 CCCCAGACCCAGCCCAGAGCAGG + Intergenic
1180364166 22:11924238-11924260 GCACCGTCCCATCCCAGAACTGG - Intergenic
1180970322 22:19811757-19811779 GCACCCACCCATCCCAGCCCTGG + Intronic
1181028166 22:20137490-20137512 GCCGCATCCCTTCCCAGAGCAGG + Intronic
1181926359 22:26362262-26362284 GCCCCCTGGCATTCCAGAGCAGG - Intronic
1182462297 22:30491484-30491506 CCCCCCACCCTCCCGAGAGCTGG + Intronic
1182468353 22:30532041-30532063 GCCCCCACCCATCCAAGATGGGG + Intronic
1183316834 22:37141642-37141664 GCCCACTCCAATCTCAGAGCGGG + Intronic
1183606678 22:38870629-38870651 GCCCCCTCCCACCCGACAGCCGG - Intronic
1183695204 22:39417854-39417876 GCCCCCTCCTGTCCCAGGGCAGG + Intronic
1183742598 22:39677266-39677288 GCCTCCACCCTTCCCAGGCCTGG + Intronic
1183748857 22:39707741-39707763 GGCTCGGCCCATCCCAGAGCTGG - Intergenic
1184457087 22:44616895-44616917 GCCCCCACCCAGGCCAGCCCGGG + Intergenic
1184734729 22:46391422-46391444 GCCCCCATCCATGTCAGAGCTGG + Intronic
1185035498 22:48474632-48474654 CCCCACACACAGCCCAGAGCTGG - Intergenic
1185322837 22:50209758-50209780 GTCCCCACCCAGCCCAGCACCGG - Intronic
949231597 3:1756903-1756925 GCTCCTACCCATTCCAGAGTGGG - Intergenic
950332602 3:12168396-12168418 GCCGCCAAACATCTCAGAGCAGG - Exonic
950486482 3:13276864-13276886 GCCCCCACCCAGGGCAGACCCGG - Intergenic
951960247 3:28310202-28310224 GCACCCTCCCTGCCCAGAGCAGG + Intronic
953538089 3:43791032-43791054 GCCCCCACCCAAACTATAGCAGG + Intergenic
953670573 3:44958852-44958874 GACCAAACCCCTCCCAGAGCAGG + Intronic
953691856 3:45126389-45126411 ACCCCCACCCCTCCCACAGCAGG - Intronic
953879138 3:46682581-46682603 GCCCCACCCCATGCCACAGCTGG - Intronic
954106001 3:48410144-48410166 GCCCCCACCCCTGGGAGAGCTGG - Intronic
954715127 3:52523124-52523146 GCCCCCACACACCCCATAGAAGG - Exonic
955065103 3:55527007-55527029 GCCCCCATCCAGGCCAGAACTGG - Intronic
955325974 3:58009394-58009416 GCCCACACCCATTCCAGCGACGG - Intronic
956659393 3:71583326-71583348 GCCCCCACCCATCCCAGAGCTGG + Intronic
957226262 3:77451917-77451939 TCCCCCAACCATCCCACAACAGG + Intronic
959913640 3:111793127-111793149 TCCCCCACCCAACCCAGGGCAGG + Intronic
960298049 3:115968096-115968118 GCCCCCTTCCAGCCCAAAGCAGG + Intronic
961173009 3:124812387-124812409 GCTCCCACCCACTCCACAGCTGG - Intronic
961661466 3:128470799-128470821 GCCCCCACTCAGACCAGTGCAGG - Intergenic
962046740 3:131768177-131768199 GCACCCACTCATTCTAGAGCTGG + Intronic
963112798 3:141700877-141700899 GCCCCCATCCCTTCCTGAGCTGG - Intergenic
964386420 3:156152474-156152496 GCTCCCACCCCTCCCACAGTGGG - Intronic
968230815 3:197003512-197003534 CCCCACCCCCACCCCAGAGCGGG - Intronic
968652264 4:1764922-1764944 GCCCGCACCCCTCGCAGGGCTGG - Intergenic
968664884 4:1815605-1815627 GCCCCACCCCACTCCAGAGCAGG + Intronic
968807689 4:2786420-2786442 TGCCCCACCCAGCCCAGAGCTGG - Intergenic
968898715 4:3420511-3420533 CCCCCCACCCATCCCCCACCAGG - Intronic
969578103 4:8048148-8048170 ATCCCCACCCATCGCAGAGCTGG - Intronic
969706872 4:8816628-8816650 TTCCCCACCCACCCCAGAGTTGG + Intergenic
970122202 4:12768504-12768526 GCCCTCCCCCATCCCAAACCTGG - Intergenic
970667448 4:18353973-18353995 GCCCCCCTCCAGCCCAGGGCAGG + Intergenic
973135207 4:46698808-46698830 GGCCTCACCCAGCCCAGAGAGGG - Intergenic
973279162 4:48341520-48341542 GCCTCCCCCAATCCCGGAGCCGG + Exonic
973394097 4:49578989-49579011 GCACCGTCCCATCCCAGAACTGG - Intergenic
975522734 4:75317866-75317888 GCCCCCACACCTCCCAGACAGGG - Intergenic
985030877 4:185788035-185788057 GCCCTCTCCCATCTCAGATCTGG - Intronic
1202764018 4_GL000008v2_random:135947-135969 GCGCCGTCCCATCCCAGAACTGG + Intergenic
985484230 5:139924-139946 GTCCCCACCCAAGCCACAGCAGG + Intergenic
987510279 5:18828573-18828595 AGCCCCACCCATCACAGACCTGG + Intergenic
992050753 5:72938461-72938483 TCCCCCACTCCACCCAGAGCTGG + Intergenic
993601597 5:89932789-89932811 GCCCCCAGCCTTTCAAGAGCAGG + Intergenic
995650141 5:114361255-114361277 GCCCCCACCCACCCCCGGCCGGG + Intronic
997242248 5:132315911-132315933 GCGTCCAGCCATTCCAGAGCAGG - Intronic
999194379 5:149772078-149772100 GCCCCAACCCAGATCAGAGCAGG - Intronic
1000097991 5:157987675-157987697 GCTGCCACCCAAGCCAGAGCGGG - Intergenic
1000337101 5:160249930-160249952 GTCCCCACCCCTCCTAGAGAAGG + Intergenic
1000984739 5:167854900-167854922 ACCCCCACTCATCCCTGACCTGG + Intronic
1001027184 5:168234065-168234087 GCCCCCTTCCATCCCATGGCAGG + Intronic
1001590014 5:172858733-172858755 ACCCCCACCCATGCCAGCGGGGG - Intronic
1001933195 5:175687422-175687444 GCCCCCACCCCACCCAGGGCAGG - Intergenic
1002235474 5:177799877-177799899 GCTCCCACCCAGGCCATAGCTGG + Intergenic
1006376810 6:33676315-33676337 TCTCCCTCCCATTCCAGAGCGGG + Intronic
1006406778 6:33850051-33850073 GCCCACACCCGTCCCAGCTCTGG - Intergenic
1006509878 6:34515936-34515958 GCCCCCTCCCTGCCCAGAGTTGG - Intronic
1006906076 6:37534570-37534592 GACCACCCCCTTCCCAGAGCAGG - Intergenic
1007121083 6:39382017-39382039 GTCCCCACCCCTCCCAGGGATGG - Intronic
1007594984 6:43045773-43045795 GACCCTACACATCCCAGGGCTGG - Intronic
1010782518 6:79960073-79960095 CCCCCCACCCACCCCACAACAGG - Intergenic
1011376133 6:86689100-86689122 TCCCCCCACCACCCCAGAGCAGG + Intergenic
1014157270 6:118125847-118125869 GCCCTCCTCCATCCCTGAGCTGG - Intronic
1015210767 6:130695832-130695854 TCCACCACCCATTCCAGATCAGG + Intergenic
1018273157 6:162102186-162102208 CCCCCCACCCATCCCCCAGTAGG + Intronic
1018844541 6:167546717-167546739 GCCCGCACCCCTGCCAGAGCTGG + Intergenic
1019447346 7:1078337-1078359 GCCCCCCCCCACCCCGCAGCTGG - Intronic
1019651602 7:2161981-2162003 GCCCCCGCCCATCCGGGAGGTGG + Intronic
1019708375 7:2507204-2507226 GCCCCCACCCCCCTCAGACCTGG + Intergenic
1021716570 7:23468106-23468128 TCCCCCACCCCTCCAGGAGCAGG - Intronic
1022003261 7:26245489-26245511 GCCCCCATCCCTTCCTGAGCTGG + Intergenic
1023017409 7:35981849-35981871 GCTCCCCCTCATCCCAGTGCTGG + Intergenic
1023088280 7:36594122-36594144 ACCCCCACCCTGCCCATAGCAGG + Intronic
1023191299 7:37585778-37585800 GCCCCCACCCATTGCAGTCCTGG + Intergenic
1025193393 7:56913424-56913446 CCCCCCACCCCCCCCATAGCTGG + Intergenic
1025678549 7:63663505-63663527 CCCCCCACCCCCCCCATAGCTGG - Intergenic
1026846337 7:73700877-73700899 GCCCCAACCCAACCCTGAGGAGG - Intronic
1026977655 7:74508210-74508232 GTCCCCACCCACCCAAGAGGAGG + Intronic
1028859957 7:95638027-95638049 GCCCCCACCCATCCCCTGGATGG - Intergenic
1028972623 7:96875703-96875725 CCACCCACCCAGCCCAGGGCAGG - Intergenic
1029386904 7:100249147-100249169 GCCCCCACCCACCCCACCCCAGG - Intronic
1029538378 7:101169015-101169037 TCCTCTCCCCATCCCAGAGCTGG + Intergenic
1029630355 7:101746351-101746373 GCCCCCACCCCTTCCATAGCCGG - Intergenic
1033756096 7:144399121-144399143 GCCCCCACCCAACCCAGTGAGGG - Exonic
1035244269 7:157552013-157552035 GCCAGCACCCAACCCACAGCTGG + Intronic
1036397495 8:8381593-8381615 GGCCCTCCCCAGCCCAGAGCGGG - Exonic
1036518437 8:9468088-9468110 GGCCCCTCCCATCACAGACCTGG + Intergenic
1037683832 8:21120745-21120767 ACCCCCATCCATGGCAGAGCTGG + Intergenic
1037722086 8:21453347-21453369 GCCATCACCAATGCCAGAGCAGG + Intergenic
1038486026 8:27935805-27935827 GGCTCCACGCAGCCCAGAGCAGG - Intronic
1038535463 8:28349996-28350018 TCTCCCACACATCCCAGGGCTGG - Intronic
1040438466 8:47416773-47416795 GCCCCCACCCCACCCACAACAGG + Intronic
1040446401 8:47499790-47499812 GCCCCCACCCCACCCACAACAGG + Intronic
1040464257 8:47679499-47679521 CCCCCCACCCCTTCCAGTGCTGG + Intronic
1041463665 8:58138250-58138272 GCCCCCAGCCTTCTCAGAGGAGG + Intronic
1041889184 8:62849602-62849624 CCCCCCACCCACCCCACAACAGG + Intronic
1045764196 8:105647525-105647547 GCCCCCCCCCACCCCACAACAGG + Intronic
1047210153 8:122834306-122834328 GCCCCCATCCCTTCCGGAGCCGG - Intronic
1047454638 8:124998214-124998236 GGCCCCACCCACGCCGGAGCCGG + Intergenic
1049202725 8:141349825-141349847 GCCACAGCCCAACCCAGAGCAGG - Intergenic
1049408884 8:142463714-142463736 GCCTCCACCCAAGCCTGAGCAGG - Intronic
1049487473 8:142874079-142874101 GCCCCCATCCCTCCCAGTGCTGG - Exonic
1049601248 8:143508758-143508780 GACCCCACCCAGCCCAGCCCAGG + Intronic
1052665305 9:31487672-31487694 GCCCTTACCCACCCCAGACCAGG + Intergenic
1052991193 9:34520312-34520334 GCCCCCCGCCTTCGCAGAGCTGG + Intronic
1053442472 9:38127664-38127686 GGCCCCACAGAACCCAGAGCTGG - Intergenic
1055470778 9:76608117-76608139 GCCCCCTCCAATCCCTGAGGAGG - Intergenic
1055920529 9:81455427-81455449 GCCCTCTCCCATCCCAGGGCAGG - Intergenic
1057701018 9:97363104-97363126 GCCCCCAACCAGCGCACAGCTGG - Intronic
1060146928 9:121261127-121261149 GCCCCCTCCCATCCCACTGGTGG + Intronic
1060276632 9:122187512-122187534 GCCCCCACCAAAACCAGTGCAGG + Intronic
1060405362 9:123370372-123370394 GCTCCCAGCCATCACAGAGAAGG - Exonic
1060529843 9:124341690-124341712 GCCCCAACCCACCCAGGAGCTGG - Intronic
1060826760 9:126692164-126692186 GTCCCTACCCATCCCTGGGCAGG + Intronic
1060831357 9:126719735-126719757 GACCCAACCCAGCCCAGAGTGGG + Intergenic
1061061032 9:128250640-128250662 GCCCCGCCCCAGCCCAGTGCTGG - Intronic
1061272409 9:129550677-129550699 GACCCCAACCACCCCACAGCGGG - Intergenic
1061368034 9:130182637-130182659 GCCTCCACCCACCCCAGTGGAGG + Intronic
1061572205 9:131484797-131484819 GCCCTCACCCAGCTCAGGGCTGG - Intronic
1061820277 9:133223519-133223541 GCCCACACCCTCCCCAGGGCAGG - Intergenic
1061885373 9:133588513-133588535 GCCCACCCCCACCCCAGAGTTGG - Intergenic
1062053440 9:134458706-134458728 GCCCCCACCAAACCCTCAGCAGG - Intergenic
1062240341 9:135534317-135534339 GCCCACACCCTCCCCAGGGCAGG + Intergenic
1062240356 9:135534385-135534407 GCCCACACCCTCCCCAGGGCAGG + Intergenic
1062256091 9:135622055-135622077 ACCCCCACCCTTTCCAGATCTGG + Intergenic
1062290574 9:135792564-135792586 GGCCACACCCAACTCAGAGCCGG + Exonic
1062326006 9:136012832-136012854 GCCCCCACACGCCCAAGAGCGGG + Intronic
1203530516 Un_GL000213v1:138740-138762 GCCTCCTCCCATCCCAGGCCCGG + Intergenic
1203544767 Un_KI270743v1:120820-120842 GCGCCGTCCCATCCCAGAACTGG + Intergenic
1186516759 X:10172022-10172044 GTTCCCACCATTCCCAGAGCTGG - Intronic
1187620073 X:21042667-21042689 GCCCCGACCCCTCCCTGTGCTGG - Intergenic
1189187084 X:39063843-39063865 GCCCCCACCCATGAAAGAGGGGG + Intergenic
1190732508 X:53234776-53234798 GCCCCCACCCTTGCCCCAGCTGG - Exonic
1191257274 X:58285065-58285087 CCCTGCACCCATCCCAGAGTTGG - Intergenic
1192340494 X:70259675-70259697 GCCCACCCCCATCCCTGAGCTGG + Exonic
1193997504 X:88384596-88384618 GCTCTCTCCCATCCCAGAACTGG + Intergenic
1196968673 X:121085480-121085502 TCTCCCTCCCATCCCAGAGCAGG + Intergenic
1197723758 X:129762090-129762112 TCACCACCCCATCCCAGAGCAGG + Intronic
1197726787 X:129781806-129781828 ACCCCAACCCCTGCCAGAGCCGG + Intronic
1199673732 X:150167083-150167105 GCCCTGACTCCTCCCAGAGCTGG - Intergenic
1199712633 X:150481163-150481185 GCCCTCACCCATCCCTGAGTGGG + Intronic
1200004002 X:153075592-153075614 GCCCCCACCCAGGCCACAGCTGG + Intergenic
1200237153 X:154473172-154473194 GACCCCACCCATTCCAAGGCGGG + Exonic