ID: 956660092

View in Genome Browser
Species Human (GRCh38)
Location 3:71588860-71588882
Sequence AATGTGTGTGAGACTTGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956660092_956660096 -8 Left 956660092 3:71588860-71588882 CCCAGCCAAGTCTCACACACATT No data
Right 956660096 3:71588875-71588897 CACACATTCAAGTTGGACAAAGG No data
956660092_956660098 27 Left 956660092 3:71588860-71588882 CCCAGCCAAGTCTCACACACATT No data
Right 956660098 3:71588910-71588932 CATGTGGCCCCTTATACAACAGG No data
956660092_956660097 11 Left 956660092 3:71588860-71588882 CCCAGCCAAGTCTCACACACATT No data
Right 956660097 3:71588894-71588916 AAGGTGATCTATAGTACATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956660092 Original CRISPR AATGTGTGTGAGACTTGGCT GGG (reversed) Intergenic
No off target data available for this crispr